Stage Ovarian Cancer Research Articles

Genome-Wide Identification of Laminin Family Related to Follicular Pseudoplacenta Development in Black Rockfish (Sebastes schlegelii).

As major elements of the basement membrane, laminins play a significant role in angiogenesis, migration, and adhesion of various cells. Sebastes schlegelii is a marine viviparous teleost of commercial importance. Previous research has reported abundant blood vessels and connective tissue in the ovary during gestation. In this study, 14 laminin genes of the α, β, and γ subfamilies from genomic data were identified based on zebrafish and human laminins, distributed on 9 chromosomes in S. schlegelii. Analysis of structural domains showed that coiled-coil regions and EGF domains existed in all laminin genes. Moreover, via qPCR, we found that the expression of laminin genes, including lama4, lama5, lamb4, lamc1, and lamc3, gradually increased from the phase III ovary stage and peaked in the early stage of gestation, especially lama4 and lama5 which showed dramatically increased expression at the blastula stage. Accordingly, in situ hybridization of lama4 was conducted. The results revealed that signals became stronger following the phase IV ovary stage, and the strongest signals were located on the follicular pseudoplacenta at the blastula stage. These results suggest that the high expression of laminin genes, especially lama4 after fertilization, may drive cell proliferation, migration, and tissue expansion in the S. schlegelii ovary and ultimately promote follicular pseudoplacenta formation.

Genome editing of SlMYB3R3, a cell cycle transcription factor gene of tomato, induces elongated fruit shape.

Fruit shape is an important trait that attracts consumers, and the regulation of genes related to cell division is crucial for shaping multicellular organs. In Arabidopsis, MYB3R transcription factors, which harbor three imperfect repeats in the N-terminus, control organ growth by regulating cell division. However, the function of MYB3Rs in tomato remains unknown. Here, we characterized tomato SlMYB3R3, which was preferentially expressed in flowers and placed in a subclade with two Arabidopsis cell cycle suppressors (MYB3R3/5). slmyb3r3 knockout mutants were generated using the CRISPR/Cas9 system. Morphological observation of the slmyb3r3 mutants showed that fruits that were elongated and occasionally peanut-like in shape were formed, which was caused by significantly increased cell numbers in the longitudinal direction. Transcriptome and yeast one-hybrid assay results suggested that SlMYB3R3 acted as a suppressor of cell-cycle-related genes by binding to the mitosis-specific activator (MSA) motifs in their promoters. Taken together, knock out of the suppressor SlMYB3R3 leads to elongated fruit, which results from the altered cell division pattern at the ovary stage, by regulating cell-cycle-related genes in an MSA-dependent manner. Our results suggest that SlMYB3R3 and its orthologs have the potential to change fruit shape as part of the molecular breeding of fruit crops.

Molecular mechanism of CD163+ tumor-associated macrophage (TAM)-derived exosome-induced cisplatin resistance in ovarian cancer ascites

BackgroundStudies have found that tumor-associated macrophages (TAMs) in the malignant ascites of patients with serous ovarian cancer exhibit a mixed polarization phenotype and highly variable expression of the surface marker CD163. The exosomes secreted by mesenchymal cells can be taken up by tumor cells, affecting the malignant biological behavior of them.MethodsUsing reverse transcription-polymerase chain reaction (RT-PCR) to detect the genes expression of drug resistance related factors cancer stem cells (CSCs)/multidrug resistance (MDR)/epithelial-mesenchymal transition (EMT) after CD163+ TAMs exosomes in ovarian cancer ascites co-cultured with A2780 and A2780/cis-diamminedichloroplatinum (DDP). Differences of the level of miR-221-3p expression between CD163+ TAMs cells (M2) and peripheral blood mononuclear cells M0 detect by microarray screening, and bioinformatics analysis predicts that its target gene is ADAMTS6. Western blot (WB) and immunohistochemical detection of ADAMTS6 expression level in epithelial ovarian cancer (EOC) clinical sample tissues, and analysis of the ADAMTS6 expression in ovarian cancer tissues and its correlation with clinicopathological factors. WB was used to detect the expression of AKT pathway and downstream EMT-related molecules [SNAIL1, ZEB1, Vimentin (VIM)] after co-culture of CD163+ TAMs exosomes with ovarian cancer cell lines A2780, A2780/DDP. WB detects the expression of EGFR and TGF-β1 upstream molecules of the AKT signaling pathway (AKT-pAKT) and downstream EMT molecules (SNAIL1, ZEB1, VIM) after overexpression of ADAMTS6 in A2780 and A2780/DDP.ResultsWe demonstrated that after CD163+ TAM exosomes were taken up by EOC cells, the highly expressed miR-221-3p could downregulate the level of ADAMTS6, further activate the AKT signaling pathway, and increase the expression of EMT transcription factors SNAIL1 and ZEB1 and the mesothelial marker VIM. Decreased expression of the epithelial marker E-cadherin induced EMT, triggering a switch to a CSC-like phenotype and MDR, thereby promoting EOC cell proliferation, adhesion, migration, and resistance. Compared with benign ovarian tumors, ADAMTS6 expression was low in EOC tissues and was closely related to the clinical stage, age, and survival curve of ovarian cancer patients.ConclusionsOverexpression of ADAMTS6 reduced the IC50 of cisplatin in ovarian cancer cells. The mechanism may be related to the inhibition of EMT mediated by the EGFR/TGF-β/AKT pathway of EOC cells, which has potential value in the treatment of ovarian cancer.

