Optimal Cytoreductive Surgery Research Articles

Randomized trial of intravenous versus bidirectional chemotherapy after cytoreductive surgery for malignant peritoneal mesothelioma.

Malignant peritoneal mesothelioma (MPM) is a rare disease that progresses within the peritoneal cavity and only disseminates to systemic sites in the terminal months of the disease. For this malignancy, there are several regimens of chemotherapy that have been accepted as standard, principally intraperitoneal chemotherapy (IPC) and intravenous chemotherapy (IVC); however, there is no standardized method of treatment. Selected patients with MPM who are amenable to cytoreductive surgery (CRS) and are fit for surgery typically undergo resection with hyperthermic intraperitoneal chemotherapy (HIPEC). Though individual toxicity and efficacy studies of IPC plus IVC (bidirectional) and IVC chemotherapy for MPM have been conducted, a prospective randomized clinical trial has not been performed for this disease. The study objective is to compare the efficacy and toxicity of normothermic bidirectional (IPC/IVC) chemotherapy versus IVC after CRS and HIPEC for epithelial MPM. The patient population are those individuals undergoing CRS for MPM. Exclusion criteria include previous therapy form mesothelioma. The study design is a randomized, nonblinded, phase II clinical trial comparing multicycle IVC with cisplatin (CDDP) and pemetrexed (PMTX) versus multicycle bidirectional chemotherapy with IVC CDDP and IPC PMTX after optimal CRS and HIPEC with CDDP and doxorubicin. The primary endpoint is 2-year disease-free survival. The secondary endpoint is 30-day post-treatment morbidity. The primary objective is to compare the 2-year rates of disease-free survival in the two treatment arms. The secondary objective is to compare the toxicity of each treatment. The prospective randomized trial provides not only a standardized approach to treatment but also a path forward to optimize the survival of patients with MPM. In addition, any increase or decrease in the adverse events associated with PMTX administered as IPC will be demonstrated. Because MPM is a rare disease a multi-institutional implementation of the protocol is required.

Role of Computed Tomography in the Diagnosis of Ovarian Cancer

Introduction. Malignant formations in the ovaries remain a pressing issue in the field of oncology today. Ovarian cancer occupies one of the leading positions in terms of frequency (7th place) and mortality (4th place). The lack of symptoms during the course of the disease is explained by the fact that cancer cells primarily spread through the abdominal cavity, often leading to late-stage disease diagnosis. The prognosis of the disease depends on the stage of the disease, the level of tumor differentiation, the period of recurrence-free survival, and the size of the residual tumor after surgical treatment. Considering these factors, this disease remains of interest to researchers in terms of identifying new prognostic factors for the course of the disease and the possibility of influencing them. Methods. The study is based on the results of observing 139 patients with stage III-IV ovarian cancer. The study and evaluation included the peritoneal cancer index and overall survival. Results. An analysis of two groups of patients who received neoadjuvant chemotherapy/intraperitoneal chemotherapy and primary cytoreductive surgery was conducted. Peritoneal carcinomatosis was evaluated in the primary patients in the neoadjuvant chemotherapy/intraperitoneal chemotherapy group and the primary cytoreductive surgery group. The average peritoneal cancer index in the neoadjuvant chemotherapy/intraperitoneal chemotherapy group was 21.5 points, and in the primary cytoreductive surgery group, it was 14.3 points. Overall patient survival was calculated, according to the Kaplan-Meier curve, the median overall survival in the neoadjuvant chemotherapy/intraperitoneal chemotherapy group was 24 months, and in the primary cytoreductive surgery group, it was 25 months. Conclusions. The use of contrast-enhanced CT in patients with ovarian cancer is an informative method for diagnosing peritoneal carcinomatosis and allows for the correct diagnosis and planning of treatment tactics. Although interval cytoreductive surgery does not affect the overall survival of patients, it allows for optimal cytoreductive surgery in patients with advanced carcinomatosis.

The clinical challenges of homologous recombination proficiency in ovarian cancer: from intrinsic resistance to new treatment opportunities.

