Infectious Origin Research Articles

Forms of infectious complications after use of metal foreign bodies of the auricle and determination of the ability of detected microorganisms to biofilm formation

Ear or nose are quite vulnerable to foreign bodies. Foreign bodies cause various side effects in the body. A special category consists of foreign bodies that are introduced for aesthetic purposes, in particular piercing products. Decoration implanted in the tissues of the ear or nose is a foreign body and is a field of increased contamination and reproduction of pathogenic and opportunistic microorganisms. The aim of the study was to determine the infectious forms of complications that occurred after prolonged use of metal foreign bodies and to study the ability of biofilms by microorganisms isolated from the pathological contents of the foreign body of the auricle. 93 patients who applied to the ENT department of Kharkiv Regional Hospital for complications after implantation of metal foreign bodies and 10 people, control group, which had no foreign bodies, and were randomly selected from healthy individuals, were examined, to determine the qualitative composition of the microbiocenosis of the auricle skin. The material for the study was pathological discharge from a foreign body of the auricle. The microbiological study was performed using MICRO-LA-TEST identification kits. Studies of the formation of biofilms were studied by determining the ability of bacterial strains to adhere to the surface of polystyrene. The obtained cultures were washed with suspension media individual for each family of bacteria. The optical density of bacterial suspensions was measured using a microplate reader "MultiskanEX" (type 355). Statistical analysis of the obtained data was performed using MSExcel, Statisica 10 software. As a result of the conducted researches the dependence between the development of infectious complications of the auricle in the presence of metal foreign bodies and the microbiocenosis of the pathological focus was revealed. The study allowed to establish the structure of the microbial landscape of the skin of the auricle in the area of the metal foreign body, to determine the dominant forms of complications of infectious origin, after prolonged use of metal foreign bodies and to study the ability to form biofilms by microorganisms from different metals. The ability of various types of microorganisms to form biofilms when using products from different types of metals has been studied. It is established that the use of metal foreign bodies made of silver and gold reduces the risk of purulent-inflammatory process. It is proved that the optical density of biofilms of most microorganisms isolated from the pathological contents of the area of foreign bodies made of silver and gold is significantly lower than when using steel and titanium products.

An automated retrospective VAE-surveillance tool for future quality improvement studies

Ventilator-associated pneumonia (VAP) is a frequent complication of mechanical ventilation and is associated with substantial morbidity and mortality. Accurate diagnosis of VAP relies in part on subjective diagnostic criteria. Surveillance according to ventilator-associated event (VAE) criteria may allow quick and objective benchmarking. Our objective was to create an automated surveillance tool for VAE tiers I and II on a large data collection, evaluate its diagnostic accuracy and retrospectively determine the yearly baseline VAE incidence. We included all consecutive intensive care unit admissions of patients with mechanical ventilation at Bern University Hospital, a tertiary referral center, from January 2008 to July 2016. Data was automatically extracted from the patient data management system and automatically processed. We created and implemented an application able to automatically analyze respiratory and relevant medication data according to the Centers for Disease Control protocol for VAE-surveillance. In a subset of patients, we compared the accuracy of automated VAE surveillance according to CDC criteria to a gold standard (a composite of automated and manual evaluation with mediation for discrepancies) and evaluated the evolution of the baseline incidence. The study included 22′442 ventilated admissions with a total of 37′221 ventilator days. 592 ventilator-associated events (tier I) occurred; of these 194 (34%) were of potentially infectious origin (tier II). In our validation sample, automated surveillance had a sensitivity of 98% and specificity of 100% in detecting VAE compared to the gold standard. The yearly VAE incidence rate ranged from 10.1–22.1 per 1000 device days and trend showed a decrease in the yearly incidence rate ratio of 0.96 (95% CI, 0.93–1.00, p = 0.03). This study demonstrated that automated VAE detection is feasible, accurate and reliable and may be applied on a large, retrospective sample and provided insight into long-term institutional VAE incidences. The surveillance tool can be extended to other centres and provides VAE incidences for performing quality control and intervention studies.

