Ornamental Orchid Research Articles

Characterization and phylogenetic analysis of the complete chloroplast genome sequence of Phalaenopsis deliciosa (Rchb. f. 1854)

Phalaenopsis deliciosa (Rchb. f.), an ornamental orchid known for vibrant flowers, has a 148,090 bp chloroplast genome with 36.78% GC content. It includes an 85,241 bp large single-copy (LSC) region, an 11,649 bp small single-copy (SSC) region, and two 13,800 bp inverted repeats (IRs), encoding 122 genes (76 protein-coding, 38 tRNA, and 8 rRNA). This genome data refines the Phalaenopsis gene database and supports research on phylogeny and molecular breeding.

Time to flowering of ornamental orchids

Objective: To analyze features of time to flowering of orchids and some strategies for its control in cultivation for ornamental purposes. Design/methodology/approach: Information from various authors and our own data is shown, in relation to the management of flowering time of ornamental orchids, based on treatments of environmental effects, plant growth regulators (PGRs) and nutrition. Findings/conclusions: It is possible to reduce the flowering time of orchids by environmental modifications, mainly temperature and photoperiod. This can also be achieved by nutritional management, mainly macro-nutritional, and through organic nutrition and PGRs. However, much more information is needed, especially for native orchid species with ornamental potential.

Geographic location shapes fungal communities associated with Epidendrum roots

Fungal biodiversity significantly influences ecosystem dynamics through various interactions with plants, ranging from pathogenic to mutually beneficial associations. This study explores the fungal diversity associated with an ornamental orchid genus Epidendrum that is widely propagated globally but native to northern South America. Root samples were collected from Epidendrum in diverse geographic locations: Brazil, Colombia, Germany, Spain and six South African provinces. Fungal biodiversity was catalogued from the genomic DNA extracted from these roots using fungal-specific primers and Illumina MiSeq sequencing. Bioinformatic and statistical analyses revealed significant fungal diversity in the roots, with distinct dominant orders in each geographic region. Among the South African samples, significant differences were found in alpha diversity indices and species richness. Even though samples originating from different provinces overlapped in the PCoA plot, PERMANOVA indicated a significant difference in the fungal biodiversity, which was further supported by PERMDISP. In the global dataset, alpha diversity indices were insignificant, but species richness was. In the PCoA plot, data points clustered by sampling sites, indicating substantial differences in fungal biodiversity between the samples. This was validated by PERMANOVA and PERMDISP analyses. Outcomes from the core fungal analyses showed Epidendrum retained a conserved set of fungal orders from its native habitat when it transitioned to exotic regions, while it also formed new associations with local fungal communities in these introduced regions. These findings highlight the role of both core and region-specific fungal communities in the ecological adaptability and success of this widely planted orchid genus.

Assembly and comparative analysis of the complete multichromosomal mitochondrial genome of Cymbidium ensifolium, an orchid of high economic and ornamental value

BackgroundOrchidaceae is one of the largest groups of angiosperms, and most species have high economic value and scientific research value due to their ornamental and medicinal properties. In China, Chinese Cymbidium is a popular ornamental orchid with high economic value and a long history. However, to date, no detailed information on the mitochondrial genome of any species of Chinese Cymbidium has been published.ResultsHere, we present the complete assembly and annotation of the mitochondrial genome of Cymbidium ensifolium (L.) Sw. The mitogenome of C. ensifolium was 560,647 bp in length and consisted of 19 circular subgenomes ranging in size from 21,995 bp to 48,212 bp. The genome encoded 35 protein-coding genes, 36 tRNAs, 3 rRNAs, and 3405 ORFs. Repeat sequence analysis and prediction of RNA editing sites revealed a total of 915 dispersed repeats, 162 simple repeats, 45 tandem repeats, and 530 RNA editing sites. Analysis of codon usage showed a preference for codons ending in A/T. Interorganellar DNA transfer was identified in 13 of the 19 chromosomes, with plastid-derived DNA fragments representing 6.81% of the C. ensifolium mitochondrial genome. The homologous fragments of the mitochondrial genome and nuclear genome were also analysed. Comparative analysis showed that the GC content was conserved, but the size, structure, and gene content of the mitogenomes varied greatly among plants with multichromosomal mitogenome structure. Phylogenetic analysis based on the mitogenomes reflected the evolutionary and taxonomic statuses of C. ensifolium. Interestingly, compared with the mitogenomes of Cymbidium lancifolium Hook. and Cymbidium macrorhizon Lindl., the mitogenome of C. ensifolium lost 8 ribosomal protein-coding genes.ConclusionIn this study, we assembled and annotated the mitogenome of C. ensifolium and compared it with the mitogenomes of other Liliidae and plants with multichromosomal mitogenome structures. Our findings enrich the mitochondrial genome database of orchid plants and reveal the rapid structural evolution of Cymbidium mitochondrial genomes, highlighting the potential for mitochondrial genes to help decipher plant evolutionary history.