Ovarian cancer is the most lethal gynecologic cancer. Optimal cytoreductive surgery followed by platinum-based chemotherapy with or without bevacizumab is the conventional therapeutic strategy. Since 2016, the pharmacological treatment of epithelial ovarian cancer has significantly changed following the introduction of the poly (ADP-ribose) polymerase inhibitors (PARPi). BRCA1/2 mutations and homologous recombination deficiency (HRD) have been established as predictive biomarkers of the benefit from platinum-based chemotherapy and PARPi. While in the absence of HRD (the so-called homologous recombination proficiency, HRp), patients derive minimal benefit from PARPi, the use of the antiangiogenic agent bevacizumab in first line did not result in different efficacy according to the presence of homologous recombination repair (HRR) genes mutations. No clinical trials have currently compared PARPi and bevacizumab as maintenance therapy in the HRp population. Different strategies are under investigation to overcome primary and acquired resistance to PARPi and to increase the sensitivity of HRp tumors to these agents. These tumors are characterized by frequent amplifications of Cyclin E and MYC, resulting in high replication stress. Different agents targeting DNA replication stress, such as ATR, WEE1 and CHK1 inhibitors, are currently being explored in preclinical models and clinical trials and have shown promising preliminary signs of activity. In this review, we will summarize the available evidence on the activity of PARPi in HRp tumors and the ongoing research to develop new treatment options in this hard-to-treat population.

Clinical Observations and Outcomes in Advanced Low-Grade Serous Carcinoma of the Ovary: Case Series from a Tertiary Cancer Center.

Low-grade serous carcinoma (LGSC) is a rare histologic subtype of ovarian cancer. We present detailed management of 15 cases of advanced LGSC from a tertiary cancer center of India. Fifteen cases of advanced LGSC who underwent cytoreductive surgery (CRS) were analyzed from a prospectively maintained database. Baseline demographic characteristics, surgical details, and chemotherapy details were recorded. Descriptive statistics were summarized, and progression-free survival (PFS) and overall survival (OS) were estimated. The median age was 37years. Nine patients had received NACT. All cases were FIGO stage III. Mean PCI was 15. Eleven patients had a completeness of cytoreduction score of 0-1. The median surgical time was 7.5h; nine patients required multiple gastrointestinal resections. Median blood loss was 2500ml. Median postoperative ventilation, ICU stay, and hospital stays were 1, 2, and 16days, respectively. One patient had a grade III complication. Four patients received adjuvant chemotherapy. There was no postoperative mortality at the end of 90days of surgery. All the patients except one were offered hormonal maintenance therapy. At a median follow-up of 43months, 4 patients were disease-free, 9 had a recurrence, one died of disease progression, and one was lost to follow-up. Most recurrences were locoregional in the peritoneal cavity or pelvis. Four-year OS and PFS were 71.8% and 29.7%, respectively. Advanced LGSCs occur mostly in young premenopausal women with favorable oncologic outcomes. Optimal CRS is the mainstay of treatment. Relative chemo-resistance and hormone receptor positivity provide an excellent therapeutic opportunity for endocrine therapy.

Clinical predictors of survival in advanced epithelial ovarian cancer: Can we foresee the long-term survivors and develop a personalized treatment approach?

