Packaging Plasmids Research Articles

Optimized protocol for high-titer lentivirus production and transduction of primary fibroblasts.

The lentivirus-short hairpin RNA (shRNA) system is a widely used tool for RNA interference. Multiple factors may affect the RNA interference efficiency during lentivirus production and transduction procedures. Thus, an optimized protocol is required to achieve high-titer lentivirus and efficient gene delivery. In the present study, lentivirus was produced by transfecting lentiviral transfer and packaging plasmids into HEK 293T cells. The factors affecting lentiviral titer were assessed, including lentiviral plasmid ratio, lentiviral transfer plasmid type, serum type for cell culture, transfection reagent-plasmid mixture incubation time, and the inoculation density of 293T cells for transfection. The high-titer lentivirus was achieved when plasmids were transfected at a molar ratio of 1:1:1:2, and the transfection reagent-plasmid mixture was replaced 6-8 h after transfection. The pLVX-shRNA2 lentiviral transfer plasmid was associated with the highest lentiviral titer, while both pLVX-shRNA2 and psi-LVRU6GP plasmids were associated with efficient RNA interference in target cells. The serum type for 293T cell culture affected the lentiviral titer significantly, while the inoculation density of 293T cells showed no influence on transfection efficiency or lentiviral titer. Moreover, the human primary fibroblasts infected with lentivirus, using the centrifugation method, achieved higher transduction efficiency than those infected with the non-centrifugation method. In conclusion, this study helped optimize lentiviral production and transduction procedures for more efficient gene delivery.

Lentivirus-mediated Conditional Gene Expression.

The ability to identify the role of a particular gene within a system is dependent on control of the expression of that gene. In this protocol, we describe a method for stable, conditional expression of Nod-Like receptors (NLRs) in THP-1 cells using a lentiviral expression system. This system combines all the necessary components for tetracycline-inducible gene expression in a single lentivector with constitutive co-expression of a selection marker, which is an efficient means for controlling gene expression using a single viral infection of cells. This is done in a third generation lentiviral expression platform that improves the safety of lentiviruses and allows for greater gene expression than previous lentiviral platforms. The lentiviral expression plasmid is first engineered to contain the gene of interest driven by a TRE (tetracycline response element) promoter in a simple gateway cloning step and is then co-transfected into HEK293T cells, along with packaging and envelope plasmids to generate the virus. The virus is used to infect a cell type of interest at a low MOI so that the majority of the transduced cells contain a single viral integration. Infected cells are grown under selection, and viral integration is validated by qPCR. Gene expression in stably transduced cells is induced with doxycycline and validated by qPCR, immunoblot, and flow cytometry. This flexible lentiviral expression platform may be used for stable and robust induction of a gene of interest in a range of cells for multiple applications. Graphic abstract: Schematic overview of lentiviral transduction of THP-1 cells.

Creation of a High-Yield AAV Vector Production Platform in Suspension Cells Using a Design-of-Experiment Approach

Recombinant adeno-associated virus (rAAV) vectors are a leading gene delivery platform, but vector manufacturing remains a challenge. New methods are needed to increase rAAV yields and reduce costs. Past efforts to improve rAAV production have focused on optimizing a single variable at a time, but this approach does not account for the interactions of multiple factors that contribute to vector generation. Here, we utilized a design-of-experiment (DOE) methodology to optimize rAAV production in a HEK293T suspension cell system. We simultaneously varied the transgene, packaging, and helper plasmid ratios, the total DNA concentration, and the cell density to systematically evaluate the impact of each variable across 52 conditions. The results revealed a unique set of parameters with a lower concentration of transgene plasmid, a higher concentration of packaging plasmid, and a higher cell density than previously described protocols. Using this DOE-optimized protocol, we achieved unpurified yields approaching 3 × 1014 viral genomes (VGs)/L of cell culture. Additionally, we incorporated polyethylene glycol (PEG)-based virus precipitation, pH-mediated protein removal, and affinity chromatography to our downstream processing, enabling average purified yields of >1 × 1014 VGs/L for rAAV-EGFPs across 13 serotypes and capsid variants.