P059 Etiological profile of childhood uveitis in a Tunisian population: a 12-year retrospective study

Abstract Background Uveitis in children represents 10% of all cases of uveitis. It is a serious condition with an often-insidious onset and evolution, and has a negative impact on visual prognosis with a risk of amblyopia or even blindness. The etiologies are varied. the aim of this study is to describe the epidemiological, clinical, and etiological characteristics of childhood uveitis during a period of 12 years. Methods A descriptive retrospective study including 138 children (276 eyes) with uveitis, was conducted at the Ophthalmology Department of Fattouma Bourguiba University Hospital in Monastir Tunisia between 1 January 2006 and 31 December 2017. Results The patients average age was 10.2 ± 3,58. A female predominance was noted (sex ratio: 0.91). Uveitis was bilateral in 2/3 of cases and unilateral in 1/3 of cases. Vision loss was the most common reason for consultation (52.2%). The mean initial visual acuity was 3,3/10 ± 3,24. Intermediate uveitis was the most common anatomical form (42,02%), followed by anterior uveitis (28,26%), panuveitis (26,08%), and posterior uveitis (3,6%). The infectious origin was the most common aetiology, followed by uveitis related to general condition (13,72%), and uveitis in context of a specific ocular condition (12,3%). Uveitis was idiopathic in 79 patients (57.24%). Periocular injection of triamcinolone acetonide was performed in (29 patients, 21%). The use of immunosuppressives agents was noted in 38 patients (27,5%) (methotrexate: 23 patients, azathioprine: 16 patients, and ciclosporin: 10 patients). The use of intravitreous injections of bevacizumab was noted in 6 patients (4.33%). Anti TNF alpha treatment was used for 2 patients. Post-uveitic complications were noted in 84.3% of cases. They were dominated by cataract (31,88%) at the anterior segment level. Cystoid macular oedema (31,88%) and retinal serous detachment (15,9%) were the major complications in the posterior segment. Mean final visual acuity was 5.98/10 ± 3,54. It was <1/10 in 14 eyes. Conclusion In our study a female predominance was noted. Intermediate uveitis was the most common anatomical form. The infectious origin was preponderant. Post-uveitic complications was dominated at the anterior segment level by cataract and cystoid macular oedema at the posterior segment.

New Records of Nematodes in the Yellow-Billed Cuckoo Coccyzus americanus (Cuculiformes: Cuculidae) Based on a Migrant Specimen Found in Brazil

The yellow-billed cuckoo, Coccyzus americanus, is a threatened passerine bird native to North America that migrates to overwinter in South America. Although migratory birds have drawn broad attention, given their assumed role in the long-distance dispersal of parasites, studies on the helminth fauna of this cuculid are scarce. In the present study, nematodes found in the gastrointestinal tract of a specimen of C. americanus found in Belo Horizonte, State of Minas Gerais, southeastern Brazil, were characterized morphologically. Five species of gastrointestinal nematodes belonging to 4 families were identified: Synhimantus (Dispharynx) nasuta (Rudolphi, 1819) and Synhimantus (Dispharynx) resticulaCanavan, 1929 (Acuariidae), Microtetrameres sp. (Tetrameridae), and Cyrnea piayaeSandground, 1929 (Habronematidae) and Subulura halli Barreto, 1918 (Subuluridae). Except for Microtetrameres sp., all other nematodes are reported in this host for the first time. Although it is difficult to accurately determine the geographical origin of infections, it is important to note that Sy. (D.) resticula and Su. halli are reported for the first time in Brazil. Additionally, the absence of the former species infecting hosts where the widespread and generalist Sy. (D.) nasuta was found may indicate that Sy. (D.) resticula have either been overlooked in previous studies or that this nematode is rare indeed. Finally, the geographical distribution of Su. halli is greatly expanded and now includes the Americas. Aspects related to the dispersion of these parasites, both in migrating and native hosts, are briefly discussed.

A Phase II Study of the Efficacy and Tolerance of Azacytidine (AZA) in Steroid Dependent/Refractory Systemic Autoimmune and Inflammatory Disorders (SAID) Associated with MDS or CMML (GFM- AZA-SAID -trial)

