Oryza Sativa Cultivars Research Articles

Genome wide profiling ofAzospirillum lipoferum4B gene expression during interaction with rice roots

Azospirillum-plant cooperation has been mainly studied from an agronomic point of view leading to a wide description of mechanisms implicated in plant growth-promoting effects. However, little is known about genetic determinants implicated in bacterial adaptation to the host plant during the transition from free-living to root-associated lifestyles. This study aims at characterizing global gene expression of Azospirillumlipoferum 4B following a 7-day-old interaction with two cultivars of Oryza sativa L. japonica (cv. Cigalon from which it was originally isolated, and cv. Nipponbare). The analysis was done on a whole genome expression array with RNA samples obtained from planktonic cells, sessile cells, and root-adhering cells. Root-associated Azospirillum cells grow in an active sessile-like state and gene expression is tightly adjusted to the host plant. Adaptation to rice seems to involve genes related to reactive oxygen species (ROS) detoxification and multidrug efflux, as well as complex regulatory networks. As revealed by the induction of genes encoding transposases, interaction with root may drive bacterial genome rearrangements. Several genes related to ABC transporters and ROS detoxification display cultivar-specific expression profiles, suggesting host specific adaptation and raising the question of A.lipoferum 4B/rice cv. Cigalon co-adaptation.

Analysis of Genetic and Molecular Identity Among Field Isolates of the Rice Blast Fungus with an International Differential System, Rep-PCR, and DNA Sequencing.

The Pi-ta gene deployed in southern U.S. rice germplasm is effective in preventing the infection by strains of Magnaporthe oryzae isolates that carry the avirulence (AVR) gene AVR-Pita1. In the present study, 169 isolates from rice (Oryza sativa) cultivars, with and without Pi-ta, were analyzed for their genetic identity using an international differential system, repetitive element-based polymerase chain reaction (Rep-PCR), and sequence analysis of PCR products of AVR-Pita1. These isolates belong to the races IA1, IB1, IB17, IC1, and IC17 of M. oryzae. These isolates were further classified into 15 distinct groups by Rep-PCR. There was a predominant group within each race. Pathogenicity assays on 'Katy' (Pi-ta) and 'M202' (pi-ta) rice determined that IC1 was virulent to Katy and M202; IB17, IC17, and most of IA1 and IB1 were avirulent to Katy and virulent to M202, suggesting that the Pi-ta gene in Katy is responsible for preventing infection by these isolates. Consistently, AVR-Pita1 was not amplified from 28 virulent isolates. One AVR-Pita1 allele was amplified by AVR-Pita1-specific primers in 78 avirulent isolates. Interestingly, different AVR-Pita1 alleles were found in each of the 12 avirulent isolates, as determined by DNA sequencing. Sequence analysis of 90 PCR products revealed 10 AVR-Pita1 haplotypes, 4 of which were new. In total, 12 amino acid changes were identified in the new variants when compared with the first described AVR-Pita sequence (AF207841). The finding of isolates with altered AVR-Pita1 from rice cultivars with and without Pi-ta suggests that these virulent isolates were adapted to the field environments in the southern United States. Further research will be needed to verify this prediction.

Effects of Plant Genotype and Nitrogen Level on Bacterial Communities in Rice Shoots and Roots

To examine whether microbial community structure differs across rice genotypes, automated ribosomal intergenic spacer analysis (ARISA) was conducted. Nine cultivars of Oryza sativa ssp. indica or japonica and seven lines of other Oryza species were grown in paddy fields with low, standard, and high levels of N fertilization. Multidimensional scaling plots of bacterial ARISA for aerial parts of rice (shoots) revealed that the structure of shoot bacterial communities was significantly affected by plant genotype (indica or japonica) based on similarity tests, whereas root microbiomes were largely affected by the N fertilization level.

Genome-wide multilocus analysis of intraspecific differentiation in Oryza rufipogon Griff. from China and the influence of introgression from O. sativa L.

