P65 DNA Binding Activity Research Articles

Ethanol extract of Elephantopus scaber Linn. Attenuates inflammatory response via the inhibition of NF-κB signaling by dampening p65-DNA binding activity in lipopolysaccharide-activated macrophages.

Elephantopus scaber Linn. (E.scaber) is a widely-used traditional herb whose use has been documented for various inflammatory diseases such as fever, sore throat, dysentery, carbuncle and so on. However, the effect and mechanism of E.scaber in LPS-activated macrophages remain unclear. This study aims to investigate the anti-inflammatory mechanism of the ethanol extract of E.scaber (ESE) in lipopolysaccharide (LPS)-induced inflammatory models. Griess reagent was used to determine NO production, and the levels of TNF-α, IL-6, MCP-1 and IL-1β were determined by ELISA kits. The molecular mechanism research was performed by RT-PCR, Western blot, and electrophoretic mobility shift assay (EMSA). LPS-induced endotoxemia mouse model was used for evaluating the in vivo anti-inflammatory action of ESE. ESE suppressed LPS-induced iNOS, TNF-α, IL-6, MCP-1 and IL-1β transcription as well as supernatant NO, TNF-α, IL-6, MCP-1 and IL-1β production in macrophages. Although ESE inhibited NF-κB activation, it did not affect the IκBα phosphorylation and degradation and the NF-κB p65 nuclear translocation. The result of EMSA revealed that ESE inhibited the NF-κB p65-DNA binding activity. Additionally, ESE also decreased the proinflammatory cytokines in serum and peritoneal lavage fluid of LPS-induced endotoxemic mice. ESE has a potently anti-inflammatory effect through inhibiting the NF-κB p65-DNA binding activity in LPS-activated macrophages.

Kinin B1 Receptor Blockade Prevents Angiotensin II-induced Neuroinflammation and Oxidative Stress in Primary Hypothalamic Neurons.

Neuroinflammation has become an important underlying factor in many cardiovascular disorders, including hypertension. Previously we showed that elevated angiotensin II (Ang II) and angiotensin II type I receptor (AT1R) expression levels can increase neuroinflammation leading to hypertension. We also found that kinin B1 receptor (B1R) expression increased in the hypothalamic paraventricular neurons resulting in neuroinflammation and oxidative stress in neurogenic hypertension. However, whether there are any potential interactions between AT1R and B1R in neuroinflammation is not clear. In the present study, we aimed to determine whether Ang II-mediated effects on inflammation and oxidative stress are mediated by the activation of B1R in mouse neonatal primary hypothalamic neuronal cultures. Gene expression and immunostaining revealed that both B1R and AT1R are expressed on primary hypothalamic neurons. Ang II stimulation significantly increased the expression of B1R, decreased mitochondrial respiration, increased the expression of two NADPH oxidase subunits (Nox2 and Nox4), increased the oxidative potential, upregulated several proinflammatory genes (IL-1β, IL-6, and TNFα), and increased NF-kB p65 DNA binding activity. These changes were prevented by pretreatment with the B1R-specific peptide antagonist, R715. In summary, our study demonstrates a causal relationship between B1R expression after Ang II stimulation, suggesting a possible cross talk between AT1R and B1R in neuroinflammation and oxidative stress.

Curcumin prevents high-fat diet-induced hepatic steatosis in ApoE\u2212/\u2212 mice by improving intestinal barrier function and reducing endotoxin and liver TLR4/NF-\u03baB inflammation

BackgroundNon-alcoholic fatty liver disease (NAFLD) is the most common chronic liver disease and has become a public health concern worldwide. The hallmark of NAFLD is hepatic steatosis. Therefore, there is an urgent need to develop new therapeutic strategies that are efficacious and have minimal side effects in hepatic steatosis and NAFLD treatment. The present study aimed to investigate the effect of dietary supplement of curcumin on high-fat diet (HFD)-induced hepatic steatosis and the underlying mechanism.MethodsApoE−/− mice were fed a normal diet, high-fat diet (HFD) or HFD supplemented with curcumin (0.1% w/w) for 16 weeks. Body and liver weight, blood biochemical.parameters, and liver lipids were measured. Intestinal permeability, hepatic steatosis and mRNA and protein expressions of TLR4-related inflammatory signaling molecule were analyzed.ResultsThe administration of curcumin significantly prevented HFD-induced body weight gain and reduced liver weight. Curcumin attenuated hepatic steatosis along with improved serum lipid profile. Moreover, curcumin up-regulated the expression of intestinal tight junction protein zonula occluden-1 and occludin, which further improved gut barrier dysfunction and reduced circulating lipopolysaccharide levels. Curcumin also markedly down-regulated the protein expression of hepatic TLR4 and myeloid differentiation factor 88 (MyD88), inhibited p65 nuclear translocation and DNA binding activity of nuclear factor-κB (NF-κB) in the liver. In addition, the mRNA expression of hepatic tumour necrosis factor-α (TNF-α) and interleukin-1β (IL-1β) as well as the plasma levels of TNF-α and IL-1β were also lowered by curcumin treatment.ConclusionThese results indicated that curcumin protects against HFD-induced hepatic steatosis by improving intestinal barrier function and reducing endotoxin and liver TLR4/NF-κB inflammation. The ability of curcumin to inhibit hepatic steatosis portrayed its potential as effective dietry intervention for NAFLD prevention.