e17605 Background: While women with recurrent disease have a poor prognosis, a subset of women are long term survivors (LTS). We aimed to characterize the demographic and clinical characteristics associated with long and short-term survival of patients with advanced epithelial OC (EOC). Methods: We conducted a retrospective descriptive analysis of 822 patients diagnosed with advanced EOC (FIGO stage III/IV) and treated at a single institution, between 2002-2020. Characteristics of short-term survivors (STS), women who survived less than 2 years, were compared to LTS, patients who lived beyond 7 and 10 years from diagnosis. Descriptive statistics of the clinical, oncologic, and treatment parameters were performed using t-test, chi-square. We assessed the contribution of age and stage, BRCA carrier status, interval or primary debulking, optimal debulking, platinum sensitivity, and treatment scheduling upon oncological outcomes. Results: Among 822 patients with advanced EOC, 112 women (13.6%) died withing 24 months from diagnosis, while 139 (16.9%), and 64 (7.8%) survived beyond 7 and 10 years, respectively. Histology, CA125 level at diagnosis, and interval or primary debulking approach, were not significant among the STS and LTS. LTS were younger at diagnosis, (median age of 57, and 56.5 among women who lived > 7 and 10 years, respectively vs. 70 in STS, p < 0.0001). The majority of LTS were diagnosed with stage III disease, (95%, and 97%, > 7 and > 10 years, respectively vs. 67% of STS), in contrast to a greater proportion of STS diagnosed with stage IV (33.0% of STS vs. 5.0%, 3.1% of LTS > 7 and > 10 years, respectively, p < 0.0001). BRCA mutation status was the strongest prognostic factor for LTS ( > 7 and 10 years, OR = 17.8, 21.2 respectively, p < 0.001). Almost half of LTS who were carriers of a deleterious BRCA mutation, (47.3%, 46.2% of LTS > 7 and 10 years, respectively, p < 0.0001), whereas most STS were not carriers of BRCA mutations (89.8%). LTS were predominantly platinum sensitive (99.3%, 98.4% > 7 and > 10 year, vs. 21.6% of STS, P < 0.0001). Optimal cytoreductive surgery was performed in a smaller number of STS compared to the LTS (41.9% of STS vs. 83.5% and 88.7% of LTS > 7 and 10 years, respectively, p < 0.0001). A greater proportion of LTS received weekly treatment scheduling of paclitaxel and carboplatin compared to STS (50.8% and 49.2% of LTS > 7 and 10 years, respectively vs. 31.6% of STS, p < 0.01). Conclusions: The long and short-term survivors of advanced EOC may be identified early in the clinical assessment, based on distinct patient characteristics associated with survivorship, which are critical in developing a personalized treatment approach. Our work demonstrated that LTS are a distinct group of women diagnosed at a younger age, lower stage, optimally debulked, platinum sensitive disease, and BRCA mutation carriers.

Apendektomi sonrası tesadüfen teşhis edilen tubal yüksek dereceli seröz karsinom olgu sunumu

Primary tubal carcinoma is a uncommon tumor of female ganitale system. The clinical approach of primary tubal cancers is similar to primary ovarian cancers. Fallopian tube carcinoma is hard to diagnosed preoperatively because of its uncertain symptoms. Providing optimal cytoreductive surgery is the most important treatment step in ovarian, tubal and peritoneal carcinomas.
 We report a case of serous tubal intraepithelial carcinoma and appendix metastasis. A 65 years old post-menopausal woman (gravida 4, para 3) submitted to an external hospital with lower abdominal pain and acute abdominal symptoms. Appendectomy was performed on the patient with preliminary diagnosis of appenditis. The pathology result was reported as high grade serous carcinoma infiltration. Staging surgery was performed with the diagnosis of carcinoma. Until the final pathology result, the diagnosis was considered as appendiceal metastasis of serous tubal cancer. Our clinical and surgical approach to the case, which was diagnosed incidentally with an appendectomy specimen and reported as high grade tubal serous carcinoma, is presented as a case study.

ASO Visual Abstract: PI3K Pathway Alterations in Peritoneal Metastases are Associated with Earlier Recurrence for Patients with Colorectal Cancer Undergoing Optimal Cytoreductive Surgery.

ASO Visual Abstract: PI3K Pathway Alterations in Peritoneal Metastases are Associated with Earlier Recurrence for Patients with Colorectal Cancer Undergoing Optimal Cytoreductive Surgery.

PI3K Pathway Alterations in Peritoneal Metastases are Associated with Earlier Recurrence in Patients with Colorectal Cancer Undergoing Optimal Cytoreductive Surgery.