Twenty-five populations of Oryza rufipogon from China and 144 cultivars of Oryza sativa were selected for this study. Based on the DNA fragment of Ehd1-4 and subspecies-specific sequence-tagged site markers in different chromosomes, intraspecific differentiation in O. rufipogon from China was analyzed. The introgression from O. sativa to O. rufipogon was also analyzed based on simple sequence repeat markers. The results revealed that the DNA fragment of Ehd1-4 could distinguish the O. sativa subspecies japonica and indica. Furthermore, although significant indica-japonica differentiation did not occur in most O. rufipogon populations from China, O. rufipogon varieties from Hainan Island and from the mainland of China showed differentiation tendencies. Japonica-like O. rufipogon varieties were predominant in Mainland China. However, more indica-like O. rufipogon varieties were found in Hainan Island. Finally, although cultivar-specific alleles were found in most of the O. rufipogon varieties from Hainan Island and Guangdong Province, some varieties remain pure and non-introgressive.

Whole Genomic Sequencing of RT98 Mitochondria Derived from Oryza rufipogon and Northern Blot Analysis to Uncover a Cytoplasmic Male Sterility-Associated Gene

Cytoplasmic male sterility (CMS) is a maternally inherited trait resulting in the failure to produce functional pollen and is often observed when an alien cytoplasm is transferred into a cultivated species. An RT98A CMS line and an RT98C fertility restorer line were obtained by successive backcrossing between Oryza rufipogon W1109 and Oryza sativa cultivar Taichung 65. To uncover the CMS-associated mitochondrial genes, we determined the complete sequence of the RT98-CMS mitochondrial genome using next-generation pyrosequencing, and searched new open reading frames (orfs) absent in a reported mitochondrial genome of O. sativa Nipponbare. Then, six candidates were selected for the CMS-associated genes based on the criteria in which they were chimeric in structure or encoded a peptide with transmembrane domains. One of the candidates, orf113, showed different transcript sizes between RT98A and RT98C on Northern blot analysis. The orf113 gene was shown to be co-transcribed with atp4 and cox3 encoding ATP synthase F0 subunit 4 and Cyt c oxidase subunit 3, respectively, and their transcripts were distinctly processed in the presence of a fertility restorer gene. Our results indicate that orf113 is a CMS-associated gene of RT98-CMS.

First Report of Rice yellow mottle virus on Rice in Burundi.

Since the mid-1980s, rice cultivation has expanded rapidly in Burundi to reach approximately 50,000 ha in 2011. In 2007, leaf mottling, reduced tillering, and stunting symptoms were observed on rice at Gatumba near Bujumbura, causing small patches in less than 10% of the fields. Rice yellow mottle virus (RYMV, genus Sobemovirus), which has seriously threatened rice cultivation in Africa (1) and was recently described in the neighboring Rwanda (3), was suspected to be involved because of similar symptoms. To identify the pathogen that caused the disease in Burundi, a survey was performed in the major rice-producing regions of Burundi and Rwanda. Six locations in Burundi and four in Rwanda were investigated in April and October 2011. Disease incidence in the fields was estimated to be 15 ± 5%. Symptomatic leaves of 24 cultivated rice plants were collected and tested by double antibody sandwich-ELISA with polyclonal antibodies raised against the RYMV isolate Mg1 (2). All tested samples reacted positively. Four isolates were inoculated on susceptible Oryza sativa cultivar IR64 (2). The typical symptoms of RYMV were reproduced 7 days after inoculation, whereas the noninoculated controls remained healthy. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from 12 samples. The RYMV coat protein gene was amplified by RT-PCR with primers 5'CGCTCAACATCCTTTTCAGGGTAG3' and 5'CAAAGATGGCCAGGAA3' (3). The sequences were deposited in GenBank (Accession Nos. HE654712 to HE654723). To characterize the isolates, the sequences of the tested samples were compared in a phylogenic tree including a set of 45 sequences of isolates from Rwanda, Uganda, western Kenya, and northern Tanzania (2,3). Six isolates from western Burundi, namely Bu1, Bu2, Bu4, Bu7, Bu10, and Bu13 (Accession Nos. HE654712 to HE654716 and HE654718), and the isolate Rw208 (HE654720) from southwestern Rwanda, belonged to strain S4-lm previously reported near Lakes Malawi and Tanganyika. They fell within the group gathering isolates from the western Bugarama plain of Rwanda (3). The isolates Bu16 (HE654719) and Bu17 (HE654717) from Mishiha in eastern Burundi belonged to strain S4-lv previously reported around Lake Victoria. However, they did not cluster with isolates from the eastern and southern provinces of Rwanda. They were genetically more closely related to isolates of strain S4-lv from northern Tanzania. Overall, the phylogeography of RYMV in Burundi and Rwanda region was similar. In the western plain of the two countries, the isolates belonged to the S4-lm lineage, whereas at the east of the two countries at midland altitude, they belonged to the S4-lv lineage. The presence of RYMV in Burundi should be considered in the future integrative pest management strategies for rice cultivation in the country.