Pemberdayaan Santri Melalui Pendampingan Budidaya Anggrek Di Pondok Pesantren Nurul Qur’an, Desa Kebulusan, Kabupaten Kebumen

The Nurul Qur'an Islamic Boarding School, which is located 5 KM from the city center of Kebumen Regency, has great economic development potential because of its strategic location. In order to increase the independence of students, it is necessary to make efforts to provide students with skills. One of the efforts made is to provide orchid cultivation training to students. The location of Islamic boarding schools close to the city center provides opportunities for students to develop ornamental orchid cultivation. The high interest of city residents in ornamental plants is the main reason for choosing orchids as the focus of development. Orchids are considered to have high aesthetic value and stable sales value, making them the right choice to develop. This service aims to provide motivation, knowledge and skills to students regarding orchid cultivation, with the hope of creating student independence. The method applied involves providing materials related to repotting, plant maintenance including fertilizing, watering, and inducing orchid flowering. Discussion sessions, making demonstration plots, and assistance with orchid cultivation practices are also an integral part of the implementation method. The results of this service show an increase in the students' competence in orchid maintenance and they are able to form an orchid agribusiness forum which is managed independently by the students. Thus, this service not only provides benefits in terms of improving practical skills, but also opens up new economic opportunities for students at the Nurul Qur'an Islamic Boarding School.

Breeding of ornamental orchids with focus on Phalaenopsis: current approaches, tools, and challenges for this century.

Ornamental orchid breeding programs have been conducted to develop commercially valuable cultivars with improved characteristics of commercial interest, such as size, flower color, pattern, shape, and resistance to pathogens. Conventional breeding, including sexual hybridization followed by selection of desirable characteristics in plants, has so far been the main method for ornamental breeding, but other techniques, including mutation induction by polyploidization and gamma irradiation, and biotechnological techniques, such as genetic transformation, have also been studied and used in ornamental breeding programs. Orchids are one of the most commercially important families in floriculture industry, having very particular reproductive biology characteristics and being a well-studied group of ornamentals in terms of genetic improvement. The present review focuses on the conventional and biotechnological techniques and approaches specially employed in breeding Phalaenopsis orchids, the genus with highest worldwide importance as an ornamental orchid, highlighting the main limitations and strengths of the approaches. Furthermore, new opportunities and future prospects for ornamental breeding in the CRISPR/Cas9 genome editing era are also discussed. We conclude that conventional hybridization remains the most used method to obtain new cultivars in orchids. However, the emergence of the first biotechnology-derived cultivars, as well as the new biotechnological tools available, such as CRISPR-Cas9, rekindled the full potential of biotechnology approaches and their importance for improve ornamental orchid breeding programs.

Molecular, morphological, and biomolecular characterization of ethyl methanesulfonate-induced mutations in Aerides odoratum, an orchid

Aerides odoratum L. is a medicinal and ornamental orchid of the Eastern Himalayas, India. Its uses in pharmacology are nought because of its rare occurrence, longer life cycle, and lack of artificial methods for large-scale propagation. Protocorms (60 days old) were treated with various concentrations of ethyl methanesulfonate ranging from 0.025% to 0.5% for different durations (2, 5, 7, and 10 days) during M0 (treatment) in vitro generation. The survival of these protocorms and the generation of shoots and roots were noted. 10–20 plantlets of each treatment showing variation in the number and weight of shoots in M0 generation (treatment generation) were maintained for three subsequent generations. M3 (third generation) axenic plantlets were hardened in the orchidarium with a 75% survival frequency. Four mutant lines (M3V1–M3V4) were established based on RAPD analysis of the leaf DNA of 300-day-old plants. M3V-1 was noted as the best among all mutant lines based on morphological analysis, whereas M3V-2 was noted as the most superior in terms of having the highest quantity of osmolytes, pigments, stomata, and phenol. M3V-3 had maximum root length, leaf breadth, and carotenoids. M3V-4 showed the viridis chlorophyll spectrum as the most distinguishing factor. Hence, this standardized protocol can be used for the genetic improvement of A. odoratum.