Background: Systemic autoimmune and inflammatory diseases (SAIDs) occur in 10-15% of MDS or CMML patients. They are often severe, difficult to treat and steroid resistant/dependent disorders. In a retrospective report of 22 patients with steroid-dependent MDS/CMML associated SAID, we observed promising results with azacytidine (AZA) on the SAID component (Fraison et al, Leuk Res, 2016). In this prospective French nationwide trial, we aimed at confirming this effect prospectively.Patients and Methods: This open-label, single-arm multicenter, phase II study included MDS/CMML patients with IPSS/CPSS int 2 or high, or lower IPSS/CPSS but with significant cytopenias, especially ESA resistant anemia (or, for CMML, proliferative features) and SAID with steroid dependence and/or resistance. The primary endpoint was response rate (RR, including CR and PR) of SAID after 6 cycles of AZA. Secondary endpoints included RRof SAID after 3 cycles of AZA, response of MDS, time to MDS progression (including to AML), overall survival (OS) and safety. AZA was used at 75 mg/m²/d x 7 days, every 4 weeks for a minimum of 6 cycles (unless overt disease progression occurred before). At the onset of AZA, prednisone (PRED) was administered at 1 mg/kg during 1 month and then decreased progressively over 6 months.Results: 30 patients were included between July 2017 and June 2020, 29 of whom received AZA and were considered evaluable: median age 72 [range 68-78], 69% males; WHO: MDS ML (n=11; 41%), CMML (n=11, 41%), MDS-RS (n=2, 7%), EB-1 (n=1) and EB-2 (n=1), unclassified (n=3); IPSS-R : good (n=15, 54%), very good (n=3; 11%, each), intermediate (n=7; 25%) and very poor profile (n=3; 11%) (all CMML had WBC <13G/l and could be classified by IPSS-R). SAIDs features included non-infectious fever (n=5; 17%), skin lesions (n=14; 48%), joint involvement (n=18; 68%), chondritis (n=6; 21%) and peripheral nervous system impairment (n=3; 10%). 11 (38%) /28 tested patients had UBA1 mutation (VEXAS syndrome), while inin the remaining cases SAID was vasculitis (n=5), rheumatic disease (n=6), neutrophilic dermatosis (n=2) and others (n=5).19 patients (65.5%, IC95% [45.7.82.1]) obtained a SAID response after 6 cycles (including 8 CR and 11 PR), while 17 (58.6% (IC95% [38.9; 76.5]) patients achieved an IWG 2006 hematological response (7 CR, 9 SD with HI and 1 marrow CR). All the 13 patients who received 12 cycles of AZA achieved SAID CR or PR at 12 months, and 10 of them had a hematological response (6 CR, 1PR, 2 HI, 1 marrow CR). The SAID response rate at 12 month was at 72.4% (IC95% : [51.3;85.6]). SAIDs complete/partial response occurred in 3/9 (33%) UBAI-positive versus 8/19 (42%) non-mutated cases. No significant prognostic factor of SAID response after 6 cycles, including sex, age, WHO classification, IPSS-R, UBA1 and TET-2 mutation status was found. With a median follow-up of 18.5 months [11.8; 24.3], 9 (31%) patients had died, with a 1-year OS of 82.3% (IC95% [69.4; 97.7]. At least one SAE occurred in 23 patients, with a median of 2 events/patient [1.5; 5.5]. Death was due to infection (n=5, two of them in patients with good IPSS-R, but severe steroid dependent SAID), MDS progression (n=2), or unrelated causes (n=2).Conclusion We confirmed prospectively an effect of AZA on the autoimmune/inflammatory component in two thirds of MDS/CMML patients with steroid dependent / refractory concomitant systemic autoimmune/inflammatory disease. No significant difference in AZA response was noted between UBA1 mutated and unmutated MDS patients. The adverse events and mortality rates, often from infectious origin, appear to be those expected in such an MDS population, potentially worsened by the associated SAID and background of immunosuppressive treatment (especially steroids) DisclosuresTerriou: Alexion, AstraZeneca Rare Disease: Consultancy, Membership on an entity's Board of Directors or advisory committees. Vey: Amgen: Honoraria; BMS: Honoraria; BIOKINESIS: Consultancy, Research Funding; NOVARTIS: Consultancy, Honoraria, Research Funding; SERVIER: Consultancy; JAZZ PHARMACEUTICALS: Honoraria; JANSSEN: Consultancy. Ades: ABBVIE: Honoraria; TAKEDA: Honoraria; CELGENE/BMS: Honoraria; NOVARTIS: Honoraria; JAZZ: Honoraria, Research Funding; CELGENE: Research Funding. Fenaux: Abbvie: Honoraria, Research Funding; JAZZ: Honoraria, Research Funding; Novartis: Honoraria, Research Funding; Celgene/BMS: Honoraria, Research Funding; Takeda: Honoraria, Research Funding; Janssen: Honoraria, Research Funding; Syros Pharmaceuticals: Honoraria.

Estimate of exposure to SARS-CoV-2 and performance of high-risk interventions by European anaesthesiologists: A Pan-European cross-sectional survey.

Estimate of exposure to SARS-CoV-2 and performance of high-risk interventions by European anaesthesiologists: A Pan-European cross-sectional survey.

Extrachromosomal viral DNA produced by transcriptionally active endogenous viral elements in non-infected banana hybrids impedes quantitative PCR diagnostics of banana streak virus infections in banana hybrids.