Miniature inverted-repeat transposable elements (MITEs) in rice were originated and amplified predominantly after the divergence of Oryza and Brachypodium and contributed considerable diversity to the species

Miniature inverted-repeat transposable elements (MITEs) are ubiquitous in high eukaryotic genomes. More than 178,000 MITE sequences of 338 families are present in the genome of rice (Oryza sativa) cultivar Nipponbare. Interestingly, only two of the 338 MITE families have homologous sequences in the genome of Brachypodium distachyon, a relative in the grass family. Therefore, the vast majority of MITEs in the rice genome were originated and amplified after the divergence of Oryza and Brachypodium. Comparison between rice cultivar Nipponbare and another rice cultivar 93–11 showed 14.8% of MITEs exhibit presence/absence (P/A) polymorphism. The P/A polymorphism was mainly attributed to recent MITE transpositions, while less than 10% of the P/A polymorphism was caused by MITE excisions. Therefore, the high P/A polymorphisms of MITEs may generate considerable gene expression and phenotypic diversity for O. sativa.

Identification and Validation of Quantitative Trait Loci for Agronomic Traits in Advanced Backcross Breeding Lines Derived from Oryza rufipogon × Oryza sativa Cultivar MR219

A backcross breeding strategy was used to identify quantitative trait loci (QTLs) associated with 14 traits in a BC2F2 population derived from a cross between MR219, an indica rice cultivar and an accession of Oryza rufipogon (IRGC 105491). A total of 261 lines were genotyped with 96 microsatellite markers and evaluated for plant morphology, yield components and growth period. The genetic linkage map generated for this population with an average interval size of 16.2 cM, spanning 1,553.4 cM (Kosambi) of the rice genome. Thirty-eight QTLs were identified with composite interval mapping (CIM), whereas simple interval mapping (SIM) resulted in 47 QTLs (LOD >3.0). The O. rufipogon allele was favourable for 59% of QTLs detected through CIM. Of 261 BC2F2 families, 26 advanced backcross breeding lines (BC2F5) were used for QTL validation. These lines were selected on the basis of the yield traits potentiality in BC2F3 and BC2F4 generations. The field trial was conducted at three different locations in Malaysia using randomized complete block design with three replications. Trait based marker analysis was done for QTL determination. Twenty-five QTLs were detected in BC2F5 generation whereas 29 QTLs were detected in BC2F2 generation of the same population. Two QTLs (qPL-1 and qSPL-7) were not considered for validation due to their low R 2 values and two QTLs (qPSS-3-2 and qGW-3-2) were not detected in the BC2F5 population. Fifteen QTLs showed the beneficial effect to enhance the trait value of the breeding lines. QTL validation aided to select the promising lines for further utilization.

Characterization of quantitative trait loci for number of primary branches in near-isogenic lines from a cross between the Oryza sativa cultivar ‘Hwayeongbyeo’ and the wild relative Oryza rufipogon

With 3 figures and 2 tables Abstract In our previous study, a quantitative trait locus (QTL) qpb2 for primary branches (PB) was mapped on chromosome 2 using introgression lines from an interspecific cross between ‘Hwayeongbyeo’ and an Asian common wild rice (Oryza rufipogon Griff.), W1944. To confirm this QTL, CR6076 (BC3F6) was selected and backcrossed to ‘Hwayeongbyeo’ to produce near-isogenic line (NIL) populations in the BC4F3, BC4F4 and BC4F5 generations. QTL analysis in three generations revealed five QTLs including plant height and PB that were mapped in the same interval. The O. rufipogon alleles decreased of PB. By substitution mapping, qpb2 was narrowed down to a 575-kb region. Colocalization of five QTLs suggests that this locus was associated with panicle structure with pleiotropic effects. The finding that QTLs for panicle traits have been mapped mainly from wild species in a similar location as qpb2 suggest that qpb2 might have played an important role in the regulation of PB during the domestication of rice panicle. The NIL populations and molecular markers are useful materials for cloning of the qpb2.