Comparative Analysis of Luisia (Aeridinae, Orchidaceae) Plastomes Shed Light on Plastomes Evolution and Barcodes Investigation.

Luisia, a genus of the subtribe Aeridinae of Orchidaceae, comprises ca. 40 species. Members of Luisia exhibit unique morphological characteristics and represent a valuable ornamental orchid genus. However, due to the scarcity of distinct morphological characters, species identification within this genus is ambiguous and controversial. In the present study, next-generation sequencing (NGS) methods were used to assemble the plastomes of five Luisia species and compare them with one publicly available Luisia plastid genome data. The plastomes of Luisia possessed a quadripartite structure, with sizes ranging from 146,243 bp to 147,430 bp. The plastomes of six Luisia species contained a total of 120 genes, comprising 74 protein-coding genes, 38 tRNA genes and eight rRNA genes. Notably, all ndh genes were pseudogenized or lost. An analysis of codon usage bias showed that leucine (Leu) exhibited the highest frequency, while cysteine (Cys) exhibited the lowest frequency. A total of 57 to 64 SSRs and 42 to 49 long repeats were identified. Five regions and five coding sequences were identified for DNA barcodes, based on the nucleotide diversity (Pi) analysis. The species of Luisia constituted a monophyletic group and were sister to Paraphalaenopsis with strong support. Our study deepens the understanding of species identification, plastome evolution and the phylogenetic positions of Luisia.

Characteristics and Comparative Analysis of Seven Complete Plastomes of Trichoglottis s.l. (Aeridinae, Orchidaceae).

Trichoglottis exhibits a range of rich variations in colors and shapes of flower and is a valuable ornamental orchid genus. The genus Trichoglottis has been expanded by the inclusion of Staurochilus, but this Trichoglottis sensu lato (s.l.) was recovered as a non-monophyletic genus based on molecular sequences from one or a few DNA regions. Here, we present phylogenomic data sets, incorporating complete plastome sequences from seven species (including five species sequenced in this study) of Trichoglottis s.l. (including two species formerly treated as Staurochilus), to compare plastome structure and to reconstruct the phylogenetic relationships of this genus. The seven plastomes possessed the typical quadripartite structure of angiosperms and ranged from 149,402 bp to 149,841 bp with a GC content of 36.6-36.7%. These plastomes contain 120 genes, which comprise 74 protein-coding genes, 38 tRNA genes, and 8 rRNA genes, all ndh genes were pseudogenized or lost. A total of 98 (T. philippinensis) to 134 (T. ionosma) SSRs and 33 (T. subviolacea) to 46 (T. ionosma) long repeats were detected. The consistent and robust phylogenetic relationships of Trichoglottis were established using a total of 25 plastid genomes from the Aeridinae subtribe. The genus Trichoglottis s.l. was strongly supported as a monophyletic group, and two species formerly treated as Staurochilus were revealed as successively basal lineages. In addition, five mutational hotspots (trnNGUU-rpl32, trnLUAA, trnSGCU-trnGUCC, rbcL-accD, and trnTGGU-psbD) were identified based on the ranking of PI values. Our research indicates that plastome data is a valuable source for molecular identification and evolutionary studies of Trichoglottis and its related genera.

Invitro and Mass Multiplication of Cymbidium mastersii an Ornamental Orchid through Protocorm-like Body Formation

The epiphytic orchid species known as Cymbidium mastersii can only be found in the region of India known as Northeast India. The preservation of wild populations faces a significant obstacle in the form of a significant threat when it comes to the necessity of obtaining an additional source of the material required to fulfil commercial demands. The objective of this research was to build an in vitro system for the bulk multiplication of C. mastersii, and it was successful in that endeavour. This required the capacity to control the growth of the seedlings through the development of the primary protocorm and germination from a limited number of fruit capsules. Also necessary was the ability to limit the amount of fruit capsules that could be used. Each protocorm resulted in the production of a number of robust plantlings that, once they had been separated from their mother plant, flourished in the conditions of the greenhouse. The child plants, in terms of both their size and the development they underwent, were genetically identical to their parent plant. The streamlined process will make it possible to cultivate Cymbidium mastersii for use in the commercial sector, which will reduce the negative influence on remaining viable wild populations. We offer here for the very first time a method of producing C. mastersii on a commercial scale that makes use of bioreactor technology.