Construction and function of Glypican-3-targeted fourth-generation chimeric antigen receptor T cells (secreting IL-7 and CCL19)

Adoptive immunotherapy based on chimeric antigen receptor-modified T cells (CAR-T) is one of the most promising strategies to treat malignant tumors, but its application in solid tumors is still limited. Glypican-3 (GPC3) is a meaningful diagnostic, therapeutic, and prognostic biomarker for hepatocellular carcinoma (HCC). The second/third generation GPC3-targeted CAR-T cells are generated to treat HCC. In order to improve the therapeutic effect, we constructed a fourth-generation lentiviral vector to express GPC3 CAR, human interleukin-7 (IL-7) and CCL19. Then the lentiviral vector and packaging plasmids were co-transfected into HEK293T cells to generate CAR lentiviral particles. Human T lymphocyte cells were transduced with CAR lentiviral to develop the fourth-generation GPC3-targeted CAR-T cells (GPC3-BBZ-7×19). In vitro, we used cell counting, transwell assay, luciferase bioluminescence assay and flow cytometry to compare the proliferation, chemotaxis, cytotoxicity and subtype distribution between GPC3-BBZ-7×19 CAR-T cells and the second generation GPC3-targeted CAR-T cells (GPC3-BBZ). In vivo, we established GPC3-positive HCC xenograft model in immunodeficient mice, then untransduced T cells (non-CAR-T) or GPC3-BBZ-7×19 CAR-T cells were injected. Tumor growth in mice was observed by bioluminescence imaging. Results showed that compared with GPC3-BBZ CAR-T, GPC3-BBZ-7×19 CAR-T cells had stronger proliferation, chemotactic ability, and higher composition of memory stem T cells (Tscm) (P values<0.05). However, there were no significant difference in cytotoxicity and cytokine secretion between them. In addition, GPC3-BBZ-7×19 CAR-T cells could significantly eliminate GPC3-positive HCC xenografts established in immunodeficient mice. Therefore, the fourth-generation GPC3-targeted CAR-T cells (secreting IL-7 and CCL19) are expected to be more durable and effective against HCC and produce tumor-specific memory, to provide a preclinical research basis for future clinical trials.

Zikavirus prME Envelope Pseudotyped Human Immunodeficiency Virus Type-1 as a Novel Tool for Glioblastoma-Directed Virotherapy.

Glioblastoma multiforme is the most lethal type of brain tumor that is not yet curable owing to its frequent resurgence after surgery. Resistance is mainly caused by the presence of a subpopulation of tumor cells, the glioma stem cells (GSCs), which are highly resistant to radiation and chemotherapy. In 2015, Zikavirus (ZIKV)-induced microcephaly emerged in newborns, indicating that ZIKV has a specific neurotropism. Accordingly, an oncolytic tropism for infecting GSCs was demonstrated in a murine tumor model. Like other flaviviruses, ZIKV is enveloped by two proteins, prM and E. The pME expression plasmid along with the HIV-1 vector pNL Luc AM generated prME pseudotyped viral particles. Four different prME envelopes, Z1 to Z4, were cloned, and the corresponding pseudotypes, Z1- to Z4-HIVluc, produced by this two-plasmid system, were tested for entry efficiency using Vero-B4 cells. The most efficient pseudotype, Z1-HIVluc, also infected glioma-derived cell lines U87 and 86HG39. The pseudotype system was then extended by using a three-plasmid system including pME-Z1, the HIV-1 packaging plasmid psPAX2, and the lentiviral vector pLenti-luciferase-P2A-Neo. The corresponding pseudotype, designated Z1-LENTIluc, also infected U87 and 86HG39 cells. Altogether, a pseudotyped virus especially targeting glioma-derived cells might be a promising candidate for a prospective glioblastoma-directed virotherapy.