Hepatopancreas transcriptome analyses provide new insights into the molecular regulatory mechanism of fast ovary maturation in Macrobrachium nipponense

BackgroundMacrobrachium nipponense is an economically and ecologically important freshwater prawn that is widely farmed in China. In contrast to other species of marine shrimp, M. nipponense has a short sexual maturity period, resulting in not only high stocking densities, but also a reduced survival rate and increased risk of hypoxia. Therefore, there is an urgent need to study the molecular mechanisms underlying fast ovary maturation in this species.ResultsComparative transcriptome analysis was performed using hepatopancreatic tissue from female M. nipponense across five ovarian maturation stages to explore differentially expressed genes and pathways involved in ovarian maturation. In total, 118.01 Gb of data were generated from 15 transcriptomes. Approximately 90.46% of clean reads were mapped from the M. nipponense reference genome. A comprehensive comparative analysis between successive ovarian maturation stages generated 230–5814 differentially expressed genes. Gene Ontology (GO) enrichment was highly concentrated in the “biological process” category in all four comparison groups, and mainly focused on energy synthesis and accumulation, energy decomposition and transport. Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment results showed that, among 20 significantly enriched KEGG pathways, nine were involved in the synthesis, degradation, and metabolism of carbohydrates, lipids, and other nutrient intermediates, suggesting that the hepatopancreas has an important role in energy supply during ovarian maturation. Furthermore, the “Insect hormone biosynthesis” pathway was found to have a dominant role in the development of the ovary from immaturity to maturity, supporting the hypothesis that ecdysteroid- and juvenile hormone-signaling pathways have an important role in hepatopancreas regulation of ovarian maturation.ConclusionTaken together, this study sheds light on the role of the hepatopancreas in the molecular regulation of ovary maturation in M. nipponense. The present study provided new insights for understanding the mechanisms of reproductive regulation in crustaceans.

Insight of vitellogenesis patterns: A comparative analysis of the differences between the primary and secondary vitellogenesis period in the ovary, hepatopancreas, and muscle of mud crab, scylla paramamosain.

The mud crab, Scylla paramamosain, has abundant nutrients in its edible parts, ovary, hepatopancreas, and muscle during the ovarian maturation stage. The ovary of S. paramamosain can re-mature after spawning during the secondary ovarian maturation period. We aimed to analyze the characteristics of the first vitellogenesis period (FVP) 1 and second vitellogenesis period (SVP) 2 of S. paramamosain during ovarian maturation to understand the differences in vitellogenesis patterns between the first and second ovarian maturation periods. Accordingly, the gonadosomatic index (GSI) and hepatopancreatic index (HSI), the external and histological characteristics of the ovary and hepatopancreas, the Sp-Vg (vitellogenin, Vg) expression levels in the hepatopancreas and ovary, and the dynamics of the biochemical components in the ovary, hepatopancreas, and muscle were determined. Based on the results, the GSI was significantly positively correlated with HSI during the FVP and significantly negatively correlated with HSI from stage Ⅳ to stage Ⅴ of the SVP. A significant difference was found between the FVP and SVP in the hepatopancreas. Notably, the hepatopancreas displayed a gradual degeneration trend during the SVP. The expression level of Sp-Vg was significantly higher in the hepatopancreas than that in the ovary during the FVP and SVP. Seventeen amino acids were detected in the hepatopancreas, ovary, and muscle during the FVP and SVP, with glutamate as the predominant amino acid. During the FVP and SVP, the C16:0 and C18:1n9c were the dominant fatty acids in the hepatopancreas and ovary, the MUFA gradually increased in the ovary and hepatopancreas, and a significant difference was found in the dynamic trend of the HUFA and SFA contents from stage Ⅳ to stage Ⅴ between the FVP and SVP. These findings indicate that the ovary can re-mature after spawning in S. paramamosain and can maintain the status of the first ovarian maturation; however, the hepatopancreas gradually degenerate during the SVP.

Highly specific selenium nanosystems for fluorescent image-guided rapid diagnosis and pathological grading of ovarian malignant tumors

Comprehensive surgical staging or optimal tumor cytoreductive surgery of malignant ovarian cancer directly affects disease prognosis. Therefore, a fluorescent selenium nanoparticle (Se@RGD/S2.2) decorated with cancer-targeting Arg-Gly-Asp (RGD) peptides and GCAGTTGATCCTTTGGATACCCTGG aptamer (S2.2) was developed for use as a diagnostic agent to achieve rapid, noninvasive diagnosis and visualization of microinvasive lesions during surgery for malignant ovarian cancer.

Cathepsin D Plays a Vital Role in Macrobrachium nipponense of Ovary Maturation: Identification, Characterization, and Function Analysis.