Inventarisasi Dan Analisis Jenis Anggrek (Orchidaceae) Di Kampung Nambo, Desa Batukarut, Kecamatan Arjasari, Kabupaten Bandung

Orchid is a plant from the Orchidaceae family which is known for the beauty and beauty of its flowers. In Indonesia, there are various species of orchids spread across large islands such as Java and Sumatra. Therefore, orchids have a lot of richness with morphological differences in them. Because of its beauty, orchids are often used as ornamental plants to beautify the yard. Observations were made in the yard of the house in the Nambo Village area, Batukarut Village, Arjasari District, Bandung Regency to classify ornamental orchid plants and differentiate them based on their morphological characteristics. The results obtained were found to be 5 species of orchids from different genera where there were morphological differences between one another. The species is Vanda sp. (Vanda Orchid), Cymbidium Golden Boy. (Boat Orchid), Phalaenopsis amabilis (Moon Orchid), Dendrobium caesar and Arachnis flos-aeris (Scorpion Orchid).

Profit Optimization of Ngawen Orchid MSME

The Ngawen Orchid MSME (Micro, Small, and Medium Enterprise) in Ngawen Hamlet, Ngawen Village, Muntilan District, Magelang Regency is a promising business opportunity. Apart from being in great demand, ornamental orchid plants also have a very high selling value. Orchid ornamental plants that are cultivated consist of three types: Dendrobium, Cattleya, and Phalaenopsis. This study aims to optimize profits by considering the number of plants and fertilizers used. This optimal profit can be achieved by applying the science of linear programming, one of which is the simplex method. The data collection techniques used in this study were interviews and direct observation of the Ngawen Orchid MSME. Based on the results of a linear programming analysis of the number of ornamental plants of Ngawen Orchid cultivation, optimal benefits were obtained from planting 40 Cattleya and 40 Phalaenopsis types orchids and there was no need to plant Dendrobium types, to get an optimal profit of IDR 4,600,000.

First report of Odontoglossum ringspot virus in Vanilla (Orchidaceae) in Madagascar.

Vanilla (Vanilla planifolia, Orchidaceae) is Madagascar's leading agricultural export resource which provides 80% of world's consumption. During a phytosanitary survey conducted from November 2019 to March 2021 in the main vanilla production regions of Madagascar, 250 plots were indexed for cymbidium mosaic virus (CymMV, Potexvirus genus) and odontoglossum ringspot virus (ORSV, Tobamovirus genus) the two most prevalent viruses of cultivated orchids worldwide (Zettler et al., 1990). For each plot, bulk samples (ten leaves taken at random) were assayed using Immunostrips (AGDIA, ISK 13301). A quarter of the plots (63/250) tested positive for CymMV. The highest prevalence of CymMV was observed in the SAVA region (57 out of 153 plots = 37,2%) where the virus has been reported since 1997 (Grisoni et al., 2010). Six plots located in the district of Mahanoro (Atsinanana) tested positive for ORSV. A few plants in these plots showed chlorotic often annular spots on their leaves. They were individually tested positive for ORSV, and negative for CymMV and potyviruses (Immunostrips AGDIA ISK 27200), the other two viruses reported so far in vanilla in Madagascar. To confirm the diagnosis of ORSV, leaf samples from five of the six infected plots were analysed by Tube Capture-RT-PCR (Grisoni et al., 2017) using two pairs of primers flanking the ORSV coat protein (CP) gene: OrCP1 (GGTCGGTAATGGTGTTAG) / OrCP2 (TGCATTATCGTATGCTCC), and CPOR-F(ATGTCTTACACTATTACAGACC) / CPOR-R(TTAGGAAGAGGTCCAAGTAAG). The five samples gave amplicons of the expected size (820 nt and 476 nt, respectively) and were sequenced with Sanger technology (Macrogen, The Netherlands). The ORSV-CP sequences of the Mahanoro isolates showed very close similarity to 198 ORSV-CP sequences from GenBank (95.8% to 99.6% nucleotide and 94.5 to 100% amino-acid identities), and less than 75.4% nucleotide (80.1% amino-acid) identities with Bell pepper mosaic virus (DQ355023), the tobamovirus closest to ORSV. The five ORSV-CP sequences from vanilla were deposited in GenBank under accessions numbers OM847399 to OM847403. These data confirmed that ORSV infects vanilla vines in Madagascar. To our knowledge, this is the first report of this virus in Madagascar and of its ability to infect symptomatically V. planifolia. The five ORSV isolates from vanilla had more than 98.7 % nucleotide identities of CP gene and clustered into a monophyletic group in maximum likelihood phylogenetic tree, suggesting a single origin of these isolates. To further investigate the origin of ORSV in Madagascar, we made use of RNA sequences isolated at different points in time to infer the timing of evolutionary events (Rieux et al., 2016). We estimated the CP gene substitution rate to 4.8E-4 subst/site/year [95%HPD 2.1E-4 - 8.7E-4] which is close to the estimate of He et al. (2019) based on a slightly different sequences set (1.25E-3 subst/site/year). We dated the initial contamination of vanilla plts by ORSV between 2004 and 2013. Both ORSV and CymMV have deleterious effects on many ornamental orchids, and the pathogenicity of CymMV is exacerbated when co-infecting with ORSV (Lee et al., 2021). Therefore, ORSV represents a new threat to the Malagasy vanilla crop, especially in regions where CymMV is already rife. Given the economic importance of vanilla cultivation in the country, the implementation of prophylactic measures aimed at preventing the spread of ORSV, in particular through the sanitary control of cuttings, should be a priority for the vanilla industry.