<p>Estrogen Receptor Beta Inhibits The Proliferation, Migration, And Angiogenesis Of Gastric Cancer Cells Through Inhibiting Nuclear Factor-Kappa B Signaling</p>

PurposeThis study aimed to investigate the regulatory roles of estrogen receptor beta (ERβ) on gastric cancer (GC) cells, and reveal the potential mechanisms relating to nuclear factor-kappa B (NF-κB) signaling.MethodsGC cell lines SGC7901 and MKN45 were transfected with pEGFP-C1-ERβ to overexpress ERβ, and treated with PMA (a NF-κB activator) to activate NF-κB signaling. The cell proliferation and migration, as well as the formation of vessel-like structures in human venous endothelial cells (HUVECs) were detected. The expression of ERβ, NF-κB p65, p-NF-κB p65, Ki67 (a proliferation marker), vascular endothelial growth factor A (VEGF-A) and matrix metalloproteinase 2 (MMP-2), the DNA binding activity of NF-κB p65, the content of VEGF-A, and the activity of MMP-2 were detected in SGC7901 and MKN45 cells.ResultsThe transfection of pEGFP-C1-ERβ significantly increased the expression of ERβ in SGC7901 and MKN45 cells (P < 0.05). Overexpression of ERβ in SGC7901 and MKN45 cells significantly decreased the cell activity, cell number in G2/M phase, cell migration, the expression of Ki67, VEGF-A and MMP-2, VEGF-A content, MMP-2 activity, as well as the number of vessel-like structures formed by HUVECs (P < 0.05). Overexpression of ERβ also significantly decreased the DNA binding activity and the expression of p-NF-κB p65 in SGC7901 and MKN45 cells (P < 0.05). The anti-tumor effect of ERβ overexpression on GC cells was reversed by the intervention of PMA (P < 0.05).ConclusionOverexpression of ERβ inhibited the proliferation, migration, and angiogenesis of GC cells through inhibiting NF-κB signaling.

Docosahexaenoic acid inhibits TNFα-induced ICAM-1 expression by activating PPARα and autophagy in human endothelial cells

Inflammation plays a key role in the development of cardiovascular disease (CVD), and docosahexaenoic acid (DHA) is recognized to fight against CVD. PPARα belongs to the nuclear hormone receptor superfamily and can interfere with inflammatory processes. Autophagy can degrade inflammasome proteins and counteract inflammation. Overexpression of intercellular adhesion molecule (ICAM) 1 in endothelial cells contributes to monocyte migration into the vascular intima. Here we investigated the mechanisms by which DHA inhibits TNFα-induced ICAM-1 expression in EA. hy926 endothelial cells. DHA markedly activated PPARα and suppressed TNFα-induced ICAM-1 expression, ICAM-1 promoter activity, p65 nuclear translocation, NFκB and DNA binding activity, and THP-1 cell adhesion. PPARα knockdown abolished the ability of DHA to inhibit TNFα-induced ICAM-1 expression and THP-1 cell adhesion. The PPARα antagonist GW6471 reversed the inhibitory effect of DHA on TNFα-induced ICAM-1 expression, p65 nuclear translocation, NFκB and DNA binding activity, and THP-1 cell adhesion. DHA significantly activated autophagy as evidenced by the formation of autophagosomes and increased LC3II protein expression. By contrast, wortmannin, which inhibits autophagy, abrogated DHA-induced autophagy and the inhibition of TNFα-induced ICAM-1 protein expression by DHA. Our results suggest that DHA likely inhibits TNFα-induced ICAM-1 expression by activating PPARα and autophagy.

Abstract 5298: Finding new molecules to bypass the tumor suppressor gene TP53 and restore cell cycle checkpoint control