Effects of salt stress on germination and early seedling growth of rice (Oryza sativa) cultivars in Iran

-2 Nacl) on germination and seedling properties of three rice cultivars (Anbar, LD and Hamar). Experiment was arranged as split-plot based on randomized complete block design in three replications, with the salinity levels in main plots and rice cultivars in subplots. The results indicate that all traits were significantly (P ≤0.05) affected by salt stress, where germination, plumule and radicle length and weight were decreased with increasing in salt concentration. The extent of these reductions was related with the variations in rice cultivar under different salt stress condition. By increasing NaCl concentration, seed germination delayed and decreased in all cultivars. Regarding the relationship between speed of germination and seed vigor, salt stress decreased seed vigor of rice cultivars LD a superior cultivar under all salt stress which can be suggested for cultivation under salinity condition.

Delivering resistance to a major constraint for rain‐fed rice production

Delivering resistance to a major constraint for rain‐fed rice production

AFLP Analysis of Genetic Relationships and Diversity of Sri Lankan Oryza sativa Cultivars

AFLP Analysis of Genetic Relationships and Diversity of Sri Lankan Oryza sativa Cultivars

The adaptation of Rice yellow mottle virus to the eIF(iso)4G-mediated rice resistance

The rymv1–3 allele of the eIF(iso)4G-mediated resistance to Rice yellow mottle virus (RYMV) is found in a few Oryza glaberrima cultivars. The same resistance-breaking (RB) mutations emerged in the central domain of the VPg after inoculation of isolates of different strains. The RB mutations were fixed, often sequentially, at codons 41 and 52 which paralleled an increase in virus accumulation. RB mutations also emerged after inoculation of an avirulent infectious clone, indicating that they were generated de novo in resistant plants. Only virus isolates with a threonine at codon 49 of the VPg broke rymv1–3 resistance, those with a glutamic acid did not. A small subset of these isolates overcame rymv1–2 resistance, but following a specific pathway. Comparison with the RB process of rymv1–2, a resistance allele found in a few Oryza sativa cultivars, showed similarities in the mode of adaptation but revealed converse virulence specificity of the isolates.

Protocol: a simple gel-free method for SNP genotyping using allele-specific primers in rice and other plant species

BackgroundGenotype analysis using multiple single nucleotide polymorphisms (SNPs) is a useful but labor-intensive or high-cost procedure in plant research. Here we describe an alternative genotyping method that is suited to multi-sample or multi-locus SNP genotyping and does not require electrophoresis or specialized equipment.ResultsWe have developed a simple method for multi-sample or multi-locus SNP genotyping using allele-specific primers (ASP). More specifically, we (1) improved the design of allele-specific primers, (2) established a method to detect PCR products optically without electrophoresis, and (3) standardized PCR conditions for parallel genomic assay using various allele-specific primers. As an illustration of multi-sample SNP genotyping using ASP, we mapped the locus for lodging resistance in a typhoon (lrt5). Additionally, we successfully tested multi-locus ASP-PCR analysis using 96 SNPs located throughout the genomes of rice (Oryza sativa) cultivars 'Koshihikari' and 'Kasalath', and demonstrated its applicability to other diverse cultivars/subspecies, including wild rice (O. rufipogon).ConclusionOur ASP methodology allows characterization of SNPs genotypes without electrophoresis, expensive probes or specialized equipment, and is highly versatile due to the flexibility in the design of primers. The method could be established easily in any molecular biology laboratory, and is applicable to diverse organisms.