The oriental river prawn Macrobrachium nipponense is an economically important aquacultural species. However, its aquaculture is negatively impacted by the rapid sexual maturation of female M. nipponense. The fast sexual maturation produces a large number of offspring which leads to a reduction in resilience, a low survival rate, and an increased risk of hypoxia, this in turn, seriously affects the economic benefits of prawn farming. Cathepsin D is a lysosomal protease involved in the ovarian maturation of M. nipponense. In the current study, the cDNA of the gene encoding cathepsin D (Mn-CTSD) was cloned from M. nipponense. The total length was 2391 bp and consisted of an open reading frame (ORF) of 1158 bp encoding 385 amino acids. Sequence analysis confirmed the presence of conserved N-glycosylation sites and characteristic sequences of nondigestive cathepsin D. The qPCR analysis indicated that Mn-CTSD was highly expressed in all tissues tested, most significantly in the ovaries, whereas in situ hybridization showed that expression occurred mainly in oocyte nuclei. Analysis of its expression during development showed that Mn-CTSD peaked during the O-IV stage of ovarian maturation. For the RNAi interference experiment, female M. nipponense specimens in the ovary stage I were selected. Injection of Mn-CTSD double-stranded (ds)RNA into female M. nipponense decreased the expression of Mn-CTSD in the ovaries, such that the Gonad Somatic Index (GSI) of the experimental group was significantly lower than that of the control group (1.79% versus 4.57%; p < 0.05). Ovary development reached the O-III stage in 80% of the control group, compared with 0% in the experimental group. These results suggest that Mn-CTSD dsRNA inhibits ovarian maturation in M. nipponense, highlighting its important role in ovarian maturation in this species and suggesting an approach to controlling ovarian maturation during M. nipponense aquaculture.

Energy utilization during ovarian development of the cichlid fish Oreochromis mossambicus (Peters) inhabiting a perennial lentic water body in Bangalore, India.

Mozambique tilapia Oreochromis mossambicus (Peters) is an invasive fish and a continuous breeder in inland waters of India. Present investigation highlights the distinct developmental stages of developing ovary and associated changes in the energy content. This investigation helps to understand the allocation of energy for development of eggs, prespawn and also oral brooding by the female. Although it is a continuous breeder, based on size of the ovary, number of eggs, their size and energy content, immature, early maturing, developing, prespawning and spawning stages are clearly noticed. Egg diameter during development of ovary varied between 0.31 mm (immature) and 2.21 mm (spawning). Energy content of ovary from immature to spawning stage ranged from 20.7515 kJ g-1 dry ovary to 31.1560 kJ g-1 dry ovary. Nearly 28.73% of energy content of ovary is expended for spawning. Similarly, yolk-sac fry utilized nearly 25.85% of energy of the fertilized egg for its development. Energy content of ovary of mouth-brooding female averaged 22.9528 kJ g-1 dry ovary, which is comparable to energy content of early maturing stage of ovary (24.5558 kJ g-1 dry ovary). A strong correlation between body weight and energy content of the developing ovary (P < 0.01), and between ovary weight and energy content of ovary (P < 0.01), was evident. During mouth-brooding, the fish continues to allocate energy to its developing ovary. Energy investment by the fish is the result of simultaneous processes associated with gonadal and somatic energy. As body size growth and gonadal development are interconnected, information on energy utilization by an iteroparous mouth-brooding fish could provide the pattern of energy allocation during ovarian developmental phase. Further details of energy utilization, as explained in this paper, could be used as one of the factors to predict the efficiency of fish production.

The latest reports on biomarkers used in the diagnosis of ovarian cancer

Introduction: Ovarian cancer ranks seventh in terms of incidence and eighth in terms of mortality among women worldwide. It is divided into several subtypes. The epithelial type of ovarian cancer is responsible for 90% of cases. The clinical picture is usually an appendage tumor detected by palpation or during pelvic imaging. Symptoms are usually non-specific such as abdominal pushing or bloating. &#x0D; State of knowledge: Ovarian cancer is usually detected at an advanced stage due to the long duration of absence of symptoms. Therefore, there is an urgent need to look at existing and identify potential biomarkers that can lead to the development of new and more effective predictors for the diagnosis and prognosis of ovarian cancer. The ability of these biomarkers to predict the existence and stages of ovarian cancer could improve early diagnosis and survival of ovarian cancer patients. Currently, the biomarkers CA-125 and HE4 play the most important role in diagnosis. However, there are an increasing number of reports on other biomarkers such as kallikreins, bikunin, VEGF, and mesothelin. &#x0D; Summary: Partly due to the lack of effective screening, ovarian cancer is usually diagnosed in the final stages. This is why ongoing research into new biomarkers that could contribute to faster detection of the disease is so important. They would also increase the effectiveness of the therapies used and enable a better prognosis of the course of the disease. &#x0D;

Impact of laparoscopic surgical algorithm to triage timing of tumor reductive surgery on overall survival in newly diagnosed advanced ovarian cancer (548)