Abstract The tumor suppressor gene, tumor protein 53 (TP53), has been shown to be mutated in more than half of all human cancer cases. p53 controls the G1/S phase checkpoint of the mitotic cell cycle, protecting the fidelity of DNA and inducing apoptosis in cells with irreparable DNA damage. Mutations in TP53, which are often missense mutations that interfere with p53 DNA binding activity or protein folding, result in protein inactivation and loss of checkpoint control, allowing cells with potentially oncogenic mutations to survive and proliferate. TP53 mutations have been shown to enhance tumor progression, increase metastatic potential, and mediate chemotherapy resistance. Because of the importance of p53 in cancer, many studies have aimed to identify small molecules that can “reactivate” mutated p53 protein in cell culture, although this has met with little success thus far. The aim of this research is to identify the extent to which the effects of non-functioning p53 can be completely bypassed, and cell cycle checkpoint restored, using already-established FDA approved compounds in a zebrafish model of p53 loss. Zebrafish were genetically engineered to have their entire TP53 locus removed using TALEN (Transcription activator-like effector nuclease), rendering them unable to produce the p53 protein. p53 deficient and wild-type zebrafish larvae were then subjected to gamma-irradiation to induce DNA damage. An apoptotic cell staining assay was then performed to allow for the qualitative and quantitative analysis of apoptosis levels throughout the larvae. As expected, TP53 null fish had significantly less apoptotic cells than control after DNA damage. We are in the process of testing 770 FDA approved compounds for their effects in inducing an apoptotic response in p53 null larvae after gamma-irradiation. Positive hits will be carried forward to human cancer cells with TP53 mutation, and the mechanism of action of the drug will be determined using biochemical approaches. These results could identify novel pathways that work in concert with p53 and will allow us to harness new mechanisms of DNA damage induced apoptosis to kill cancer cells. Repurposing FDA-approved drugs can also rapidly translate to clinical benefit in a wide number of cancers driven by TP53 mutation. Citation Format: Henry Moore, Jessica Blackburn. Finding new molecules to bypass the tumor suppressor gene TP53 and restore cell cycle checkpoint control [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2019; 2019 Mar 29-Apr 3; Atlanta, GA. Philadelphia (PA): AACR; Cancer Res 2019;79(13 Suppl):Abstract nr 5298.

Cyclic Stretch Force Induces Periodontal Ligament Cells to Secrete Exosomes That Suppress IL-1β Production Through the Inhibition of the NF-κB Signaling Pathway in Macrophages.

In the oral mechanical environment, periodontal ligament cells (PDL cells) contribute to maintaining periodontal tissue homeostasis. Recent studies showed that exosomes, which are small vesicles secreted by various types of cells, play a pivotal role in cell-to-cell communication in biological processes. We examined the secretion of exosomes from PDL cells stimulated with cyclic stretch and their role in the inflammatory response of macrophages using the human macrophage cell line THP-1 and human primary monocytes/macrophages. We prepared supernatants from human PDL cells (PDL-sup) stimulated with cyclic stretch. The treatment of macrophages with PDL-sup, but not PDL-sup from unstimulated PDL cells, inhibited the production of IL-1β in LPS/nigericin-stimulated macrophages. The pretreatment of PDL cells with GW4869, an inhibitor of exosome secretion, or siRNA for Rab27B, which controls exosome secretion, abrogated the inhibitory effects of PDL-sup. A transmission electron microscopy analysis demonstrated the existence of exosomes with diameters ranging between 30 and 100 nm in PDL-sup, suggesting that exosomes in PDL-sup contribute to this inhibition. An immunofluorescence microscopy analysis revealed that exosomes labeled with PKH67, a fluorescent dye, were incorporated by macrophages as early as 2 h after the addition of exosomes. Purified exosomes inhibited IL-1β production in LPS/nigericin-stimulated macrophages and the nuclear translocation of NF-κB as well as NF-κB p65 DNA-binding activity in LPS-stimulated macrophages, suggesting that exosomes suppress IL-1β production by inhibiting the NF-κB signaling pathway. Our results indicate that PDL cells in mechanical environments contribute to the maintenance of periodontal immune/inflammatory homeostasis by releasing exosomes.

The TLR-4/NF-κB signaling pathway activation in cochlear inflammation of rats with noise-induced hearing loss

The TLR-4/NF-κB signaling pathway is involved in innate immunity and inflammation induced by trauma. The present study aimed to investigate possible TLR-4/NF-κB signaling pathway activation in the cochlea associated with acoustic trauma that might induce cochlear inflammation. A total of 72 rats were exposed to white noise at 120 dB SPL for 8 h per day repeated over 2 successive days. Auditory brainstem responses (ABR) were measured in animals before noise exposure and 0 d (PE0), 1 d (PE1), 3 d (PE3), 7 d (PE7), and 14 d (PE14) after noise exposure. At each defined time point, animals were sacrificed, and cochleae were collected to evaluate the expression levels of TLR4, MyD88, cytoplasmic NF-κB p65, IκBα, TNF-α, and IL-1β using western blotting and NF-κB p65 transcriptional activity using an NF-κB p65 Transcription Factor Assay Kit. Cochlear localizations of TLR-4, TNF-α and IL-1β were analyzed using immunohistochemistry in paraffin-embedded slices. The nuclear translocation of NF-κB p65 was evaluated using immunofluorescence staining in paraffin-embedded slices. DNA fragmentation was measured with a TUNEL assay in paraffin-embedded slices. We found a stable permanent threshold shift after noise exposure. After noise exposure, expression levels of TLR-4, MyD88, IκBα, TNF-α, and IL-1β were significantly upregulated (PE3); DNA binding activity of NF-κB p65 was also significantly enhanced (PE3), while the cytoplasmic NF-κB p65 levels were unchanged. TLR-4, TNF-α, and IL-1β immunostaining intensities were substantially enhanced in spiral ganglion cells and spiral ligament fibrocytes after noise exposure (PE3). In conclusion, the results of this study indicate that the TLR-4/NF-κB signaling pathway is activated in noise-exposed cochleae and that it participates in noise-induced cochlear inflammation.