The main edible and cultivated banana varieties are intra- and interspecific hybrids of the two main Musa species, Musa acuminata and Musa balbisiana, having diploid genomes denoted A and B, respectively. The B genome naturally hosts sequences of banana streak virus (BSV) named endogenous BSV (eBSV). Upon stress, eBSVs are identified as the origin of BSV infection for at least three BSV species, causing banana streak disease. For each of the three species, BSV and eBSV share >99.9 % sequence identity, complicating PCR-based diagnosis of viral infection in the B genome-containing bananas. Here, we designed a quantitative PCR-based method to only quantify episomal BSV particles produced, overcoming the limitation of eBSV also being detected by qPCR by using it as a 'calibrator'. However, our results revealed unexpected variation of eBSV amplification in calibrator plants composed of a clonal population of 53 replicating virus-free banana hybrids with the same AAB genotype. Our in-depth molecular analyses suggest that this calibrator variation is due to the variable abundance of non-encapsidated extrachromosomal viral DNA, likely produced via the transcription of eBSVs, followed by occasional reverse transcription. We also present evidence that accumulation of viral transcripts in AAB plants is downregulated both at post-transcriptional and transcriptional levels by an RNA interference mechanism that keeps the plants free of virus infection. Finally, we recommend that such eBSV amplification variation be taken into account to establish a quantitative viral diagnostic for banana plants with the B genome.

Transmission patterns of a Mycobacterium avium subsp. paratuberculosis clone within a single heard investigated by Whole Genome Sequencing

Mycobacterium avium subsp. paratuberculosis (MAP) is characterized by a low genomic rate of mutation. Current subtyping tools, such as Mini-Micro-satellite analyses, do to have not sufficient discriminatory power to disclose MAP’s evolution on small spatial and temporal scales. The aim of the study was to investigate the population structure of MAP inside a single dairy herd using whole genome sequencing (WGS) approaches. For this purpose, the genomes of 43 field isolates, recovered from the faeces of 36 cows of the same dairy herd from 2012 to 2016, were sequenced by WGS.The isolates’ genomes showed a low number (43) of polymorphic sites (SNPs), confirming the clonal origin of the herd infection. However, despite the limited genomic diversity found in WGS, the phylogenetic analysis was discriminatory enough to detect the presence of different genomic clades and sub-clades inside the herd population. In addition, the phylodynamic reconstruction showed the existence of an ancestor clade from which the other clades and sub-clades originated. Moreover, by reconstructing the putative within-herd transmission networks using WGS data, we demonstrated that: (i) in a herd where MAP is endemic, multiple isolates recovered from a single animal and differing from each other by few (three/four) SNPs can originate from different transmission or passive shedding events and not from intra-host evolution; and (ii) variability of minisatellites coupled with a few microsatellites does not represent reliable tracers of within-herd infection chains.Our findings show that WGS, coupled with relevant epidemiological information, represents a valuable tool to work out fine epidemiological and micro-evolutionary relationships such as those at herd-level scale.

Acinetobacter baumannii Quorum sensing: A way to communicate and a target to eradicate

Quorum sensing is a communication system based on the actions of chemical signal molecules depending on the density of the cell population. These molecules are widely considered as effectors of the gene expression of several virulence factors. As a result, it has attracted a lot of attention because of its possible applicability as a target for treating infections. This review attempts to give a description of this system on gram negative bacteria specifically on Acinetobacter baumannii as an important nosocomial pathogen. Additionally, quorum sensing in biofilm will be also treated because it is considered as the origin of several chronic infections. Numerous studies have been carried out to prove the role of inhibitors in the disruption of quorum sensing, known as quorum quenching. Quorum quenching is a new strategy to eradicate bacterial infections due to the crucial intervention of quorum sensing in different virulence factors and particularly in the biofilm formation.

Tonsillar origin of deep neck infection as a negative prognostic factor for developing complications.