Genetic analysis of Turkish rice varieties (Oryza sativa L.) using seed storage proteins and RAPD markers

Due to an increasing demand for rice in Turkey, assessing and maintaining genetic variability in rice cultivars is essential for the success of rice breeding programs. Genetic polymorphisms in seed storage proteins (SSP) and RAPD markers were evaluated among different Turkish cultivars of Oryza sativa L. Twenty-one rice cultivars of Turkish origin and 11 rice cultivars from Bulgaria, France, Italy and Russia were analyzed. SDS-PAGE profiles from SSP of 20 cultivars showed similar expression patterns. Seven polymorphic and reproducible RAPD primers produced 42 bands ranging from 250 to 2,500 bp; 29 were polymorphic (69%) and 13 monomorphic (31%). Unweighted Pair-Group Method with Arithmetic Mean (UPGMA) was performed to generate a pairwise genetic distance (or similarity) matrix. A rooted dendrogram resulted in two main groups based on Jaccard’s coefficients. Surek-95, Serhat-92, and Rocca were placed in one group, and all other cultivars in another group. Principle coordinate analysis was also conducted and the results supported UPGMA results, where Surek-95, Serhat-92, and Rocca were distinct from all other cultivars. Our results suggest that the rice cultivars screened in this study exhibit narrow genetic diversity. In addition, RAPD-based genetic characterization can aid in both conservation and selection of desired rice cultivars in future breeding studies.

Dissection of a QTL reveals an adaptive, interacting gene complex associated with transgressive variation for flowering time in rice

A days to heading QTL (dth1.1) located on the short arm of rice chromosome 1 was sub-divided into eight sub-introgression lines (SILs) to analyze the genetic basis of transgressive variation for flowering time. Each SIL contained one or more introgression(s) from O. rufipogon in the genetic background of the elite Oryza sativa cultivar, Jefferson. Each introgression was defined at high resolution using molecular markers and those in the dth1.1 region were associated with the presence of one or more flowering time genes (GI, SOC1, FT-L8, EMF1, and PNZIP). SILs and controls were evaluated for flowering time under both short- and long-day growing conditions. Under short-day lengths, lines with introgressions carrying combinations of linked flowering time genes (GI/SOC1, SOC1/FT-L8, GI/SOC1/FT-L8 and EMF1/PNZIP) from the late parent, O. rufipogon, flowered earlier than the recurrent parent, Jefferson, while recombinant lines carrying smaller introgressions marked by the presence of GI, SOC1, EMF1 or PNZIP alone no longer flowered early. Under long-day length, lines carrying SOC1/FT-L8, SOC1 or PNZIP flowered early, while those carrying GI or EMF1 delayed flowering. Across all experiments and in the field, only SIL_SOC1/FT-L8 was consistently early. A preliminary yield evaluation indicated that the transgressive early flowering observed in several of the SILs was also associated with a measurable and positive effect on yield. These SILs represent a new source of variation that can be used in breeding programs to manipulate flowering time in rice cultivars without the reduction in yield that is often associated with early maturing phenotypes.

벼 발아종자 발현유전자의 발현특성분석

Seed germination is the important stage to express many genes for regulation of energy metabolism, starch degradation and cell division from seed dormancy state. For the functional analysis of seed germination mechanisms, we were analyzed the rice cDNA clones (Oryzasativa cultivar Ilpum) obtained from seed imbibition during 48 hours. Total number of 18,101 Expressed Sequence Tags (ESTs) were clustered using SeqMan program. Among them, 8,836 clones were identified as unique clones. We identified the chitinase gene specifically expressed in seed germination and amylase gene involved to starch degradation from the full length cDNA analysis, and several genes were registered to NCBI GeneBank. To analyzed the commonly expressed genes between inmature seed and germinated seed, 25,66 inmature ESTs and 18,101 germinated ESTs were clustered using SeqMan program and identified 2,514 clones as commonly expressed unigene. Among them, alpha-glubulin and alcohol dehydrogenase I were supposed to LEA genes only expressed in the immature and germinated seed stages. For the clustering of orthologous group genes, we further analyzed the 8,836 EST clones from germinating seeds using NCBI clusters of orthologous groups database. Among the clones, 5,076 clones were categorized into information storage and processing, cellular processes and signaling, metabolism and poorly characterized genes, proportioning 783 (14.29%), 1,484 (27%), 1,363 (24.8%) and 1,869 (34%) clones to the previous four categories, respectively.