Subcellular localization of GTPase of immunity-associated protein 2

To analyze the subcellular localization of GTPase of immunity-associated protein 2 (GIMAP2) for the further functional study. In the study, we first obtained the protein sequences of GTPase of immunity-associated protein 2 (GIMAP2) from National Center for Biotechnology Information (NCBI) database, and then performed a prediction analysis of its transmembrane structure, nuclear localization signal (NLS), nuclear export signal (NES) and subcellular localization through bioinformatics online tools. GIMAP2 gene amplified by PCR was inserted into the expression vector pQCXIP-mCherry-N1 and positive clones were selected by ampicillin resistance. After using methods to extract and purify, the sequenced recombinant plasmid pQCXIP-GIMAP2-mCherry, together with the retroviral packaging plasmids VSVG and Gag/pol, was transferred into HEK293FT cells by liposomes for virus packaging. The virus supernatant was collected 48 h after transfection and directly infected the human breast cancer cell line MDA-MB-436. Immunofluorescence staining was constructed to detect the localization of endogenous and exogenous GIMAP2 in MDA-MB-436 cells. Meanwhile, green fluorescent chemical dyes were used to label mitochondria, endoplasmic reticulum, and lipid droplets in living MDA-MB-436 cells stably expressing the GIMAP2-mCherry fusion protein. Images for the three dye-labeled organelles and GIMAP2-mCherry fusion protein were captured by super-resolution microscope N-SIM. Bioinformatics analysis data showed that GIMAP2 protein composed of 337 amino acids might contain two transmembrane helix (TM) structures at the carboxyl terminus, of which TMs were estimated to contain 40-41 expected amino acids, followed by the residual protein structures toward the cytoplasmic side. NES was located at the 279-281 amino acids of the carboxyl terminus whereas NLS was not found. GIMAP2 might locate in the lumen of the endoplasmic reticulum. Sequencing results indicated that the expression vector pQCXIP-GIMAP2-mCherry was successfully constructed. Fluorescent staining confirmed that GIMAP2-mCherry fusion protein, co-localized well with endogenous GIMAP2, expressed successfully in the endoplasmic reticulum and on the surface of lipid droplets in MDA-MB-436 cells. GIMAP2 localizes in the endoplasmic reticulum and on the surface of LDs, suggesting potential involvement of GIMAP2 in lipid metabolism.

Construction of a Novel Fatty Liver Cell Model with Low Density Lipoprotein Receptor Gene Knockout Based On Cas9/Single Guide RNA Technique

Clustered regularly interspaced short palindromic repeats/Cas9 gene editing technique was used to construct the human liver Lo2 stable cell line with low density lipoprotein receptor gene deletion. According to the design principle of clustered regularly interspaced short palindromic repeats/Cas9 target, the single guide RNA specifically target low density lipoprotein receptor gene was designed and the recombinant plasmid lenticlustered regularly interspaced short palindromic repeats v2 was used to construct the recombinant plasmid which can express this single guide RNA and Cas9 protein. After sequencing identification, the recombinant plasmid was transferred into Human embryonic kidney 293T cells together with retroviral packaging plasmids VSVG and PAX2. 48 h after transfection, the virus supernatant was collected and directly infected with human liver Lo2 cell. Puromycin was used to screen low density lipoprotein receptor-deficient Lo2 cells, which was verified by polymerase chain reaction, western blotting, and immunofluorescence staining. Then polymerase chain reaction and western blotting were used to verify the effects of low density lipoprotein receptor knockout on the function, lipid metabolism, glucose metabolism pathway, and insulin resistance of the Lo2 cell line. In this paper, the clustered regularly interspaced short palindromic repeats/Cas9 plasmid targeting low density lipoprotein receptor was successfully constructed. The results of polymerase chain reaction and western blotting showed that the human liver Lo2 cell with a stable knockout of low density lipoprotein receptor was obtained. The results of immunofluorescence staining showed that compared with the control group, the content of prealbumin in low density lipoprotein receptor knockout cells decreased significantly, while the content of diacylglycerol increased. At the same time, low density lipoprotein receptor gene knockout can increase the expression level of fatty acid synthase, peroxisome proliferator-activated receptor-γ, sterol regulatory element binding protein 1c, and inhibit the expression of carnitine palmitoyltransferase 1a. In addition, compared with the control group, there was no significant difference in mRNA expression and protein level of mammalian target of rapamycin and phosphatidylinositol-3-kinase, and there was no significant change in epsilon isoform of protein kinase C and insulin receptor substrates 1 expression level. The Lo2 cell line with low density lipoprotein receptor gene knockout was constructed by clustered regularly interspaced short palindromic repeats/Cas9 technique, and the role of low density lipoprotein receptor in lipid metabolism and glucose metabolism was proved by Polymerase chain reaction and Western blotting. The low density lipoprotein receptor knockout polyclonal and monoclonal cells constructed in this study can provide a useful tool for future research.

207 Editing of prostaglandin E2 gene receptors EP2 and EP4 by CRISPR/Cas9 technology in equine adipose mesenchymal stem cells