<b>Objectives:</b> To estimate the effects of implementing a laparoscopic scoring algorithm to triage timing of tumor reductive surgery (TRS) in patients with newly diagnosed advanced-stage ovarian cancer on overall survival. <b>Methods:</b> In April 2013, we initiated a prospective quality improvement project utilizing laparoscopic scoring assessment to determine primary resectability in patients with newly diagnosed advanced- stage ovarian cancer in order to improve complete gross resection rates (R0). Current data were analyzed through March 2021. Patients who were medically inoperable or had distant metastatic disease did not undergo laparoscopic assessment and received neoadjuvant chemotherapy (NACT). A validated scoring method was used, and patients with predictive index value (PIV) > 10 received NACT, and those with PIV < 10 were offered primary TRS (algorithm updated from PIV <8 on March 1, 2018). Univariate and multivariate analysis was performed for effects of overall survival (OS). <b>Results:</b> A total of 1,124 patients were included in our analysis; the median follow-up was 28 months (1-96 months). Three hundred forty-five patients (31%) underwent laparoscopic scoring assessment, of which 206 patients (59%) had PIV <10, 112 patients (32%) had PIV > 10, 10 patients (3%) were unscorable, and 17 patients (5%) had an outside laparoscopic assessment with score unknown. Six hundred sixty-four (59%) patients were triaged directly to NACT without laparoscopic assessment. Patients triaged to primary TRS had a lower median CA-125 (404 vs 647 U/mL, p<0.001) and lower median platelet count at diagnosis (312 vs 365, p<0.001) compared to those triaged to NACT by laparoscopy. There was no difference in complete gross resection rates (R0) between those patients triaged to primary TRS versus NACT (84% vs 75%, p=0.32); however, 13% of patients triaged to NACT (p<0.001) were not candidates for interval TRS due to either stable disease (4%) or death (6%). Patients who underwent primary TRS had a significantly longer OS (85.4 months) compared to those who underwent NACT following laparoscopy (36.6 months) or were triaged to NACT and not candidates for laparoscopic assessment (38.5 months, p<0.001). Age (p<0.001), advanced stage (p<0.001), Charlson comorbidity index (p<0.001), platelet count at diagnosis (p=0.001), germline <i>BRCA</i> mutation status (p<0.001), and complete gross resection at TRS (<0.001) were factors significantly associated with OS in our patient population. <b>Conclusions:</b> Implementation of laparoscopic scoring triage in patients with newly diagnosed advanced-stage ovarian patients resulted in high complete gross resection rates at TRS and appropriately triaged select patients to primary TRS who had significantly longer OS. Laparoscopic scoring assessment is a valuable tool to incorporate into surgical practice in advanced ovarian cancer.

Misdiagnosed and over- or undertreated? Patients with synchronous ovarian and uterine cancers outperform those with single primaries (493)

Objectives: The objectives of this epidemiologic study were to investigate potential misdiagnosis of synchronous endometrial and ovarian cancers, utilizing the Surveillance Epidemiology and End Results (SEER) Program, which is a population-based tumor registry. We hypothesize that women diagnosed with synchronous tumors may have worse overall survival than those with nonsynchronous stage I tumors, closer to stage IIIA endometrial cancer due to misdiagnosis and potential undertreatment. Methods: This retrospective observational study utilized the SEER database to compare synchronous uterine and ovarian cancers cases to those of separate, primary endometrial and ovarian cancers. Kaplan-Meier analyses were used to construct overall survival curves, which were compared with log-rank tests. Cox proportional hazard regression models were utilized to adjust for age, adjuvant treatments, and histologic and grade subgroup pairings. Magnitudes of statistical significance were expressed with age-adjusted HR and 95% CI. Results: Women with stage I synchronous tumors had the highest progression-free survival of all groups compared to stage I non-syn- chronous (NS) ovarian and uterine cancers and NS stage IIIA uterine cancers with an HR of 0.44. The mean age at diagnosis for synchronous cancers was 52.54 years, compared to 61.53 for all other groups. After adjusting for age, the synchronous cancers continue to have the highest survival with a statistically significant HR of 0.74 (p=0.005). The most common histology type for synchronous cancers was endometrioid for both uterine and ovarian (n=593), with endometrioid uterine and serous ovarian histology types being the second most common (n=42). In a subgroup analysis with grade I endometrioid carcinomas of the uterus and ovary versus primary grade I endometrioid NS stage I of the ovary and NS stage I of the uterus, the improved survival relationship remains for the synchronous cancers (HR: 0.86, 0.60). In a similar subgroup limited to those patients with known chemotherapy or radiation treatment, those with synchronous cancers continue to have improved survival comparatively (HR: 0.54, 0.55). Conclusions: Contrary to our hypothesis, those diagnosed with synchronous cancers had improved survival than NS stage I primary uterine or ovarian cancers and stage IIIA uterine cancers. The survival advantage of patients with synchronous tumors is attributed to factors, including younger age, endometrioid histology, lower grade, and receipt of adjuvant treatment; however, after adjusting for these variables, the survival benefit relationship continued. Further studies need to be done for improved understanding, including HRD and molecular testing, which we are currently investigating. Objectives: The objectives of this epidemiologic study were to investigate potential misdiagnosis of synchronous endometrial and ovarian cancers, utilizing the Surveillance Epidemiology and End Results (SEER) Program, which is a population-based tumor registry. We hypothesize that women diagnosed with synchronous tumors may have worse overall survival than those with nonsynchronous stage I tumors, closer to stage IIIA endometrial cancer due to misdiagnosis and potential undertreatment. Methods: This retrospective observational study utilized the SEER database to compare synchronous uterine and ovarian cancers cases to those of separate, primary endometrial and ovarian cancers. Kaplan-Meier analyses were used to construct overall survival curves, which were compared with log-rank tests. Cox proportional hazard regression models were utilized to adjust for age, adjuvant treatments, and histologic and grade subgroup pairings. Magnitudes of statistical significance were expressed with age-adjusted HR and 95% CI. Results: Women with stage I synchronous tumors had the highest progression-free survival of all groups compared to stage I non-syn- chronous (NS) ovarian and uterine cancers and NS stage IIIA uterine cancers with an HR of 0.44. The mean age at diagnosis for synchronous cancers was 52.54 years, compared to 61.53 for all other groups. After adjusting for age, the synchronous cancers continue to have the highest survival with a statistically significant HR of 0.74 (p=0.005). The most common histology type for synchronous cancers was endometrioid for both uterine and ovarian (n=593), with endometrioid uterine and serous ovarian histology types being the second most common (n=42). In a subgroup analysis with grade I endometrioid carcinomas of the uterus and ovary versus primary grade I endometrioid NS stage I of the ovary and NS stage I of the uterus, the improved survival relationship remains for the synchronous cancers (HR: 0.86, 0.60). In a similar subgroup limited to those patients with known chemotherapy or radiation treatment, those with synchronous cancers continue to have improved survival comparatively (HR: 0.54, 0.55). Conclusions: Contrary to our hypothesis, those diagnosed with synchronous cancers had improved survival than NS stage I primary uterine or ovarian cancers and stage IIIA uterine cancers. The survival advantage of patients with synchronous tumors is attributed to factors, including younger age, endometrioid histology, lower grade, and receipt of adjuvant treatment; however, after adjusting for these variables, the survival benefit relationship continued. Further studies need to be done for improved understanding, including HRD and molecular testing, which we are currently investigating.