Colorectal cancer with peritoneal metastasis (CRC-PM) represents a biologically heterogeneous disease; yet little is known regarding the impact of tumor biology on survival outcomes following optimal cytoreductive surgery (CRS). We analyzed the frequency of alterations in cancer signaling pathways in patients with CRC-PM and their impact on recurrence-free survival (RFS) following optimal CRS. Thirty-five consecutive CRC-PM patients who underwent optimal CRS/HIPEC and next generation sequencing of peritoneal metastases were included in the study. Alterations in eight cancer-related signaling pathways were analyzed: Wnt/APC, p53, RTK-RAS, PI3K, TGF-B, Notch, Myc, and cell cycle. The association of pathway alterations with RFS and OS following optimal cytoreduction was estimated using Cox proportional hazard modeling. The most frequently altered pathways were Wnt/APC (63%), p53 (63%), RTK-RAS (60%), and PI3K (23%). Among optimally cytoreduced patients with CRC-PM, PI3K pathway alterations were an independent predictor of worse RFS (hazard ratio 3.2, 95% confidence interval CI 1.3-8.3, p = 0.01) with a clinically meaningful impact on median months to recurrence (5 vs. 13 months, p = 0.02). Alterations in p53, Wnt, and RTK-RAS pathways were not significantly associated with a difference in RFS following CRS. Alterations in the four pathways were not associated with differences in OS following CRS (median OS was 50 (interquartile range 23-80) months). In patients with CRC-PM, PI3K pathway alterations are associated with earlier recurrence following optimal CRS, which may represent a distinct molecular subtype. This novel finding can tailor clinical trials by using PIK3CA-directed interventions to reduce risk of recurrence after optimal CRS.

Mature Cystic Teratoma of the Ovary Transforms into Squamous Cell Carcinoma: A Case Report.

Mature cystic teratomas (MCTs) are benign ovarian tumors known to undergo malignant transformation in 1%-2% of cases. Most of these cases lead to squamous cell carcinomas (SCC), and the prognosis is often poor, particularly in advanced-stage disease. A 50-year-old postmenopausal woman presented with a large pelvic mass. The patient initially underwent suboptimal primary surgery and was later diagnosed with stage IIIA SCC arising from MCT. Following the first cycle of chemotherapy with carboplatin and paclitaxel, a computed tomography scan showed a rapidly growing large mass in the pelvic cavity after 4 weeks of primary surgery, leading to a second debulking surgery. However, the patient underwent only one cycle of chemotherapy after secondary debulking surgery because of her poor performance status. Subsequently, after 4 months of secondary debulking surgery, the patient developed rapidly progressive disease, leading to her death approximately after 8 months of diagnosis. While an appropriate multimodal treatment strategy has yet to be established, optimal cytoreductive surgery and adjuvant chemotherapy should be considered for treatment of advanced-stage diseases to improve survival outcomes.

Minilaparotomy, Cyfra21-1, and Other Predicting Factors for Suboptimal Cytoreductive Surgery in Advanced Epithelial Ovarian Cancer: A Pilot Study

Currently, there is no reliable method to predict the result of the primary cytoreduction to decide whether to go on primary cytoreductive surgery or receive neoadjuvant chemotherapy. This study aimed to identify candidate predicting factors from clinical data, serum biomarkers, CT/MRI imaging, and minilaparotomy for suboptimal cytoreduction in women with advanced epithelial ovarian cancer. Women who were clinically suspicious of advanced-stage epithelial ovarian, fallopian tube, and peritoneal cancer undergoing primary cytoreductive surgery were recruited. Clinical data, abdominopelvic CT/MRI, and serum biomarkers, including CA125, HE4, and Cyfra21-1, were collected preoperatively. At the start of the surgery, a minilaparotomy incision was made, the peritoneal cavity was assessed, and the operating surgeons gave the impression of whether the optimal cytoreductive surgery would be attainable. Subsequently, the incision was extended as necessary, and the standard cytoreductive surgery was attempted. After the procedure completion, the surgical outcome (optimal vs. suboptimal cytoreduction) and other operative outcomes were recorded. The association between the potential predicting factors and the surgical outcome was examined. Fourteen patients were included in this pilot study. Twelve patients were diagnosed with primary ovarian or fallopian tube cancer, while two had ovarian metastasis from colorectal cancer. The optimal cytoreduction was achieved in eight women. After minilaparotomy, the surgeons could predict suboptimal surgery correctly in five out of six cases (OR: 24.12, 95%CI: 2.34-Inf., p<0.01). Moreover, no patient with the finding of rectosigmoid invasion from CT had optimal surgery (OR: 12.96, 95%CI: 1.26-Inf., p=0.03). Lastly, increased serum cyfra21-1(>8 ng/mL) and HE4 (>83 pmol/L) were significantly associated with suboptimal cytoreduction, with OR: 35.00, 95%CI: 1.74-702.99, p=0.02 and OR: 15.00, 95%CI: 1.03-218.30, p=0.05, respectively. The finding of rectosigmoid invasion from abdominal CT, increased serum cyfra21-1 and HE4, and the initial minilaparotomy impression were potentially associated with suboptimal cytoreduction.