Effect of Astragalus membranaceus in Ovalbumin-Induced Allergic Rhinitis Mouse Model.

Background Astragalus membranaceus (AM), a traditional Chinese medicine, has been used to treat allergic diseases, but the mechanism for treating allergic rhinitis (AR) remains unclear. Objective The purpose of this study was to look at the anti-inflammatory effect of AM on AR and the mechanism of anti-allergy. Methods The mouse model of AR was induced by ovalbumin. Allergic symptoms, number of eosinophils in nasal mucosa, and levels of inflammatory cells in nasal lavage fluid were analyzed. We explored the serum immunoglobulin E (IgE), interleukin-4 (IL-4), IL-5, IL-13, interferon-γ (IFN-γ), and IL-10. Besides, the relative mRNA of IL-4, IL-5, and IL-13 was also detected in nasal mucosa tissue. The proportion of CD4+ CD25+ Foxp3+ T cells in the spleen and nasal lymphoid tissue were analyzed. The mRNA levels of nuclear factor-kappa B p65 (NF-κB p65) and inhibitory kappa B alpha (IκBα), as well as NF-κB p65 DNA binding activity, were tested. We also measured the protein levels of NF-κB p65 and p-NF-κB p65 in nasal mucosa. Results AM could reduce the number of eosinophils in the nasal mucosa and decrease the levels of inflammatory cells in nasal lavage fluid. The serum IgE, IL-4, IL-5, and IL-13 were also decreased, while levels of IFN-γ and IL-10 were increased. The relative mRNA of IL-4, IL-5, and IL-13 was decreased by AM. AM increased the proportion of CD4+ CD25+ Foxp3+ T cells in the spleen and nasal lymphoid tissue. In addition, AM could reduce the activity of NF-kB by inhibiting the mRNA expression and DNA binding activity of NF-κB p65. However, AM had no significant effect on mRNA of IκBα. Above all, AM could reduce the p-NF-κB p65 protein expression of nasal mucosa. Conclusions AM could reduce the secretion of inflammatory cytokines by increasing the level of CD4+ CD25+ Foxp3+ T cells and inhibiting the activation of the NF-κB.

Curcumin Attenuates Asthmatic Airway Inflammation and Mucus Hypersecretion Involving a PPARγ-Dependent NF-κB Signaling Pathway In Vivo and In Vitro.

Asthma is characterized by airway inflammation and mucus hypersecretion. Curcumin possessed a potent anti-inflammatory property involved in the PPARγ-dependent NF-κB signaling pathway. Then, the aim of the current study was to explore the value of curcumin in asthmatic airway inflammation and mucus secretion and its underlying mechanism. In vivo, mice were sensitized and challenged by ovalbumin (OVA) to induce chronic asthma. Airway inflammation and mucus secretion were analyzed. In vitro, BEAS-2B cells were obtained. MCP-1, MUC5AC, and PPARγ expression and the phosphorylation of NF-κB p65 and NF-κB p65 DNA-binding activity were measured in both the lungs and BEAS-2B cells. shRNA-PPARγ was used to knock down PPARγ expression. We found that OVA-induced airway inflammation and mucus hypersecretion in mice, OVA and IL-4-induced upregulation of MCP-1 and MUC5AC, suppression of PPARγ, and activation and translocation of NF-κB p65 were notably improved by curcumin both in vivo and in vitro. Our data also showed that these effects of curcumin were significantly abrogated by shRNA-PPARγ. Taken together, our results indicate that curcumin attenuated OVA-induced airway inflammation and mucus hypersecretion in mice and suppressed OVA- and IL-4-induced upregulation of MCP-1 and MUC5AC both in vivo and in vitro, most likely through a PPARγ-dependent NF-κB signaling pathway.

Inhibitory Effects of Novel Oridonin Analog CYD0617‐2 on Hepatic Stellate Cell Activation through NF‐κB and Stat3 Pathways