The first report of Phytophthora multivesiculata causing black rot of Cymbidium and Ansellia africana from South Africa.

Globally, various species and hybrids of Cymbidium are of horticultural importance. In January 2022, we visited a private orchidarium near Pretoria (25° 54' 30" S, 28° 24' 34" E). During this visit, the owner reported mortality among various pure and hybrid Cymbidium and Ansellia africana, an indigenous South African ornamental orchid. Phytophthora was identified as a possible causative agent based on an initial examination of the affected orchids. The infected orchids exhibited vascular wilting. Brown, water-soaked lesions covered the roots. The pseudobulbs showed black rot symptoms. Necrotic lesions were also visible towards the basal part of the leaves. For isolation of the causal agent, pieces of infected tissues from roots, pseudobulbs and leaves were surface sterilised using 70% ethanol and plated into Phytophthora selective medium, NARPH. All the plates were incubated at 21°C in darkness. After three days, Phytophthora-like mycelia emerged from all three tissue types. These colonies were transferred onto the PDA medium. For molecular identification, genomic DNA was extracted from four representative isolates (CMW58027-30) using a Zymo Research Fungal/Bacterial DNA MiniPrep kit. The complete ITS, and partial beta-tubulin (BT) and cytochrome oxidase 1 (COX1) gene regions were amplified using the primers DC6/ITS4 (Cooke et al. 2000; White et al. 1990), Btub_F1A/Btub_R1 (Blair et al. 2008; Kroon et al. 2004) and FM84/FM83 (Martin and Tooley 2003), respectively. BLAST searches in NCBI showed that the four isolates were from Phytophthora ITS Clades 2. ITS, BT, and COX1 datasets from Bose et al. (2021) were used for the phylogenetic identification of our isolates. Single gene and concatenated datasets were analysed using both maximum likelihood and Bayesian approaches, which confirmed the identity of the isolates as Phytophthora multivesiculata. All the sequences were submitted to the GenBank: ITS (OM967212-15), BT (OM966588-91), and COX1 (OM966592-95). Measurements of sporangia and gametangia overlapped with those from Ilieva et al. (1998): sporangia (28.3 - 56.3) 41.6 x 31.3 (21.5 -3 9.6) µm; L:B 1.42 (1.08 - 1.69); exit pore 11.2 (7.1 - 14.6) µm; oogonia 44.2 (24.5 - 56.3) µm; oospore 34.2 (21.6 - 53.2) µm; antheridia (5.8 - 14.6) 11.8 x 15.3 (6.2-14.9) µm. The pathogenicity trial was conducted following the protocol suggested by Ilieva et al. (1998). Five A. africana roots and the cut ends of seven Cymbidium leaves were immersed in separate beakers containing 100 ml of sterile distilled water and ten 5 mm agar discs excised from a 7-day-old culture of P. multivesiculata (CMW58027) grown on PDA. Sterile distilled water was used as the control, with an equal number of plants and leaves. All of the sets were incubated at 21°C. After seven days, the plants and leaves developed lesions similar to those observed on the symptomatic plants at the orchidarium. Trials were repeated once and the pathogen was reisolated from both trials and the identity was confirmed by amplifying the complete ITS gene region. Phytophthora multivesiculata has been previously reported from the Netherlands (Ilieva et al. 1998), Taiwan (Chern et al. 2011), Australia (Cunnington et al. 2009), New Zealand (Hill 2004) and elsewhere causing black rot of Cymbidium. However, this is the first report of P. multivesiculata causing black rot of Cymbidium and A. africana from Africa. We are now conducting follow-up surveys to determine the distribution range of this pathogen in South Africa.