Furthering the clinical development of navicixizumab in advanced epithelial ovarian cancer patients with a population pharmacokinetic model and exploratory exposure-safety-efficacy response analyses (225)

Objectives: Cumulative data from navicixizumab clinical trials were analyzed to establish a population pharmacokinetic model, which was further used to characterize the relationships of navicixizumab exposure with safety and efficacy parameters. Methods: A population pharmacokinetic model was developed using data from clinical trials with navicixizumab in advanced cancer patients (B83-001), in combination with paclitaxel in advanced ovarian cancer patients (B83-002) and combination with standard of care in colorectal cancer patients (B83-003). Exposure-safety analyses focused on the relationship between navicixizumab exposures and systemic hypertension as measured with mean arterial pressure data and incidence of pulmonary hypertension assessed using peak tricuspid velocity data. For the purposes of this analysis, pulmonary hypertension was defined as peak tricuspid velocities >3.4 m/s. Exposure-efficacy analyses focused on objective response rates collected using RECIST version 1.1 and sum of the longest diameters of the target lesion. Results: The overall pharmacokinetic profile of navicixizumab was best described by a 2-compartment model with dose-proportional pharmacokinetics observed at doses ≥ 2.5 mg/kg. The effects of patient weight and patient antidrug antibody (ADA) status were identified as significant covariates in the model, where ADA positivity was associated with reduced clearance values. Changes in mean arterial pressure were concentration-dependent, where both Stage III/IV and ADA positive patients had lesser changes in mean arterial pressures. While peak tricuspid velocities were not related to navicixizumab concentrations, dose, disease stage, or disease indication, pulmonary hypertension was observed as being related to cumulative navicixizumab exposures as measured by AUC and total dose. Navicixizumab exposures were not significantly related to objective response rates. Ovarian stage III/IV cancer patients demonstrated a significant relationship between higher exposure and significantly greater reductions in target tumor size. Conclusions: A robust pharmacokinetic model was developed, demonstrating linear navicixizumab pharmacokinetics at doses ≥ 2.5 mg/kg. While the impact of ADA on navicixizumab clearance was statistically significant, the impact at therapeutically relevant doses was not clinically meaningful. Changes in mean arterial pressures with navicixizumab concentrations support a favorable adverse event profile in the ovarian patient population, while cumulative dose and exposures are associated with peak tricuspid velocities ≥ 3.4 m/s. When both ORR and changes in target tumor size were considered, cumulative navicixizumab exposures were associated with increased efficacy in ovarian cancer patients. Cumulative data reported herein support continued clinical development of navicixizumab, especially in ovarian cancer patients. Objectives: Cumulative data from navicixizumab clinical trials were analyzed to establish a population pharmacokinetic model, which was further used to characterize the relationships of navicixizumab exposure with safety and efficacy parameters. Methods: A population pharmacokinetic model was developed using data from clinical trials with navicixizumab in advanced cancer patients (B83-001), in combination with paclitaxel in advanced ovarian cancer patients (B83-002) and combination with standard of care in colorectal cancer patients (B83-003). Exposure-safety analyses focused on the relationship between navicixizumab exposures and systemic hypertension as measured with mean arterial pressure data and incidence of pulmonary hypertension assessed using peak tricuspid velocity data. For the purposes of this analysis, pulmonary hypertension was defined as peak tricuspid velocities >3.4 m/s. Exposure-efficacy analyses focused on objective response rates collected using RECIST version 1.1 and sum of the longest diameters of the target lesion. Results: The overall pharmacokinetic profile of navicixizumab was best described by a 2-compartment model with dose-proportional pharmacokinetics observed at doses ≥ 2.5 mg/kg. The effects of patient weight and patient antidrug antibody (ADA) status were identified as significant covariates in the model, where ADA positivity was associated with reduced clearance values. Changes in mean arterial pressure were concentration-dependent, where both Stage III/IV and ADA positive patients had lesser changes in mean arterial pressures. While peak tricuspid velocities were not related to navicixizumab concentrations, dose, disease stage, or disease indication, pulmonary hypertension was observed as being related to cumulative navicixizumab exposures as measured by AUC and total dose. Navicixizumab exposures were not significantly related to objective response rates. Ovarian stage III/IV cancer patients demonstrated a significant relationship between higher exposure and significantly greater reductions in target tumor size. Conclusions: A robust pharmacokinetic model was developed, demonstrating linear navicixizumab pharmacokinetics at doses ≥ 2.5 mg/kg. While the impact of ADA on navicixizumab clearance was statistically significant, the impact at therapeutically relevant doses was not clinically meaningful. Changes in mean arterial pressures with navicixizumab concentrations support a favorable adverse event profile in the ovarian patient population, while cumulative dose and exposures are associated with peak tricuspid velocities ≥ 3.4 m/s. When both ORR and changes in target tumor size were considered, cumulative navicixizumab exposures were associated with increased efficacy in ovarian cancer patients. Cumulative data reported herein support continued clinical development of navicixizumab, especially in ovarian cancer patients.