IntroductionInhibition of activated hepatic stellate cell (HSC) proliferation is recognized as a promising therapeutic strategy for liver fibrosis. Previously, we reported that natural compound oridonin exhibits potent anti‐hepatic fibrosis activity, and that NF‐κB and Stat3 signaling contribute to HSC activation. In this study, we determined the anti‐fibrotic effects of a novel oridonin analog CYD0617‐2 in activated HSCs and the underlying mechanism.MethodsThe activated human and rat HSC lines LX‐2 and HSC‐T6 were treated with CYD0617‐2. Cell viability was measured by alamarBlue assay. Apoptosis was determined by Cell death ELISA. Cellular proteins were analyzed with Western blot. Cytokines were determined with ELISA.ResultsCYD0617‐2 treatment significantly inhibited proliferation and induced apoptosis in both cell lines in a dose‐dependent manner approximately 10 fold more potent than the parent compound oridonin. CYD0617‐2 stimulated apoptotic proteins p21, p27, and cleaved‐PARP, while suppressing extracellular matrix proteins fibronectin and laminin. CYD0617‐2 blocked LPS‐induced NF‐κB p65 nuclear translocation and DNA binding activity, prevented LPS‐induced NF‐κB inhibitory protein IκBα phosphorylation and degradation, and suppressed LPS‐stimulated IKKα/β phosphorylation. LPS‐induced NF‐κB cytokines IL‐6, MCP‐1, and IL‐1β were attenuated by CYD0617‐2. The endogenous and LPS‐induced NF‐κB p65 S536 phosphorylation was inhibited by CYD0617‐2. Importantly, NF‐κB chemical inhibitor Bay‐11‐0782 was found to inhibit proliferation and promote apoptosis in both cell lines. Moreover, CYD0617‐2 attenuated Stat3 activation by suppressing pStat3/T705 phosphorylation and target gene c‐myc.ConclusionThe potent anti‐hepatic fibrogenetic effect of CYD0617‐2 may be through suppression of IKK/IκBα/NF‐κB and Stat3 pathway.This abstract is from the Experimental Biology 2019 Meeting. There is no full text article associated with this abstract published in The FASEB Journal.

Understanding p53 functions through p53 antibodies

TP53 is the most frequently mutated gene across all cancer types. Our understanding of its functions has evolved since its discovery four decades ago. Initially thought to be an oncogene, it was later realized to be a critical tumour suppressor. A significant amount of our knowledge about p53 functions have come from the use of antibodies against its various forms. The early anti-p53 antibodies contributed to the recognition of p53 accumulation as a common feature of cancer cells and to our understanding of p53 DNA-binding and transcription activities. They led to the concept that conformational changes can facilitate p53’s activity as a growth inhibitory protein. The ensuing p53 conformational-specific antibodies further underlined p53’s conformational flexibility, collectively forming the basis for current efforts to generate therapeutic molecules capable of altering the conformation of mutant p53. A subsequent barrage of antibodies against post-translational modifications on p53 has clarified p53’s roles further, especially with respect to the mechanistic details and context-dependence of its activity. More recently, the generation of p53 mutation-specific antibodies have highlighted the possibility to go beyond the general framework of our comprehension of mutant p53—and promises to provide insights into the specific properties of individual p53 mutants. This review summarizes our current knowledge of p53 functions derived through the major classes of anti-p53 antibodies, which could be a paradigm for understanding other molecular events in health and disease.

Natural Compound Oridonin Inhibits Endotoxin-Induced Inflammatory Response of Activated Hepatic Stellate Cells.

Hepatic stellate cells (HSCs) play an important role in hepatic fibrogenesis and inflammatory modulation. Endotoxin is dramatically increased in portal venous blood after serious injury and can contribute to liver damage. However, the mechanism underlying endotoxin's effects on HSCs remains largely unknown. Oridonin is a bioactive diterpenoid isolated from Rabdosia rubescens that exhibits anti-inflammatory properties in different tissues. In the present study, we determined the effects of oridonin on endotoxin-induced inflammatory response and signaling pathways in vitro. The production of proinflammatory cytokines in activated human HSCs line LX-2 was measured by ELISA and Western blots. Immunofluorescence and nuclear fractionation assay were used to determine NF-κB activity. Oridonin treatment significantly inhibited LPS-induced proinflammatory cytokines IL-1β, IL-6, and MCP-1 production as well as cell adhesion molecules ICAM-1 and VCAM-1. Additionally, oridonin blocked LPS-induced NF-κB p65 nuclear translocation and DNA binding activity. Oridonin prevented LPS-stimulated NF-κB regulator IKKα/β and IκBα phosphorylation and IκBα degradation. Combined treatment of oridonin and an Hsp70 substrate binding inhibitor synergistically suppressed LPS-stimulated proinflammatory cytokines and NF-κB pathway activation. Therefore, oridonin inhibits LPS-stimulated proinflammatory mediators through IKK/IκBα/NF-κB pathway. Oridonin could be a promising agent for a hepatic anti-inflammatory.

Targeting TRIM3 deletion-induced tumor-associated lymphangiogenesis prohibits lymphatic metastasis in esophageal squamous cell carcinoma.