Precocious in vitro flowering in threatened ornamental orchid, Dendrobium ovatum – Decoding the causal factors

Dendrobium has been the focus of floral industries for decades. Wild Dendrobiums serve as germplasm for creating hybrids in the cut flower industry and are priced high. But, fewer reports exist on the wild tropical species of Dendrobium. The present study reports in vitro flowering in Dendrobium ovatum - an epiphytic orchid species endemic to the oriental tropics. The seedlings are raised from the protocorms and protocorm-like bodies. This research also highlights the traits displayed by the in vitro flowers of D. ovatum. An optimized modified MS medium was developed to enhance the flowering in the orchid species. The pre-treatment methods, notably dark incubation for 12 h and prechilling at 15 °C for 2 h, demonstrated the synthesis of pharmacologically relevant bioactives viz., ‘Moscatilin’ and ‘Resveratrol’. The tissue culture system devised can decode the enigmatic reproductive biology and its underlying molecular regulation of D. ovatum. This strategy could be emulated in other horticultural, medicinal and food crops for producing industrially relevant phytochemicals.

Orchids Cytogenetics and Karyotype of Phaius callosus and Phaius montanus

The Phaius callosus and Phaius montanus orchids are ornamental orchids with high ornamental value and are classified as endangered plants. Genetic information from Phaius callosus and Phaius montanus orchids will facilitate plant breeding as it is essential to improve ornamental plant properties. Chromosome analysis aims to determine chromosomes' shape, number, and size. The research was conducted at the Cytology Laboratory of the LIPI Biology Research Center, Bogor, West Java. Analysis of research results based on observations of shooting results and data on the size and shape of chromosomes was carried out descriptively. The chromosome number of Phaius callosus and Phaius montanus had a similarity of 2n = 46, metacentric in shape. The chromosome size of Phaius callosus was 1.30 ± 0.29, while that of Phaius montanus was 2.32 ± 1.01. The karyotype formula of Phaius callosus and Phaius montanus had a similarity of 2n=46=23m which was dominantly metacentric.

Orchid mycorrhizal fungi and ascomycetous fungi in epiphytic Vanda falcata roots occupy different niches during growth and development.

Epiphytic orchids are commonly found in exposed environments, which plausibly lead to different root fungal community structures from terrestrial orchids. Until recently, few studies have been conducted to show the fungal community structure during the growth of a photosynthetic and epiphytic orchid in its natural growing site. In this study, the Vanda falcata (commonly known as Neofinetia falcata), one of Japan's ornamental orchids, was used to characterize the fungal community structure at different developmental stages. Amplicon sequencing analysis showed that all development stages contain a similar fungal community: Ascomycota dominate half of the community while one-third of the community belongs to Basidiomycota. Rhizoctonia-like fungi, a polyphyletic basidiomycetous fungal group forming mycorrhizas in many orchids, exist even in a smaller portion (around one-quarter) compared to other Basidiomycota members. While ascomycetous fungi exhibit pathogenicity, two Ceratobasidium strains isolated from young and adult plants could initiate seed germination in vitro. It was also found that the colonization of mycorrhizal fungi was concentrated in a part of the root where it directly attaches to the phorophyte bark, while ascomycetous fungi were distributed in the velamen but never colonized cortical cells. Additionally, the root parts attached to the bark have denser exodermal passage cells, and these cells were only colonized by mycorrhizal fungi that further penetrated into the cortical area. Therefore, we confirmed a process that physical regulation of fungal entry to partition the ascomycetes and mycorrhizal fungi results in the balanced mycorrhizal symbiosis in this orchid.