Transcriptome analysis of female western flower thrips, Frankliniella occidentalis, exhibiting neo-panoistic ovarian development.

The western flower thrips, Frankliniella occidentalis, is one of the most devastating insect pests with explosive reproductive potential. However, its reproductive physiological processes are not well understood. This study reports the ovarian development and associated transcriptomes of F. occidentalis. Each ovary consisted of four ovarioles, each of which contained a maximum of nine follicles in the vitellarium. The germarium consisted of several dividing cells forming a germ cell cluster, presumably consisting of oocytes and nurse cells. The nurse cells were restricted to the germarium while the subsequent follicles did not possess nurse cells or a nutritive cord, supporting the neo-panoistic ovariole usually found in thysanopteran insects. Oocyte development was completed 72 h after adult emergence (AAE). Transcriptome analysis was performed at mid (36 h AAE) and late (60 h AAE) ovarian developmental stages using RNA sequencing (RNASeq) technology. More than 120 million reads per replication were matched to ≈ 15,000 F. occidentalis genes. Almost 500 genes were differentially expressed at each of the mid and late ovarian developmental stages. Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis showed that these differentially expressed genes (DEGs) were associated with metabolic pathways along with protein and nucleic acid biosynthesis. In both ovarian developmental stages, vitellogenin, mucin, and chorion genes were highly (> 8-fold) expressed. Endocrine signals associated with ovarian development were further investigated from the DEGs. Insulin and juvenile hormone signals were upregulated only at 36 h AAE, whereas the ecdysteroid signal was highly maintained at 60 h AAE. This study reports the transcriptome associated with the ovarian development of F. occidentalis, which possesses a neo-panoistic ovariole.

Differentiating ovarian cancer stage, histology, and associated prognosis using pretreatment CA125: A study of4,555 patients (456)

Objectives: To evaluate the utility of CA-125 expression in differentiating histologic subtypes and their associated prognosis in patients with epithelial ovarian cancers. Methods: Data were abstracted from the Surveillance, Epidemiology, and End Results database from 2010-2015. Chi-square and Kaplan- Meier tests were used for statistical analysis. Results: Of 4,555 women with ovarian cancer, most were aged 55-59 years. White, Asian, and Black patients comprised 80%, 12%, and 7% of the group, respectively (1% other). In patients with information regarding the stage of disease, stage I was present in 42% of patients, stage II in 10%, stage III in 33%, and stage IV in 16%. Most tumor histologies were papillary serous at 40% compared to 27% endometrioid, 19% clear cell, and 14% mucinous. CA-125 levels were elevated in 82% of the overall group. The proportions of White, Asian and Black with elevated CA-125 were 82%, 76%, and 85% (p<0.01), respectively. Total 68%, 82%, 94%, and 95% of patients with stage I, II, III, and IV had elevated CA-125, respectively (p<0.01). Tumors with papillary serous histology had elevated CA-125 in 92% of cases, whereas endometrioid had 84%, clear cell 72%, and mucinous 63% (p<0.001). In the subgroup of those with stage I disease, CA-125 was increased in 68% of women. Of patients with stage I disease and papillary serous histology, 68% had elevated CA-125, while endometrioid had 79%, clear cell 63%, and mucinous 55% (p<0.001). Elevated expression in patients with stage I disease was associated with worsened survival in those with papillary serous histology but not other subtypes (93 vs 76%; p<0.001). The more advanced disease showed no association between decreased survival and increased CA-125 expression regardless of histology type. Conclusions: Pretreatment CA-125 levels were elevated in nearly 70% of stage I epithelial ovarian cancers and more likely in endometrioid and serous histologies versus other cell types. Increased CA-125 expression was associated with worse survival in patients with stage I disease and papillary serous histology but not other subtypes. Objectives: To evaluate the utility of CA-125 expression in differentiating histologic subtypes and their associated prognosis in patients with epithelial ovarian cancers. Methods: Data were abstracted from the Surveillance, Epidemiology, and End Results database from 2010-2015. Chi-square and Kaplan- Meier tests were used for statistical analysis. Results: Of 4,555 women with ovarian cancer, most were aged 55-59 years. White, Asian, and Black patients comprised 80%, 12%, and 7% of the group, respectively (1% other). In patients with information regarding the stage of disease, stage I was present in 42% of patients, stage II in 10%, stage III in 33%, and stage IV in 16%. Most tumor histologies were papillary serous at 40% compared to 27% endometrioid, 19% clear cell, and 14% mucinous. CA-125 levels were elevated in 82% of the overall group. The proportions of White, Asian and Black with elevated CA-125 were 82%, 76%, and 85% (p<0.01), respectively. Total 68%, 82%, 94%, and 95% of patients with stage I, II, III, and IV had elevated CA-125, respectively (p<0.01). Tumors with papillary serous histology had elevated CA-125 in 92% of cases, whereas endometrioid had 84%, clear cell 72%, and mucinous 63% (p<0.001). In the subgroup of those with stage I disease, CA-125 was increased in 68% of women. Of patients with stage I disease and papillary serous histology, 68% had elevated CA-125, while endometrioid had 79%, clear cell 63%, and mucinous 55% (p<0.001). Elevated expression in patients with stage I disease was associated with worsened survival in those with papillary serous histology but not other subtypes (93 vs 76%; p<0.001). The more advanced disease showed no association between decreased survival and increased CA-125 expression regardless of histology type. Conclusions: Pretreatment CA-125 levels were elevated in nearly 70% of stage I epithelial ovarian cancers and more likely in endometrioid and serous histologies versus other cell types. Increased CA-125 expression was associated with worse survival in patients with stage I disease and papillary serous histology but not other subtypes.