Tumor-associated lymphangiogenesis has attracted increasing attention because of its potential contribution to lymph node metastasis. However, the molecular mechanisms underlying lymphangiogenesis in cancer remains elusive. In the current study, we demonstrate that tripartite motif-containing 3 (TRIM3) directly interacts with and induces E3 ligase-dependent proteasomal turnover of importin α3 and α-Actinin-4 (ACTN4), which controls nuclear factor kappa B (NF-κB) activity at a well-ordered level. Heterozygous deletion-mediated TRIM3 downregulation led to NF-κB constitutive activation through disruption of the NF-κB-IκB-α negative feedback loop and enhancement of the p65 DNA-binding affinity and transcriptional activity via promoting symmetrical dimethylarginine modification of NF-κB/p65 at Arg30 and Arg35, which consequently promoted lymphatic metastasis of esophageal squamous cell carcinoma (ESCC) cells. Treatment with Tecfidera, a medication used to treat multiple sclerosis, restored the negative feedback inhibition of NF-κB by reducing the NF-κB/ACTN4 interaction and decreasing symmetrically dimethylated NF-κB levels, resulting in inhibition of ESCC lymphatic metastasis both in vitro and in vivo. Taken together, our results uncover a novel mechanism for constitutive NF-κB activation in cancer and may represent an attractive strategy to treat ESCC lymphatic metastasis.

Activation of Aryl Hydrocarbon Receptor Negatively Regulates Thymic Stromal Lymphopoietin Gene Expression via Protein Kinase Cδ-p300–NF-κB Pathway in Keratinocytes under Inflammatory Conditions

Epithelial-derived thymic stromal lymphopoietin (TSLP) plays an important role in pathogenesis in several types of dermatitis. Recently, the anti-inflammatory effects of aryl hydrocarbon receptor (AhR) have been reported in inflamed skin. In this study, keratinocytes were stimulated with tumor necrosis factor-α or flagellin in combination with AhR ligands or antagonist. TSLP gene expression and recruitment of transcriptional regulator to TSLP gene promoter were determined. The effects of AhR activation were also studied in DNFB-induced dermatitis model. We found that AhR activation suppressed upregulation of TSLP expression in keratinocytes treated with tumor necrosis factor-α or flagellin. In addition, AhR activation induced protein kinase Cδ-mediated phosphorylation of p300 at serine 89, leading to decreased acetylation and DNA binding activity of NF-κB p65 to the TSLP gene promoter. We also found that AhR activation alleviates dermatitis induced by DNFB treatment. Protein kinase Cδ depletion by small interfering RNA abolished the beneficial effect of AhR activation on dermatitis. Our study suggests that AhR activation may help to reduce inflammation in the dermatitis via downregulation of TSLP expression.

Targeting IRAK4 Disrupts Inflammatory Pathways and Delays Tumor Development in Chronic Lymphocytic Leukemia

Interleukin-1 receptor-associated kinase 4 (IRAK4) plays a critical role in Toll-like receptor (TLR) signal transduction and the innate immune responses. Recruitment and subsequent activation of IRAK4 upon TLR stimulation is mediatedby the myeloid differentiation primary response 88 (MYD88) adaptor protein. Around 5% of chronic lymphocytic leukemia (CLL) patients have activating mutations of MYD88, a driver mutation in this disease. Gene expression profiling of 423 CLL cases, assessed by the computational GSEA analysis tool, identified enrichment of gene sets related to cytokines and inflammation in the subgroup carrying mutations in MYD88. Accordingly, CLL cells from individuals with MYD88 mutations showed higher p65 NF-κB activity and secreted higher basal levels of CCL2, CCL3 and CCL4 cytokines compared with unmutated cases. To assess the effects of this pathway in CLL, we stimulated these cells with a TLR agonists mix, containing Pam3CSK4, HKLM, FSL1 and ODN2006, which was able to induce cytokines secretion, increase in NF-KB activity and STAT3 signaling as well as cells proliferation and migration. Here, we study the pharmacological inhibition of IRAK4 with ND2158, an IRAK4 competitive inhibitor, as a therapeutic approach in CLL. ND2158 was able to efficiently decrease all TLR effects seen with the mix like STAT3 signaling and the secretion of CCL2, CCL3, CCL4, TNFα, IL1β, IL10 and IL6 cytokines (assessed by Luminex). NF-κB signaling was also modulated by the drug, as observed by the downregulation of IκBα phosphorylation protein level, p65 translocation to the nucleus and decreased p65 DNA binding activity. ND2158 also impaired CLL proliferation (checked by carboxyfluoresceinsuccinimidyl ester staining) and migration towards CXCL12 in MYD88-mutated and -unmutated CLL cases.ND2158 also induced a selective dose-dependent cytotoxic effect in CLL cells, without differences regarding their MYD88 mutational status. To further validate this results, we checked the effect of ND2158 in splenocytes from leukemic Eμ-TCL1 mice and similar antitumor effects were seen.In addition to the direct impact on tumor cells, we analyzed whether ND2158 also affects other immune cells that also signal via MYD88/IRAK4. Monocytes, broadly known for their importance in tumor supporting, were also modulated by TLR agonists, and a reduction in activation markers and cytokines secretion was achieved after ND2158 treatment.In vivo studies in Eμ-TCL1 leukemic mice showed a significant reduction in tumor load in CLL-affected organs (peripheral blood, spleen, lymph node and peritoneal cavity) associated with reduced PD-L1 expression levels in mice treated with 100 mg/kg/day of the IRAK4 inhibitor. A decrease in spleen weight and size was also detected after the treatment. Corroborating the in vitro studies,ND2158 also modulated tumor-supporting monocytes. The effect of ND2158 was also assessed in CD8+ effector T cells, where a low proliferative (Ki-67+ percentage), exhausted phenotype (increase in TIGIT, CD244, CD160 and LAG3 markers) and less functional population (increase in the immune checkpoint protein PD-1) was found.Based on our in vitro data, it seems that ND2158 targets both MYD88 mutated and unmutated CLL cases to a similar degree. Since CLL progression in the TCL1 mouse model has not been reported to be driven by an activating MYD88 mutation, our in vivo results support the notion that IRAK4 inhibition might also be effective in CLL patients with an unmutated MYD88 status. To overcome the potential negative impact of IRAK4 inhibition on T cells, the combination treatment with drugs that improve T cell function and avoid their rapid exhaustion should be considered. As we observed increased expression of several inhibitory receptors on CD8+ T cells in ND2158-treated mice, including PD-1 and TIGIT, blocking these receptors with antibodies might be a successful strategy to overcome loss of T cell function and improve therapy outcome.In summary, our data show the importance of TLR signaling in CLL development and suggest IRAK4 as a novel treatment target for CLL that targets both the malignant cells and the tumor-supportive inflammatory milieu. DisclosuresNo relevant conflicts of interest to declare.