One-step in vitro protocol for clonal propagation of Dendrobium Yuki White, a high value ornamental orchid hybrid

A novel and accelerated one-step protocol for complete in vitro mass propagation of Dendrobium Yuki White was optimized for the first time. Rapid shoot-root initiation and multiplication was simultaneously achieved from apical shoot segment explants on Murashige and Skoog basal medium fortified with 0.5 mg L−1 N6-benzyladenine (BA), 0.1 mg L−1 α-naphthaleneacetic acid, along with 40 mg L−1 adenine sulphate as an additive. Maximum number of shoots per explant (12) was obtained within eight weeks of culture. Maximum number of root induction (17) and elongation (6.5 cm) were recorded within this period. On the other hand, the matrix plot, network plot, and principal component analyses illustrated the association of auxin-cytokinin and the multiple growth attributes under study. In a simple acclimatization procedure, involving primary acclimatization in charcoal blocks for six weeks, and followed by a combination of coconut fibre and charcoal (1:1; v v−1) with intermittent water spraying ensured 97% survival rate in the next ten weeks. Based on the comprehensive information developed in this study, this protocol should be of immense importance for large-scale production of planting materials as well as for exploring the possible comparative roles of the auxin-cytokinin combinations used in this study.

Extensive Phytochemical Assessment of Dendrobium fimbriatum Hook (Orchidaceae)

Dendrobium fimbriatum Hook is an important medicinal and ornamental orchid that may lead to important drugs and cosmetics. In this study, 2 analytical strategies were combined to describe the detailed composition of a hydroethanolic extract of the whole plant. The CARAMEL approach, based on centrifugal partition chromatography and nuclear magnetic resonance data interpretation, allowed the rapid dereplication of 21 major constituents, mainly including polyols, nucleosides, zwitterionic compounds, phenolic compounds, and organic acids. Further semipreparative high-performance liquid chromatography and spectroscopic analyses led to the isolation of 6 additional compounds; 4 phenanthrenes (plicatol B, hircinol, plicatol A, and plicatol C), 1 bibenzyl (3′,4-dihydroxy-3,5′-dimethoxybibenzyl), and 1 furostanol saponin (protodioscin), as well as a new phenanthrene derivative, plicatol D. A total of 28 metabolites were structurally elucidated, among which 23 are described for this species for the first time.

Floral organ-specific proteome profiling of the floral ornamental orchid (Cymbidium goeringii) reveals candidate proteins related to floral organ development

BackgroundCymbidium goeringii, belonging to the Orchidaceae family, is an important ornamental plant with striking petals and lips. Extremely diversified floral patterns and morphologies make C. goeringii good research material to examine floral development of orchids. However, no floral organ-specific protein has been identified yet. To screen floral development associated proteins, four proteomes from petal (PE), lip (LI), gynostemium (GY), and sepal (SE) were analyzed using Tandem Mass Tag-based proteomic analysis.ResultsA total of 6626 unique peptides encoding 2331 proteins were identified in our study. Proteins in several primary metabolic pathways, including amino acid metabolism, energy metabolism, and lipid metabolism, were identified as differentially expressed proteins. Interestingly, most of the energy metabolism-related proteins highly expressed in SE, indicating that SE is an important photosynthetic organ of C. goeringii flower. Furthermore, a number of phytohormone-related proteins and transcription factors (TFs) were identified in C. goeringii flowers. Expression analysis showed that 1-aminocyclopropane-1-carboxylate oxidase highly expressed in GY, IAA-amino acid hydrolase ILR1-like 4 and gibberellin receptor 1 C greatly expressed in LI, and auxin-binding protein ABP20 significantly expressed in SE, suggesting a significant role of hormones in the regulation of flower morphogenesis and development. For TFs, GY-highly expressed bHLH13, PE-highly expressed WRKY33, and GY-highly expressed VIP1, were identified.ConclusionsMining of floral organ differential expressed enzymes and TFs helps us to excavate candidate proteins related to floral organ development and to accelerate the breeding of Cymbidium plants.