&lt;b&gt;Aim:&lt;/b&gt; The aim of this study was to compare the odontogenic and tonsillar origins of deep neck infection (DNI) as a negative prognostic factor for developing complications. &lt;/br&gt;&lt;/br&gt; &lt;b&gt;Methods:&lt;/b&gt; This was a retrospective study of 544 patients with tonsillar and odontogenic origins of DNI treated between 2006 and 2015 at 6 ENT Departments and Departments of Oral and Maxillofacial Surgery. Complications from DNI (descending mediastinitis, sepsis, thrombosis of the internal jugular vein, pneumonia, and pleuritis) were evaluated in both groups and compared. Associated comorbidities (cardiovascular involvement, hepatopathy, diabetes mellitus respiratory involvement, gastroduodenal involvement) were reviewed. &lt;/br&gt;&lt;/br&gt; &lt;b&gt;Results:&lt;/b&gt; Five hundred and forty-four patients were analyzed; 350/544 males (64.3%) and 19/544 females (35.7%). There were 505/544 cases (92.8%) with an odontogenic origin and 39/544 cases (7.2%) with a tonsillar origin of DNI. Complications occurred more frequently in the group with tonsillar origin of DNI (P &lt; 0.001). There was no difference in diabetes mellitus between the two groups. &lt;/br&gt;&lt;/br&gt; &lt;b&gt;Conclusions:&lt;/b&gt; Currently, the tonsillar origin of DNI occurs much less frequently; nevertheless, it carries a much higher risk of developing complications than cases with an odontogenic origin. We recommend that these potentially high-risk patients with a tonsillar origin of deep neck infections should be more closely monitored.

Periodontal Inflammation and Systemic Diseases: An Overview.

Periodontitis is a common inflammatory disease of infectious origins that often evolves into a chronic condition. Aside from its importance as a stomatologic ailment, chronic periodontitis has gained relevance since it has been shown that it can develop into a systemic condition characterized by unresolved hyper-inflammation, disruption of the innate and adaptive immune system, dysbiosis of the oral, gut and other location's microbiota and other system-wide alterations that may cause, coexist or aggravate other health issues associated to elevated morbi-mortality. The relationships between the infectious, immune, inflammatory, and systemic features of periodontitis and its many related diseases are far from being fully understood and are indeed still debated. However, to date, a large body of evidence on the different biological, clinical, and policy-enabling sources of information, is available. The aim of the present work is to summarize many of these sources of information and contextualize them under a systemic inflammation framework that may set the basis to an integral vision, useful for basic, clinical, and therapeutic goals.

Epidural fever.

Epidural analgesia (EPA) is the most effective method of intrapartum pain relief and is considered to be very safe. Recently, it has been used in up to 34% of parturients with EPA and is also associated with maternal temperature elevations during labor. The mechanism of this epidural-associated fever remains incompletely understood. The most likely etiology seems to be non-infectious inflammation caused by an epidural catheter. However, some authors deny this association. They theorize it is caused by selection bias only, as EPA is more often required by women with more painful and prolonged or more complicated labor, where temperature elevation is due to other causes. They point out that in some studies, fever was correlated to EPA only with concurrent placental inflammation. Maternal fever, despite the cause, either infectious or non-infectious origin, carries important clinical and public health implications. Further research that evaluates maternal epidural status and its influence on maternal or neonatal fever could improve sepsis evaluation and lead to worldwide decrease of unnecessary antibio-tic exposure.

Surveillance analysis and microbiological profiles of nosocomial infections in a palliative care center

Objective: The growing geriatric population and increasing prevalence rates of chronic diseases increase the need for palliative care globally. Despite the wide availability of palliative care units in several countries, they have been founded in our country recently. This study aimed to contribute to the development of appropriate treatment protocols by determining the causes of hospitalizations, comorbidities, infection rates, and causative microorganisms in a palliative care center.&#x0D; Material and Method: A total of 457 patients admitted to palliative care were evaluated. Blood cultures were taken from the patients suspected to have developed nosocomial infections. Samples for cultures were taken from the foci that were thought to be the origin of infection. Identification of isolates was performed using automated systems and standard manual methods. The numbers of patients and patient days, and the numbers and rates of nosocomial infections were retrieved from the infection control unit data records and were analyzed. The rates and incidences of nosocomial infections in our hospital and the palliative care unit were calculated. &#x0D; Results: Of the patients, 51% were men and 49% were women. The mean age was 72±12.6 years. Nosocomial infection rates were 6.3% in 2019, 9.1% in 2020, and 3.3% in the first six months of 2021. Urinary system infections ranked first with a rate of 58.6%. The most common cause of hospital admissions was malignancy with a rate of 25.9%. The most commonly isolated microorganism was Klebsiella spp with a rate of 27.5%.&#x0D; Conclusion: Palliative care is a multidisciplinary practice requiring strong coordination and collaboration. Palliative care aims to improve symptoms and the quality of life of patients. Our study has contributed to developing practical solutions by documenting prognostic factors, infections, causative microorganisms, and issues experienced in palliative care patients.