Malignant Bowel Obstruction in Ovarian Cancer Recurrence: The Role of Palliative Surgery in a Decision-Making Process

Background: Malignant bowel obstruction (MBO) is often the latest stage in ovarian cancer (OC). The therapy of this condition ranges from medical waiting to surgery. The objective of this pilot study is to compare the two strategies so that we can provide a path forward for future studies. Methods: From 700 women diagnosed with OC in the database of the Division of Gynecologic Oncology we crossed the names of those admitted by the emergency services of the IRCSS Azienda Ospedaliero Universitaria of Bologna, Italy. We selected MBO patients with a history of OC as the only neoplastic condition and compared the results between medical conduct and surgery to restore intestinal transit. Results: Of the 700 women in our database, 36 were eligible for study according to the inclusion and exclusion criteria: 9 in surgery group and 27 in medical group. Surgical conduct (tumor biopsy and stoma) appears to be resolutory for the obstruction and have a better result than medical therapy regarding recurrence of MBO, despite the development of greater complications. Relapses of MBOs occurred in 11% of surgical patients and 44% of medical patients (p = 0.0714). Furthermore, after surgical treatment, five patients (55%) experienced postoperative complications; in four cases, severe anemia requiring blood transfusion, while one patient developed post-surgical sepsis, which evolved into multiple organ failure and death. Of the 9 patients treated surgically, 2 (22%) were given surgery as a first choice. In most cases (78%), surgery was decided upon when medical treatment failed. The only discriminative factor appears to be age. The length of hospitalization increased with the patient’s age (p = 0.0181) as statistically significant factors for a worse outcome in surgery. Conclusions: MBO requires complex and multidisciplinary management where different factors need to be considered before initiating surgical therapy. Future studies are needed to deal with this complex problem.

Reproductive Cycle and Periodicity of In Situ and Aquarium Female Sand Tiger Sharks Carcharias taurus from the Western North Atlantic

Fundamental characteristics of the reproductive biology of female sand tiger sharks Carcharias taurus are needed to understand the periodicity, seasonality and environmental factors essential for reproduction in this iconic species. Animals in managed care, such as aquariums, provide the unique opportunity for longitudinal study in contrast to in situ sharks that are examined opportunistically, and at a single point in time. Additionally, comparison of reproductive observations from successfully reproducing in situ sharks and aquarium sharks may help elucidate reasons for lack of reproduction among aquarium sharks and aid the development of assisted reproductive techniques for managed populations. Reproductive status of in situ and aquarium female sharks was assessed using ultrasonography and plasma hormone (17β-estradiol, testosterone, and progesterone) monitoring. The reproductive cycle was divided into eight stages based on ovarian activity and uterine contents. In situ sharks were sampled from Delaware Bay (n = 29), North Carolina (n = 39) and South Carolina (n = 11) during April-November from 2015–2020. Nineteen aquarium females from five aquaria were examined longitudinally for two or more consecutive years. Reproductive regionalization was observed among in situ females with the majority (83%) of North Carolina females in an active state of reproduction and all Delaware females in a resting reproductive state. All aquarium females had a pattern of reproductive cycling that was consistent with alternating years of activity and rest with confirmed biennial (n = 7) or triennial (n = 3) reproductive cycles with spring seasonality. In contrast to in situ females, aquarium females often retained uterine eggs for 9-20 months after ovulation in the absence of a developing embryo(s). Pre-ovulatory aquarium females had significantly higher concentrations of 17β-estradiol, testosterone and progesterone than other reproductive stages. For females in the ovulatory stage, in situ females had higher testosterone than aquarium females. Endocrine differences between successfully reproducing in situ females and aquarium females likely contribute to the limited reproductive success observed for this species in managed care and may be a reflection of diminished seasonal cues and environmental differences.

Full-Length Transcriptome Sequencing and Comparative Transcriptomic Analysis Provide Insights Into the Ovarian Maturation of Exopalaemon carinicauda

The ridgetail white shrimp Exopalaemon carinicauda has the potential to be used as a useful experimental organism in the field of crustacean research due to its transparent body, large egg, and short reproductive cycle. However, little is known about the regulatory mechanisms of ovarian maturation in E. carinicauda. In this study, we applied PacBio single-molecule long-read sequencing technology to unveil the whole transcriptome landscape of Exopalaemon carinicauda to better understand the molecular mechanisms of ovarian development. A total of 49.05 G polymerase read bases were generated, finally, 15, 151 unigenes were successfully identified with a mean length of 4, 257 bp and an N50 of 4, 884 bp from ovary tissues (five different ovarian developmental stages). A total of 14, 007 unigenes were successfully annotated in at least one public database. In addition, 8, 861 coding sequences, 4, 594 lncRNAs and 895 transcription factors were identified. Furthermore, we performed RNA-Seq analysis combined with Iso-Seq results to investigate ovarian maturation regulation mechanism and validated the results by quantitative real-time PCR. We annotated five vitellogenin isoforms in the full-length transcriptome, meanwhile these five genes and vitellogenin receptor suggested an important role during previtellogenesis of E. carinicauda. Genes were involved in PI3K-Akt signaling pathway, retinol metabolism, cell cycle and hedgehog signaling pathway, which showed obvious associations with ovarian maturation of E. carinicauda. We identified 40 DEGs, such as forkhead box protein L2, which may be related to ovarian development in the comparisons. The expression profiles of genes such as ecdysone receptor, ecdysone-induced protein 74EF, ecdysone inducible gene E75 and post-molt protein suggest that they were significantly associated with reproductive molting in the ovarian mature stage. In conclusion, the present study identified important genes and pathways involved in ovarian maturation, which might be useful for studying the reproductive regulation and mechanisms of ovarian maturation in E. carinicauda.