Prostaglandin E2 (PGE2) is an important mediator of cellular responses, playing a key role in limiting inflammation. PGE2 acts distinctly through one of four EP receptors. In MSCs, it PGE2 stimulation of EP2 and EP4 receptors triggers processes such as migration, self-renewal, survival, and proliferation, and their activation is involved in homing. PGE2 has been proposed as a key factor of MSC immunomodulation. The CRISPR-Cas9 system has been adapted successfully to edit the genome of animals. Loss of EP2 and EP4 receptors in equine adipose mesenchymal stem cells (eAT-MSC) could help us understand their role in cell migration, homing, and self-renewal capacities. Here, we aimed to edit these receptors in eAT-MSC to test their function. The eAT-MSC were obtained from three Chilean breed horses and cultured in Dulbecco's modified Eagle's medium-high glucose with 10% fetal bovine serum. Guide RNAs (sgRNA) for CRISPR-Cas 9 editing were designed based on EP2 and EP4 DNA sequences. The sgRNA and PAM sequence targeting exon 1 of the equine genes (EP2-sgRNA: TGGTGCTGGCTTCGTACGCG; PAM:CGG and EP4-sgRNA: GGAGACGACCTTCTACACGT;PAM:TGG) were cloned into linearized LentiCRISPRv2GFP vector (#82416; Addgene). The lentiviral vector plus helping packaging plasmids was co-transfected into HEK293FT cells. The produced viral particles were harvested and transduced into eAT-MSC. After 48h, cells were sorted and green fluorescent protein (GFP)-positive cells were expanded to obtain individual clones. Genomic DNA was extracted for PCR amplification, and the frequency of site directed-mutation was assessed by T7 endonuclease assay. Because of the high background (e.g. excessive banding) produced by the T7E1 assay, the PCR products were cloned into a pUC57 vector, and sequenced. Quantitative PCR and immunocytochemistry staining examined expression of EP2 and EP4. The statistical analyses were performed using GraphPad Prism 6 (GraphPad Inc.) with unpaired t-test; P-values&amp;lt;0.05 were considered statistically significant. Transduction efficiency of eAT-MSC/EP2ko and eAT-MSC/EP4ko was 31 and 38%, respectively. A total of 15 clones for each lineage obtained from a single cell culture were subjected to T7EI assay to identify the frequency of mutation. Eight eAT-MSC/EP2ko and 7 eAT-MSC/EP4ko clones showed mutations; DNA sequencing confirmed mutations in 3 eAT-MSC/EP2ko clones and 3 eAT-MSC/EP4ko clones. Immunostaining with specific anti-EP2 and anti-EP4 antibodies showed diminished expression of the particular receptors in the knockout cells. Decreased expression was quantitatively confirmed by quantitative PCR analysis, showing downregulation of PTGER2 (4.3-fold) and PTGER4 (2.7-fold) in the edited clones compared with eAT-MSC naïve cells (P&amp;lt;0.05). This CRISPR/Cas9 design allows the possibility of using these mutant cell lines as a model system to elucidate the role of EP2 and EP4 in cell migration, homing, and self-renewal. Research was supported by FONDECYT 3170390 to ACFM, Ministry of Education, Chile.

MicroRNA‑192 inhibits cell proliferation and induces apoptosis in human breast cancer by targeting caveolin 1.

It has been demonstrated that microRNA-192 (miR-192) serves important roles in different cancer types, including breast cancer, prostate cancer and colorectal cancer. However, its biological role and function in breast cancer remains largely unknown. The present study aimed to determine the role of miR-192 in breast cancer. In the present study, one normal breast and two breast tumor cells lines were used, which included the normal mammary fibroblast cell line Hs578Bst, a more aggressive breast tumor cell line MDA-MB-231 and a less aggressive breast tumor cell line MCF-7. The effect of miR-192 on proliferation of breast cancer cells was detected with an MTT assay. Western blot analysis was performed to determine protein expression of caveolin 1 (CAV1). A lentiviral vector that overexpresses pre-miR-192 and control lentiviral packaging plasmids were used in the present study. The Student's t-test was performed to analyze the significance of differences between samples. In the present study, it was determined that the expression of miR-192 is downregulated in breast cancer, compared with the adjacent normal tissues. Overexpression of miR-192 significantly inhibited cell proliferation, and induced cell apoptosis and cell cycle arrest in MCF7 and MDA-MB-231 cells. Using a bioinformatics method, CAV1 was considered a potential target of miR-192. Furthermore, it was demonstrated that CAV1 is a direct target of miR-192 and its protein expression is negatively regulated by miR-192. Therefore, the present study demonstrated that miR-192 serves an important role as a regulator in breast cancer and the miR-192/CAV1 axis has a potential as a therapeutic target for treatment of breast cancer.