Origins of bloodstream infections following fecal microbiota transplantation: a strain-level analysis

AbstractWe observed high rates of bloodstream infections (BSIs) following fecal microbiota transplantation (FMT) for graft-versus-host-disease (33 events in 22 patients). To trace the BSIs' origin, we applied a metagenomic bioinformatic pipeline screening donor and recipient stool samples for bacteremia-causing strains in 13 cases. Offending strains were not detected in FMT donations. Enterococcus faecium, Escherichia coli, Pseudomonas aeruginosa, and Acinetobacter baumannii could be detected in stool samples before emerging in the blood. In this largest report of BSIs post-FMT, we present an approach that may be applicable for evaluating BSI origin following microbiota-based interventions. Our findings support FMT safety in immunocompromised patients but do not rule out FMT as an inducer of bacterial translocation.

Diagnostics with clinical microbiome-based identification of microorganisms in patients with brain abscesses-a prospective cohort study.

Brain abscesses are often polymicrobial and of unclear primary origin. Here, we compare the use of next-generation sequencing (NGS) technology with classical microbiological diagnostics for identification of clinically relevant microorganisms and describe the microbiome profiling with respect to the primary source of brain abscess. Thirty-six samples from 36 patients, with primary brain abscesses, were subjected to both culture- and 16S/18S rRNA Sanger sequencing-based diagnostics ("standard methods") and compared to a 16S/18S amplicon-based NGS, which were also subjected to a microbiome diversity analyses. Forty-seven species were identified with "standard methods" compared to 96 species with NGS, both confirming and adding to the number of species identified (p<0.05). The variation of the brain abscess microbiome diversity was not continuous but could be stratified comparing the presumable origin of infection ("dental," "sinus," "disseminated," or "unknown"). Alpha diversity did not differ (p>0.05) between groups while beta diversity differed significantly (p=0.003) comparing disseminated vs the other presumable origin of infection. Interesting, clustering was also detected between "dental" and "sinusitis," although not significantly (p=0.07). Microbiome-based diagnostics can increase sensitivity without losing specificity. The bacterial beta diversity differed between the presumably origin of the brain abscess and might help to clarify the primary source of infection.

Leprosy in wild chimpanzees

Humans are considered as the main host for Mycobacterium leprae1, the aetiological agent of leprosy, but spillover has occurred to other mammals that are now maintenance hosts, such as nine-banded armadillos and red squirrels2,3. Although naturally acquired leprosy has also been described in captive nonhuman primates4–7, the exact origins of infection remain unclear. Here we describe leprosy-like lesions in two wild populations of western chimpanzees (Pan troglodytes verus) in Cantanhez National Park, Guinea-Bissau and Taï National Park, Côte d’Ivoire, West Africa. Longitudinal monitoring of both populations revealed the progression of disease symptoms compatible with advanced leprosy. Screening of faecal and necropsy samples confirmed the presence of M. leprae as the causative agent at each site and phylogenomic comparisons with other strains from humans and other animals show that the chimpanzee strains belong to different and rare genotypes (4N/O and 2F). These findings suggest that M. leprae may be circulating in more wild animals than suspected, either as a result of exposure to humans or other unknown environmental sources.

Impacto de la pandemia COVID-19 en la formación de los residentes de otorrinolaringología

Background and objectivesTraining in surgical specialties has declined during the COVID-19 pandemic. A study was carried out to further analyze the impact of the COVID-19 pandemic on specific aspects of clinical, training, and research activities performed by the otolaryngology residents in Spain. MethodsA cross-sectional qualitative study was conducted during the last two weeks of February 2021. The study consisted of an online survey taken by otolaryngology residents who had undertaken one-year continuing training from February 15, 2020, to February 15, 2021, and consisted of 26 questions exploring the impact of the COVID-19 on the health of the ENT residents and training activities. Categorical variables were reported as frequency and percentage. When indicated, Pearsońs Chi-square test (χ2) with Yates's correction and Pearson's correlation coefficient (r) were used. Results143 completed surveys were received from 264 residents (54.17%). 36 residents (25.2%) have suffered from the disease due to SARS-CoV-2. Most of them only developed mild symptoms (86.1%), with 3 requiring hospitalization (8.3%). The origin of infection was unknown in all reported cases and the need for confinement was principally due to either attending an asymptomatic patient in 9 cases (6.3%) or to being supposedly in close contact with an asymptomatic person in 22 (15.4%). 60.1% of the residents surveyed reported having lost more than 6months of their training period, and in 18.8% of cases, it was as high as 10 and 12months. There has been a reduction of more than 75% of what was planned in surgical training (P<.05) of tympanoplasty, mastoidectomy, stapedectomy, cochlear implants, endoscopic sinonasal and anterior skull base surgery, septoplasty and turbinoplasty. ConclusionsThe decline in ENT activity and residents having to assist in other COVID-19 units during the most critical moments of the pandemic, has caused the main reduction in their training capacity. Contagion mainly occurred through contact with asymptomatic carriers during patient care and through supposedly close contact with asymptomatic carriers. Virtual activities have been widely accepted, but they have not completely replaced all residents’ training needs. Measures should be implemented to recover lost training, especially surgical practical learning in otology and rhinology.