Role of ferritin in the rice tolerance to iron overload

Plants ordinarily face iron (Fe) deficiency, since this mineral is poorly available in soils under aerobic conditions. Nonetheless, wetland and irrigated rice plants can be exposed to excess, highly toxic Fe. Ferritin is a ubiquitous Fe-storage protein, important for iron homeostasis. Increased ferritin accumulation resulting from higher Fe availability was shown in some plant species. However, the role of ferritin in tolerance mechanisms to Fe overload in rice is yet to be established. In this study, recombinant rice ferritin was expressed in Escherichia coli, producing an anti-rice ferritin polyclonal antibody which was used to evaluate ferritin accumulation in two rice (Oryza sativa L.) cultivars, either susceptible (BR-IRGA 409) or tolerant (EPAGRI 108) to Fe toxicity. Increased ferritin mRNA and protein levels resulting from excess Fe treatment were detected in both cultivars, with higher ferritin protein accumulation in EPAGRI 108 plants, which also reached lower shoot Fe concentrations when submitted to iron overload. The tolerance mechanism to excess Fe in EPAGRI 108 seems to include both restricted Fe translocation and increased ferritin accumulation. This is the first work that shows higher accumulation of the ferritin protein in an iron-excess tolerant Oryza sativa cultivar, providing evidence of a possible role of this protein in iron tolerance mechanisms.

Independent Losses of Function in a Polyphenol Oxidase in Rice: Differentiation in Grain Discoloration between Subspecies and the Role of Positive Selection under Domestication

Asian rice (Oryza sativa) cultivars originated from wild rice and can be divided into two subspecies by several criteria, one of which is the phenol reaction (PHR) phenotype. Grains of indica cultivars turn brown in a phenol solution that accelerates a similar process that occurs during prolonged storage. By contrast, the grains of japonica do not discolor. This distinction may reflect the divergent domestication of these two subspecies. The PHR is controlled by a single gene, Phr1; here, we report the cloning of Phr1, which encodes a polyphenol oxidase. The Phr1 gene is indeed responsible for the PHR phenotype, as transformation with a functional Phr1 can complement a PHR negative cultivar. Phr1 is defective in all japonica lines but functional in nearly all indica and wild strains. Phylogenetic analysis showed that the defects in Phr1 arose independently three times. The multiple recent origins and rapid spread of phr1 in japonica suggest the action of positive selection, which is further supported by several population genetic tests. This case may hence represent an example of artificial selection driving the differentiation among domesticated varieties.

Contrasting physiological responses by cultivars of Oryza sativa and O. glaberrima to prolonged submergence

Oryza glaberrima is widely grown in flood-prone areas of African river basins and is subject to prolonged periods of annual submergence. The effects of submergence on shoot elongation, shoot biomass, leaf area and CO(2) uptake were studied and compared with those of O. sativa. A wide selection of lines of O. sativa and O. glaberrima, including some classified as submergence tolerant, were compared in field and pot experiments. Plants were submerged completely for 31 d in a field experiment, and partially or completely for 37 d in a pot experiment in a growth chamber. Leaf elongation and growth in shoot biomass during complete submergence in the field were significantly greater in O. glaberrima than in O. sativa. So-called submergence-tolerant cultivars of O. sativa were unable to survive prolonged complete submergence for 31-37 d. This indicates that the mechanism of suppressed leaf elongation that confers increased survival of short-term submergence is inadequate for surviving long periods underwater. The O. sativa deepwater cultivar 'Nylon' and the 'Yélé1A' cultivar of O. glaberrima succeeded in emerging above the floodwater. This resulted in greatly increased shoot length, shoot biomass and leaf area, in association with an increased net assimilation rate compared with the lowland-adapted O. sativa 'Banjoulou'. The superior tolerance of deepwater O. sativa and O. glaberrima genotypes to prolonged complete submergence appears to be due to their greater photosynthetic capacity developed by leaves newly emerged above the floodwater. Vigorous upward leaf elongation during prolonged submergence is therefore critical for ensuring shoot emergence from water, leaf area extension above the water surface and a subsequent strong increase in shoot biomass.