Antifibrosis Effect of Novel Oridonin Analog CYD0618 Via Suppression of the NF-κB Pathway

BackgroundLiver fibrosis is characterized as excessive deposition of the extracellular matrix proteins, primarily by activated hepatic stellate cells (HSCs). NF-κB has been reported as one of the major mediators of HSC activation. Previously, our team reported that oridonin exhibited antihepatic fibrogenetic activity in vitro. In this study, we examined the effects of its novel derivative CYD0618 on HSC viability, apoptosis, and NF-κB signaling. MethodsCell proliferation of activated human and rat HSC lines LX-2 and HSC-T6 was measured using Alamar Blue Assay. Apoptosis was measured by a Cell Death Detection ELISA kit. Cellular proteins were determined by Western blots and immunofluorescence. ResultsCYD0618 significantly inhibited LX-2 and HSC-T6 cell proliferation in a dose-dependent manner. CYD0618 induced cell apoptosis in both cell lines. CYD0618 treatment increased cell cycle inhibitory protein p21, p27, and induced apoptosis marker cleaved poly (ADP-ribose) polymerase, while suppressing the expression of Collagen type 1. CYD0618 blocked lipopolysaccharide (LPS)-induced NF-κB p65 nuclear translocation and DNA binding activity and prevented LPS-induced NF-κB inhibitory protein IκBα phosphorylation and degradation. LPS-stimulated NF-κB downstream target cytokines IL-6 and MCP-1 were attenuated by CYD0618. Endogenous and LPS-stimulated NF-κB p65 S536 phosphorylation was inhibited by CYD0618 treatment. ConclusionsThe potent antihepatic fibrogenetic effect of CYD0618 may be mediated via suppression of the NF-κB pathway.

Ribosomal Protein S3 Gene Silencing Protects Against Cigarette Smoke-Induced Acute Lung Injury

Chronic obstructive pulmonary disease (COPD) is estimated to be the third leading cause of death by 2030. Transcription factor NF-κB may play a critical role in COPD pathogenesis. Ribosomal protein S3 (RPS3), a 40S ribosomal protein essential for executing protein translation, has recently been found to interact with the NF-κB p65 subunit and promote p65 DNA-binding activity. We sought to study whether RPS3 gene silencing could protect against cigarette-smoke (CS)-induced acute lung injury in a mouse model. Effects of an intratracheal RPS3 siRNA in CS-induced lung injury were determined by measuring bronchoalveolar lavage (BAL) fluid cell counts, levels of inflammatory and oxidative damage markers, and NF-κB translocation. Lung RPS3 level was found to be upregulated for the first time with CS exposure, and RPS3 siRNA blocked CS-induced neutrophil counts in BAL fluid. RPS3 siRNA suppressed CS-induced lung inflammatory mediator and oxidative damage marker levels, as well as nuclear p65 accumulation and transcriptional activation. RPS3 siRNA was able to disrupt CS extract (CSE)-induced NF-κB activation in an NF-κB reporter gene assay. We report for the first time that RPS3 gene silencing ameliorated CS-induced acute lung injury, probably via interruption of the NF-κB activity, postulating that RPS3 is a novel therapeutic target for COPD.