First report of grapevine rupestris vein feathering virus in wine grapes in Idaho.

Grapevine rupestris vein feathering virus (GRVFV) was found associated with chlorotic discolorations of leaf veins in a Greek grapevine cultivar (El Beaino et al. 2001; Abou Ghanem-Sabanadzovic et al. 2003) or with Syrah decline (Al Rwahnih et al. 2009). In the United States, GRVFV was reported to occur in California (Al Rwahnih et al. 2009) and in Washington State (Chingandu et al. 2021). Wine grape production in Idaho is known to be affected by several viruses, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (GFkV; Kanuya et al. 2012), and grapevine red blotch virus (GRBV; Thompson et al. 2019b), but the GRVFV status was not addressed previously. In 2018, leaf and petiole samples from five declining Chardonnay vines were collected from a single vineyard in Canyon County of Idaho. Ribodepleted total RNA prepared from these samples was subjected to a high-throughput sequencing (HTS) analysis on a MiSeq platform as described previously (Thompson et al. 2019a), yielding between 3,623,716 and 4,467,149 300-bp paired-end reads. Briefly, raw reads were adapter and quality cleaned, mapped against the Vitis vinifera L., reference genome. Unmapped paired reads were assembled, producing between 829 and 1,996 contigs over 1,000-nt in length. All five samples were found to contain GLRaV-3 and the two common viroids, hop stunt viroid and grapevine yellow speckle viroid, while four contigs ranging in size from 1,361 to 6,736 and exhibiting homology with the GRVFV were found in three out of the five Chardonnay samples analyzed. Those GRVFV-specific contigs had 98.5-98.7% pairwise identity. A nearly complete genome of GRVFV-ID was assembled from the HTS data of one sample, and the 3'-terminus of the genome was acquired using the RACE methodology; the 6,736-nt sequence has been deposited in the GenBank database under the accession number MZ027155. BLASTn analysis of this sequence revealed 90.7% identity to the closest match in the GenBank database (MH544699, isolate SK931from Slovakia). In the fall of 2020, six commercially operating vineyards in Canyon and Nez Perce Counties of Idaho, including the original one, were sampled for the total of 26 sampled plants of white and red wine grape cultivars, based on visual symptoms of leaf reddening, leaf rolling, and chlorosis, and tested by reverse transcription (RT)-PCR using newly designed GRVFV-specific primers, GRVFV-F1 (5'- GAAGCAACAGTGCCCGTCTC -3') and GRVFV-R1 (5'- AGGTCGCTTTACGGACCTTTTCTT -3'). Four plants were found positive for GRVFV by RT-PCR; these positive samples came from three vineyards in Canyon County, from the same wine grape cultivar, Chardonnay. Amplified RT-PCR products were directly sequenced using conventional Sanger methodology, and confirmed to represent 662-nt segments of the GRVFV genome exhibiting 98.6-99.1% pairwise identity to the HTS-derived full-length genome of GRVFV-ID (MZ027155). The four corresponding partial sequences were deposited under the accession numbers MZ020577 to MZ020580. This close identity between the GRVFV sequences from three different Idaho vineyards, coming from the same cultivar Chardonnay, may suggest a common origin of the original GRVFV infection, possibly the same supplier of the original Chardonnay planting material. The California GRVFV sequence AY706994 was 80% identical to the GRVFV-ID, while the recently reported partial sequences of GRVFV from Washington State (MT782067-MT782070; Chingandu et al. 2021) were found to be only 82-85% identical to the GRVFV-ID. Presence of GRVFV might have contributed to the decline of the original Chardonnay vines, although the exact role of GRVFV in a mixed infection with GLRaV-3 is not clear at the moment. To the best of our knowledge, this is the first report of GRVFV in wine grapes in Idaho.