Construction and identification of recombinant lentiviral plasmid of receptor for advanced glycation end products

Objective To construct a recombinant lentiviral plasmid of receptor for advanced glycation end products (RAGE) and establish RAGE stable expressing hepatocellular carcinoma cell models in order to explore the pathogenesis of RAGE in the occurrence and development of hepatocellular carcinoma. Methods RAGE gene fragments were amplified by PCR and cloned into the lentiviral expression vector pCDH-CMV-MCS-EF1-Puro. Then the recombinant lentiviral plasmid and packaging plasmid were used to package lentivirus in HEK293T cells by calcium phosphate transfection. Lentivirus supernatant was collected to infect hepatoma cells HepG2 and Huh7. After that cells were screened by puromycin. Finally, RAGE expression was detected by real-time PCR and Western blot. Results RAGE gene fragment was successfully amplified and inserted into lentiviral expression vector. After packaging the lentivirus-infected liver cancer cells, real-time quantitative PCR and Western blot results showed that the mRNA (P<0.05) and protein expression of RAGE cells stably expressing RAGE were significantly higher than that of the control cells. Conclusions The RAGE overexpressing hepatocarcinoma cell line was successfully constructed by using lentiviral expression vector, which laid a good foundation for further study on the pathogenesis of RAGE. Key words: Liver neoplasms; Lentiviral expression vector; Receptor for advanced glycation end products

A standard procedure for lentiviral-mediated labeling of murine mesenchymal stromal cells in vitro.

Tracking of stem cells after transplantation is effectively performed in vivo with imaging systems, assuming the cells are adequately labeled to facilitate their recognition. This study aimed to optimize a protocol for fluorescent labeling of mesenchymal stromal cells (MSCs) in vitro, by using a third-generation lentiviral system. Basically, 293T cells are seeded in high-glucose Dulbecco's modified Eagle medium with 10% FBS one day before transfection. Transfection is done for 24h using a mix of transfer, packaging, regulatory, and envelope plasmids, in molar ratio of 4:2:1:1, respectively. After transfection, the cells are further cultured for two days. During this period, the viral medium is harvested two times, at 24-h intervals, with the first round being stored at 4°C until the second round is completed. The pooled viral medium is frozen in single-use aliquots. MSCs are transduced with 25 multiplicity of infection (MOI) and one day later the cells are passaged at standard seeding density and further grown for three days, when the fluorescence reach the maximum level. Our protocol provides particular experimental details for permanent MSC labeling that makes the procedure highly effective for therapeutic purposes, without affecting the functional properties of stem cells.

The Transcription Factor Deaf1 Modulates Engrailed-1 Expression to Regulate Skin Appendage Fate

The Transcription Factor Deaf1 Modulates Engrailed-1 Expression to Regulate Skin Appendage Fate

The Lentiviral Vector Pseudotyped by Modified Rabies Glycoprotein Does Not Cause Reactive Gliosis and Neurodegeneration in Rat Hippocampus

Background:A human immunodeficiency virus type 1 (HIV-1)-based lentiviral vector (LV) pseudotyped by a variant of rabies envelope glycoprotein, FUG-B2, has previously been prepared and used in transfection of hippocampal CA1 ("Cornu Ammonis" area 1) neurons. This study aimed to verify reactive gliosis and neuronal damage after injection of the vector into the rat hippocampus. Methods:HEK 293T cells were transfected with transfer (fck-Jaws-GFP-ER2), envelope (FUG-B2), and packaging (pMDLg/pRRE, pRSV-Rev) plasmids, and the vector was injected into CA1 of the rat hippocampus. After one week, transduction efficiency, and the number of neuronal and astroglial cells were determined in CA1 and CA3 by double staining of the brain slices. Results:Hippocampal cells were successfully transfected as 92.7% of CA1 and 95.8% of CA3 neuronal cells expressed GFP. The frequency of neuronal and astroglial cells in CA1 and CA3 of the vector-injected rats remained unchanged compared to those in the control and the saline-injected rats. Furthermore, no morphological change was found in hippocampal astrocytes and neuronal cells. Conclusion:The HIV-1-based LV pseudotyped by FUG-B2 is safe and does not cause neuroinflammation and neuronal loss once directly delivered into the rat hippocampus.

Role of Cav-1 in HIV-1 Tat-Induced Dysfunction of Tight Junctions and Aβ-Transferring Proteins.