PO-101 P53 core domain activity at low PH

IntroductionThe wild-type p53 is a nuclear tumour suppressor whose DNA binding function is critical for protection against cancer. The major role of p53 in normal cells is to induce cell cycle arrest or apoptosis in response cellular stress, particularly DNA damage. The region responsible for DNA interaction is located in its core domain (p53C). The specific DNA binding activity of p53 is crucial for its tumour suppression function. Missense mutations in the p53 gene are the most frequent type of gene-specific alterations in human cancer. These oncogenic mutant forms of p53 are deficient for specific DNA binding.Material and methodsDNA binding affinities of the p53C with either poly(GC) DNA or consensus DNA (5’ TTTCCTAGACATGCCTAATTA 3’) at low pH were monitored by anisotropy and intrinsic fluorescence, circular dichroism (CD), EMSA (Electrophoretic mobility shift assay) and isothermal titration calorimetry (ITC). HSQC and 1D- NMR (Nuclear magnetic resonance) measurements were carried out to observe the effect of pH on p53 structure.Results and discussionsOur results provided evidence that the specificity and stability of p53 protein:DNA complexes are influenced by pH. We describe the interaction of DNA and p53 at several pH (5.0, 5.5, 6.0, 6.5, 7.2) using fluorescence anisotropy. We confirm the formation of p53C:DNA complex under the same conditions by EMSA and ITC. Comparison of 1D and HSQC spectrum indicates structural changes in the presence of DNA when subjected at 7.2 or 6.0 pH. Far-UV CD shows that the secondary structure of p53 is maintained in the presence of specific (consensus) or unspecific (poliGC) DNA sequences in most studied pH, except at 5.0 pH. To verify the stability of p53:DNA complex at 5.0 pH, we use high pressure. This tool promote a greater effect on the p53 in the absence of DNA when compared with effect caused in the protein:DNA complex.ConclusionAltogether, these data support the hypothesis that the activity of p53 is maintained even after the acidification suggesting the pH change may have implications on cancer patology.

Abstract LB-083: Targeting IRAK4 disrupts inflammatory pathways and tumor microenvironment in chronic lymphocytic leukemia regardless MYD88 mutational status

Abstract BACKGROUND &amp; AIM. Interleukin-1 receptor-associated kinase 4 (IRAK4) plays a critical role in Toll-like receptor (TLR) signal transduction and the innate immune response. Recruitment of IRAK4 to these receptors and its subsequent activation is facilitated by the MYD88 adaptor protein. Approximately 2-5% of chronic lymphocytic leukemia (CLL) patients have activating mutations of MYD88, a driver mutation in this disease. Here we study the pharmacological inhibition of IRAK4 with ND2158, an IRAK4 competitive inhibitor, as a therapeutic approach in CLL. METHODS. TLR stimulation was performed with an agonist mix of Pam3CSK4, HKLM, FSL1 and ODN2006. Cytokine secretion and CLL proliferation were assessed by Luminex system and carboxyfluorescein succinimidyl ester staining, respectively. For in vivo studies, the Eμ-TCL1 adoptive transfer mouse model was used. RESULTS. TLR repertoire analysis in CLL cells revealed high expression levels of TLR1, TLR7 and TLR10. Gene expression profiling identified enrichment of gene sets related to cytokines and inflammation in the subgroup carrying mutations in MYD88. Accordingly, CLL cells from individuals with MYD88 mutations showed higher p65 NF-κB activity and secreted higher basal levels of CCL2, CCL3 and CCL4 cytokines compared with unmutated cases. ND2158 induced a selective dose-dependent cytotoxic effect in CLL cells, without differences regarding their MYD88 mutational status. In the context of TLR stimulation, ND2158 was able to efficiently decrease the secretion of CCL2, CCL3, CCL4, TNFα, IL1β and IL6 cytokines. NF-κB signaling was also modulated by the drug, as observed by the downregulation of IκBα phosphorylation protein level, p65 translocation to the nucleus and decreased p65 DNA binding activity. ND2158 also impaired CLL proliferation and migration towards CXCL12. In vitro experiments with splenocytes from leukemic Eμ-TCL1 mice corroborated the ND2158 antitumor effects. In vivo studies showed a significant reduction in tumor load in peripheral blood, lymph node, spleen and peritoneal cavity in mice treated with 100 mg/kg/day of the IRAK4 inhibitor. A decrease in spleen weight and size was also detected after the treatment. As monocytes have been shown to support CLL survival, we investigated ND2158 impact on this cell type. A significant reduction in monocyte absolute counts in spleen and skewing to inflammatory Ly6C+ monocytes in peritoneal cavity was detected after ND2158 treatment, thereby disrupting the support for tumor cells. CONCLUSION. Our findings support pharmacological inhibition of IRAK4 as a potential therapeutic strategy in CLL cells regardless of their MYD88 mutational status, indicating that TLR signaling plays an important role in CLL cells development and CLL tumor microenvironment. Citation Format: Laia Rosich, Neus Gimenez, Ralph Schulz, Morihiro Higashi, Marta Aymerich, Monica Lopez, Manel Juan, Martina Seiffert, Elias Campo, Dolors Colomer. Targeting IRAK4 disrupts inflammatory pathways and tumor microenvironment in chronic lymphocytic leukemia regardless MYD88 mutational status [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr LB-083.