POSSIBLE ZOONOTIC TRANSMISSION OF UNKNOWN MICROBIAL PATHOGEN IN A LUNG TRANSPLANT RECIPIENT: A CASE REPORT

TOPIC: Transplantation TYPE: Fellow Case Reports INTRODUCTION: Lung transplant recipients are at an increased risk for microbial infection, which may at times be difficult to isolate or properly identify, even with repeat transbronchial biopsies (1). CASE PRESENTATION: We reviewed the unique, potential route of transmission and infectious disease course of an enigmatic microbial pathogen that was challenging to identify and associated with an abscess of the lung allograft in a 59-year-old bilateral lung re-transplant recipient. Interestingly, the patient reported having multiple pets at home, including dogs, lizards, cows, horses, and chickens residing on her property, which may have been a source of infection. DISCUSSION: This lung re-transplant recipient presented to our advanced lung disease center at 9-years post-transplant with complaints of sudden fever and chills alongside a 2-week history of productive cough with yellow-tinged sputum. Maintenance immunosuppression consisted of tacrolimus, sirolimus, and prednisone. The patient denied unintentional weight loss, night sweats, or known tuberculosis contacts or exposures;COVID-19 testing was negative in the interim. On thoracic imaging (Figure A), a right upper lobe cavitary lesion was identified. Bronchoscopy was negative for microorganismal growth. She was treated empirically with meropenem, isoniazid, and amikacin. The fever resolved, but the patient reported continued malaise over the next several weeks. Repeated bronchoscopies failed to identify any microorganisms. After six weeks of antibiotic therapy, the size of the lung abscess decreased (Figure B), but all cultures and transbronchial biopsies had failed to determine the infectious origin. The only note regarding her history prior to presentation was that she performed mouth-to-mouth resuscitation on her pet dog who unexpectantly collapsed. It is surmised that this event served as the basis for an oral transmission of a microbial pathogen. CONCLUSIONS: Lung abscesses are generally an early complication in the post-lung transplant period, yet our patient seemingly developed an abscess from an unknown microbial infection at 9-years post-transplant, potentially from a zoonotic source. Although infrequently observed, lung transplant recipients (and other immunosuppressed groups) may be at risk for severe harm or prolonged infection due to direct zoonosis. REFERENCE #1: Pahlman LI, Manoharan L, Aspelund AS. Divergent airway microbiomes in lung transplant recipients with or without pulmonary infection. Respir Res. 2021 Apr 23;22(1):118. doi: 10.1186/s12931-021-01724-w. PMID: 33892717. DISCLOSURES: No relevant relationships by Ashwini Arjuna, source=Web Response No relevant relationships by David Bowman, source=Web Response No relevant relationships by Michael Olson, source=Web Response No relevant relationships by Ali Saeed, source=Web Response

Comparison of the diagnostic predictability of serum amyloid A, white blood cell count and immunoglobulin G tests as indicators of early‐onset, acute‐phase morbidities in newborn foals

SummaryBackgroundAcute‐phase proteins (APPs) have diagnostic value as nonspecific, early indicators of inflammation and infectious disease.ObjectivesTo assess the ability of serum amyloid A (SAA) testing to distinguish between healthy and nonhealthy newborn foals, and to compare the diagnostic predictability of SAA with white blood cell (WBC) counts and serum immunoglobulin G (IgG) concentration.Study designThree‐year prospective clinical evaluation and diagnostic sample collection from newborn foals.MethodsFollowing an examination, a blood sample was obtained from each foal and tested for SAA and IgG concentrations, complete blood count (CBC) and standard biochemistry values. Foals were categorised as healthy or nonhealthy based on the clinical examination. The presence of clinical signs of infectious origin or certain noninfectious morbidities with a pro‐inflammatory component was sufficient for a nonhealthy designation. Serum amyloid A, IgG and WBC test results were determined and compared for healthy and nonhealthy foals.ResultsA total of 24 (13.7%) foals were diagnosed as clinically sick and 151 (86.3%) as normal based on physical examinations performed within 24 h after parturition. Mean SAA values were 27.7 ± 129.0 mg/L and 247.2 ± 454.8 mg/L for healthy and nonhealthy foals, respectively, a significant (p &lt; 0.05) difference indicating that elevated SAA values are associated with a nonhealthy diagnosis. Using a positive threshold of 100 mg/L, the SAA test had a positive predictive value (PPV) of 55.6% and IgG had the lowest PPV (16.7%) followed by WBC count (23.3%).Main limitationsA larger number of clinically nonhealthy foals with SAA levels &gt;100 would have given the study greater statistical power.ConclusionsEquine practitioners can consider SAA testing to be a reliable newborn examination diagnostic tool for detecting early‐onset, acute‐phase infection or noninfectious morbidities with an inflammatory component.