Objective To evaluate the role of caveolin-1 (Cav-1) in HIV-1 Tat-induced dysfunction of tight junction and amyloid β-peptide- (Aβ-) transferring proteins. Methods A Cav-1 shRNA interference target sequence was cloned into the lentiviral vector pHBLV-U6-Scramble-ZsGreen-Puro and verified by double enzyme digestion and DNA sequencing. Human cerebral microvascular endothelium (HBEC-5i) cells were transduced with viral particles made in 293T cells by transfection with lentiviral packaging plasmids. HBEC-5i cells transduced with Cav-1 shRNA or Ctr shRNA were exposed to HIV-1 Tat for 24 h, and the protein and mRNA levels of the tight junction protein occludin, Aβ-transferring protein, receptor for advanced glycation end products (RAGE), low-density lipoprotein receptor-related protein- (LRP-) 1, and RhoA were evaluated with Western blot and real-time reverse transcription polymerase chain reaction (qRT-PCR) assays, respectively. Results After sequencing, an RNA interference recombinant lentivirus expressing a vector targeting Cav-1 was successfully established. The recombined lentiviral particles were made by using 293T cells to package the recombined lentiviral vector. A stable monoclonal cell line with strong GFP expression was acquired with a Cav-1 knockdown rate of 85.7%. The occludin protein and mRNA levels in the Ctr shRNA group were decreased with HIV-1 Tat exposure but were upregulated in the Cav-1 shRNA group. The HIV-1 Tat-induced alterations of RAGE and LRP-1 protein and mRNA levels in the Ctr shRNA group were attenuated in the Cav-1 shRNA group. The RhoA protein levels in the Ctr shRNA group were upregulated by HIV-1 Tat exposure but were downregulated in the Cav-1 shRNA group. Conclusion These results show that HIV-1 Tat-induced downregulation of occludin and LRP-1 and upregulation of RAGE and RhoA may result in the accumulation of Aβ in the brain. Silencing the Cav-1 gene with shRNA plays a key role in the protection against HIV-1 Tat-induced dysfunction of the blood-brain barrier and Aβ accumulation.

Acquired MET Exon 14 Alteration Drives Secondary Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitor in EGFR-Mutated Lung Cancer.

Novel resistance mechanisms to epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) in EGFR-mutant lung cancer continue to be defined.1 With the recent approval of the third-generation EGFR TKI osimertinib as first-line treatment, and expanded use of large-panel next-generation sequencing (NGS)–based testing, many novel resistance mechanisms are emerging. Resistance to osimertinib can result from on-target mechanisms, such as the acquisition of second-site EGFR mutations, or from the activation of off-target mechanisms or bypass pathways, including acquired oncogenic fusions of RET, ALK, BRAF, and FGFR1,2 and amplification or mutation of HER2, BRAF, MEK, KRAS, PIK3CA, and MET.3 MET amplification is reported in 5% to 22% of EGFR TKI resistance.1,4 Preclinical studies have shown that acquired resistance to EGFR TKIs resulting from MET amplification can be reversed by combined therapy with EGFR and MET inhibitors.4 MET exon 14 skipping alteration (METex14) is present in 3% to 4% of lung adenocarcinomas,5 and the MET receptor lacking exon 14 shows decreased protein turnover because of loss of the ubiquitination site encoded by exon 14, resulting in aberrant MET activation and oncogenesis.6 In preclinical and clinical studies, responses to MET inhibitors, such as crizotinib, have been reported in patients with lung cancer with METex14 as a primary driver.6-11 However, it has not been previously implicated in acquired resistance to EGFR-TKIs. In this study, we used targeted NGS with Memorial Sloan Kettering Integrated Mutation Profiling of Actionable Cancer Targets (MSK-IMPACT),12 immunohistochemistry, cell-free DNA testing, and fluorescence in situ hybridization to evaluate acquired resistance mediated by METex14. Furthermore, we used in vitro functional studies to establish METex14 as a novel mechanism of acquired resistance to EGFR TKIs. We used MSK-IMPACT, a large-panel NGS assay, to detect mutations, copy-number alterations, and select gene fusions involving up to 468 cancer-associated genes.12 METex14 was introduced into PC9 and H1975 cells as follows. Briefly, full-length METex14 was polymerase chain reaction amplified and subcloned into pLenti-CMV-blast lentiviral vector (plasmid 17451; Addgene, Cambridge, MA). The lentiviral plasmids were cotransfected with packaging plasmids into HEK 293 T cells using FuGENE HD (Promega, Madison, WI), and lentiviruses were generated. Cells were infected with lentivirus-expressing METex14 cDNA, followed by selection with blasticidin (20 µg/mL) for 8 days. The Data Supplement provides more detailed methods.