Dysfunctional Ovarian Stem Cells Due to Neonatal Endocrine Disruption Result in PCOS and Ovarian Insufficiency in Adult Mice.

Polycystic ovarian syndrome (PCOS) is a common global cause of anovulatory infertility but underlying etiology leading to PCOS still remains elusive. Fetal and perinatal endocrine disruption reportedly affects germ cell nests (GCN) breakdown, meiosis, and primordial follicle (PF) assembly with unassembled oocytes in neonatal ovaries. We recently reported that very small embryonic-like stem cells (VSELs) and ovarian stem cells (OSCs) express ERα, ERβ and FSHR, undergo distinct cyclic changes and neo-oogenesis encompassing GCN formation, meiosis, and primordial follicle (PF) assembly on regular basis in adult mice ovaries and these GCN are arrested in pre-meiotic or early meiotic stage in aged ovaries. Present study was undertaken to evaluate whether neonatal exposure to endocrine disruption (estradiol E2 or diethylstilbestrol DES) affects ovarian stem cells and their differentiation (neo-oogenesis) and PF assembly in adult 100 days old ovaries. Neonatal exposure to E2 resulted in typical features of PCOS including hyperandrogenism, infertility, increased stromal compartment, absent corpus lutea, and cystic follicles whereas DES treated ovaries showed rapid recruitment of follicles in young ovaries and multi-ovular/cystic follicles. Ovary surface epithelial cells smears showed large numbers of growth-arrested GCN in zygotene/pachytene with increased expression of Mlh-1 and Scp-1 suggesting defects at synapsis and recombination stages during prophase-1 of meiosis. Being immortal and expression of ERα and ERβ makes VSELs directly vulnerable to carry developmental endocrine insults to adult life. Dysfunction of VSELs/OSCs possibly results in oocyte defects observedin our study in PCOS/POI besides the widely reported defects in granulosa cells.

Ovarian maturation of Penaeus subtilis (Decapoda: Penaeidae): A new insight to describe oocyte development and somatic structures

AbstractWe observed the presence of follicular cells (FC) in the ovaries of Penaeus subtilis (n = 1198), which led us to classify the development of germ cells into six phases: oogonia, previtellogenic oocytes, primary and secondary vitellogenic oocytes, mature oocytes and atretic oocytes. The FC changes their shape according to the development of germ cells and showed a different distribution along the ovary, which allowed differentiating vitellogenic oocytes into primary and secondary. We also observed that the postovulatory follicles (POF) are composed of follicular cells. The presence of POF in penaeids ovaries is rarely reported, but allows the differentiation between spent and resting stages, commonly grouped in reproductive biology research. Furthermore, observation of ovarian lining was useful to differentiate immature females from females that had spawned at least once. Thus, ovarian development was classified into six stages: immature, early developing, advanced developing, ripe, spent and resting. The distribution and shape variations of FC, ovarian lining features and presence of POF were considered crucial for the classification of ovarian maturation stages. The methods developed here may improve estimates of their reproductive cycle, size at first maturity and spawning season, which are important variables in future studies of the reproductive dynamics.

Development of Chitosan-Coated PLGA-Based Nanoparticles for Improved Oral Olaparib Delivery: In Vitro Characterization, and In Vivo Pharmacokinetic Studies

Olaparib (OLP) is an orally active poly (ADP-ribose) polymerase enzyme inhibitor, approved for treatment for the metastatic stage of prostate, pancreatic, breast and ovarian cancer. Due to its low bioavailability, an increase in dose and frequency is required to achieve therapeutic benefits, which also results in associated toxicity in patients. In the current study, OLP-loaded poly (d,l-lactide-co-glycolide) (PLGA) nanoparticles (NPs) (OLP-PLGA NPs) and a coating of OLP-PLGA NPs with chitosan (CS) (OLP-CS-PLGA NPs) were prepared successfully in order to improve the dissolution rate and bioavailability. The developed OLP-PLGA NPs were evaluated for hydrodynamic particle size (392 ± 5.3 nm), PDI (0.360 ± 0.03), ZP (−26.9 ± 2.1 mV), EE (71.39 ± 5.5%) and DL (14.86 ± 1.4%), and OLP-CS-PLGA NPs, hydrodynamic particle size (622 ± 9.5 nm), PDI (0.321 ± 0.02), ZP (+36.0 ± 1.7 mV), EE (84.78 ± 6.3%) and DL (11.05 ± 2.6%). The in vitro release profile of both developed NPs showed a sustained release pattern. Moreover, the pharmacokinetics results exhibited a 2.0- and 4.75-fold increase in the bioavailability of OLP-PLGA NPs and OLP-CS-PLGA NPs, respectively, compared to normal OLP suspension. The results revealed that OLP-CS-PLGA NPs could be an effective approach to sustaining and improving the bioavailability of OLP.