Construction of human ubiquitin specific peptidase 53 overexpressing cell line

Objective To construct an Esophageal cancer Eca109 cell line which can stably overexpressing the ubiquitin specific peptidase 53 (USP53). Methods The USP53 full-length gene was amplified by Polymerase Chain Reaction (PCR) using a plasmid containing the full-length sequence of USP53 purchased by GE. The constructed USP53 lentiviral plasmid and packaging plasmid were co-transfected into 293T cells to obtain concentrated lentiviral particles, and then the lentiviral particles were infected with Eca109 cells. The medium containing puromycin was selected for stable transfected cell lines. Results The mRNA expression of USP53 in overexpressing cell lines (45.070±0.942) was significantly higher than that in the control group (1.091±0.075) and the normal group (1.000±0.023). The difference was statistically significant (P<0.05), Western blotting showed that the expression of the tagged protein HA was significant expressed in the overexpressed cell line, and no tagged protein expression was observed in the control group and the normal group. Conclusion Human ubiquitin specific peptidase 53 overexpressing cell line was successfully constructed. Key words: Esophageal cancer; Eca109; Ubiquitin specific peptidase 53; Lentivirus

Novel Chimeric Gene Therapy Vectors Based on Adeno-Associated Virus and Four Different Mammalian Bocaviruses

Parvoviruses are highly attractive templates for the engineering of safe, efficient, and specific gene therapy vectors, as best exemplified by adeno-associated virus (AAV). Another candidate that currently garners increasing attention is human bocavirus 1 (HBoV1). Notably, HBoV1 capsids can cross-package recombinant (r)AAV2 genomes, yielding rAAV2/HBoV1 chimeras that specifically transduce polarized human airway epithelia (pHAEs). Here, we largely expanded the repertoire of rAAV/BoV chimeras, by assembling packaging plasmids encoding the capsid genes of four additional primate bocaviruses, HBoV2–4 and GBoV (Gorilla BoV). Capsid protein expression and efficient rAAV cross-packaging were validated by immunoblotting and qPCR, respectively. Interestingly, not only HBoV1 but also HBoV4 and GBoV transduced pHAEs as well as primary human lung organoids. Flow cytometry analysis of pHAEs revealed distinct cellular specificities between the BoV isolates, with HBoV1 targeting ciliated, club, and KRT5+ basal cells, whereas HBoV4 showed a preference for KRT5+ basal cells. Surprisingly, primary human hepatocytes, skeletal muscle cells, and T cells were also highly amenable to rAAV/BoV transduction. Finally, we adapted our pipeline for AAV capsid gene shuffling to all five BoV isolates. Collectively, our chimeric rAAV/BoV vectors and bocaviral capsid library represent valuable new resources to dissect BoV biology and to breed unique gene therapy vectors.

185 Overexpression or CRISPr/Cas9-mediated inhibition of prostaglandin E2 receptors EP2 and EP4 in equine adipose mesenchymal stem cells: implications for cell migration and cellular therapies

Prostaglandin E2 (PGE2) acts through 4 cellular receptors: EP1, EP2, EP3, and EP4; only EP2 and EP4 are relevant for immunomodulation and migration in immune cells. Besides those, several cells express these receptors on their surface, including mesenchymal stem cells. Pharmacological inhibition of the EP2 receptor prevents migration of immune system cells to inflamed sites, where the concentration of PGE2 is high. Based on this, we hypothesised that overexpression of EP2 or EP4 receptors in equine mesenchymal stem cells (eMSC) will improve their migration to inflammatory sites and subsequent homing capability. Conversely, their suppression will lead to low or no migration, favouring the paracrine properties of MSC in the processes of tissue regeneration and reduction of inflammation. To test this, we manipulated the PGE2-EP2-EP4 axis and evaluated the effect of such modifications on transgenic cells in vitro. Equine MSC from adipose tissue were obtained from 5 animals. The coding sequences of both receptors were synthesised (GenScript, Hong Kong) based on the published horse genome (National Center for Biotechnology Information; https://www.ncbi.nlm.nih.gov/) and cloned into pcDNA3.1 overexpression vectors (Addgene). The resulting constructs were lipofected into naïve adipose eMSC. For knockouts, we PCR-amplified and sequenced horse EP2 and EP4 receptors, and gRNAs were created based on the obtained sequences and ligated into LentiCRISPRV2 plasmid (Addgene, Cambridge, MA, USA). The lentiviral vector plus helping packaging plasmids were co-transfected into HEK293FT cells and the produced viral particles were harvested and transduced into adipose eMSC. After 48h of transfection (for overexpression) or transduction (for knockout, KO), cells were probed for the presence/absence of EP2 and EP4 receptors by immunohistochemistry and/or quantitative (q)PCR. Mitomycin-C-treated cells of both phenotypes and naïve, were subjected to migration in scratch assay, towards 3mM PGE2. Fetal calf serum (10 or 0%) was used as positive or negative control, respectively, in migration experiments. Receptors EP2 and EP4 were clearly overexpressed after transfection as determined by immunocytochemistry or qPCR assays (phenotype MSC-EP2+/EP4+), whereas in the cells that underwent KO, little or no expression of EP2 and EP4 was detected (phenotype MSC-EP2ko/EP4ko) compared with unmanipulated cells (naïve MSC-Ctr). In the migration experiments towards 3mM of PGE2, MSC-EP2+/EP4+ cells at 24h filled the scratch faster (P&amp;lt;0.05) than MSC-EP2ko/EP4ko or MSC-Ctr. These results showed that manipulation of PGE2-EP2/EP4 axis receptors led to changes in cell surface receptor availability and increased the migration pattern in overexpressed cells compared with KO and unmanipulated cells. These factors may affect the design of cellular therapeutic tools for inflammatory diseases in the equine species. This research was supported by FONDECYT 3170390 to ACFM, Ministry of Education, Chile.

Genome-wide CRISPR-dCas9 screens in E. coli identify essential genes and phage host factors.

High-throughput genetic screens are powerful methods to identify genes linked to a given phenotype. The catalytic null mutant of the Cas9 RNA-guided nuclease (dCas9) can be conveniently used to silence genes of interest in a method also known as CRISPRi. Here, we report a genome-wide CRISPR-dCas9 screen using a starting pool of ~ 92,000 sgRNAs which target random positions in the chromosome of E. coli. To benchmark our method, we first investigate its utility to predict gene essentiality in the genome of E. coli during growth in rich medium. We could identify 79% of the genes previously reported as essential and demonstrate the non-essentiality of some genes annotated as essential. In addition, we took advantage of the intermediate repression levels obtained when targeting the template strand of genes to show that cells are very sensitive to the expression level of a limited set of essential genes. Our data can be visualized on CRISPRbrowser, a custom web interface available at crispr.pasteur.fr. We then apply the screen to discover E. coli genes required by phages λ, T4 and 186 to kill their host, highlighting the involvement of diverse host pathways in the infection process of the three tested phages. We also identify colanic acid capsule synthesis as a shared resistance mechanism to all three phages. Finally, using a plasmid packaging system and a transduction assay, we identify genes required for the formation of functional λ capsids, thus covering the entire phage cycle. This study demonstrates the usefulness and convenience of pooled genome-wide CRISPR-dCas9 screens in bacteria and paves the way for their broader use as a powerful tool in bacterial genomics.

A Syngeneic Mouse B-Cell Lymphoma Model for Pre-Clinical Evaluation of CD19 CAR T Cells

The astonishing clinical success of CD19 chimeric antigen receptor (CAR) T-cell therapy has led to the approval of two second generation chimeric antigen receptors (CARs) for acute lymphoblastic leukemia (ALL) andnon-Hodgkin lymphoma (NHL). The focus of the field is now on emulating these successes in other hematological malignancies where less impressive complete response rates are observed. Further engineering of CAR T cells or co-administration of other treatment modalities may successfully overcome obstacles to successful therapy in other cancer settings. We therefore present a model in which others can conduct pre-clinical testing of CD19 CAR T cells. Results in this well tested B-cell lymphoma model are likely to be informative CAR T-cell therapy in general. This protocol allows the reproducible production of mouse CAR T cells through calcium phosphate transfection of Plat-E producer cells with MP71 retroviral constructs and pCL-Eco packaging plasmid followed by collection of secreted retroviral particles and transduction using recombinant human fibronectin fragment and centrifugation. Validation of retroviral transduction, and confirmation of the ability of CAR T cells to kill target lymphoma cells ex vivo, through the use of flow cytometry, luminometry and enzyme-linked immunosorbent assay (ELISA), is also described. Protocols for testing CAR T cells in vivo in lymphoreplete and lymphodepleted syngeneic mice, bearing established, systemic lymphoma are described. Anti-cancer activity is monitored by in vivo bioluminescence and disease progression. We show typical results of eradication of established B-cell lymphoma when utilizing 1st or 2nd generation CARs in combination with lymphodepleting pre-conditioning and a minority of mice achieving long term remissions when utilizing CAR T cells expressing IL-12 in lymphoreplete mice. These protocols can be used to evaluate CD19 CAR T cells with different additional modification, combinations of CAR T cells and other therapeutic agents or adapted for the use of CAR T cells against different target antigens.