Outcomes of Laparoscopic Optimal Interval Cytoreduction Surgery (LOICS) in Patients with Advanced Ovarian Cancers Having Low Burden Disease.

Laparoscopy has been increasingly utilised for cytoreduction surgery in patients with early ovarian cancers. The present study tries to assess the feasibility of laparoscopic interval cytoreduction surgery (LOICS) in patients with advanced ovarian cancer (AOC) having low burden residual disease. A retrospective study of was done of AOC's who underwent LOICS between 2010 and 2014. Epithelial ovarian cancer patients who underwent interval cytoreduction surgery were included and analysed for short-term and long-term outcomes. In all, 36 patients with stage III ovarian cancers were included in the analysis. Twenty-two (61.1%) were grade 3 and 14 (38.8%) were grade 2, and no patient had grade 1 tumour. Stage wise majority were stage IIIC (94.4%) followed by 2 (5.5%) in stage IIIA. There was 1 postoperative complication (2.5%) and no intraoperative complications. Median time to discharge and to start chemotherapy was 5days and 23days respectively. After a median follow-up of 60months, 3 patients (8.3%) were lost to follow-up and the remaining 33 patients were analysed for survival outcomes. The overall survival (OS) and recurrence-free survival (RFS) were 58.3% and 36.1% respectively. The median RFS and OS were 24months and 51months, respectively. Most recurrences involved the peritoneum (82.6%), and 5 patients (21.7%) had nodal recurrence alone. Laparoscopic optimal interval cytoreduction is feasible in patients with advanced ovarian cancers provided the disease burden permits optimal surgery, especially in centres with expertise in complex laparoscopic procedures.

Advanced low grade serous ovarian cancer: A retrospective analysis of surgical and chemotherapeutic management in two high volume oncological centers

Simple summaryLow-grade serous ovarian cancer (LGSOC) represents an uncommon histotype of serous ovarian cancer (accounting for approximately 5% of all ovarian cancer) with a distinct behavior compared to its high-grade serous counterpart, characterized by a better prognosis and low response rate to chemotherapeutic agents. Similar to high-grade serous ovarian cancer, cytoreductive surgery is considered crucial for patient survival. This retrospective study aimed to analyze the outcomes of women affected by advanced stages (III–IV FIGO) of LGSOC from two high-volume oncological centers for ovarian neoplasm. In particular, we sought to evaluate the impact on survival outcomes of optimal cytoreductive surgery [i.e., residual disease (RD) <10 mm at the end of surgery]. The results of our work confirm the role of complete cytoreduction (i.e., no evidence of disease after surgery) in the survival of patients and even the positive prognostic role of a minimal RD (i.e., <10 mm), whenever complete cytoreduction cannot be achieved.BackgroundLow-grade serous ovarian cancer (LGSOC) is a rare entity with different behavior compared to high-grade serous (HGSOC). Because of its general low chemosensitivity, complete cytoreductive surgery with no residual disease is crucial in advanced stage LGSOC. We evaluated the impact of optimal cytoreduction on survival outcome both at first diagnosis and at recurrence.MethodsWe retrospectively studied consecutive patients diagnosed with advanced LGSOCs who underwent cytoreductive surgery in two oncological centers from January 1994 to December 2018. Survival curves were estimated by the Kaplan–Meier method, and 95% confidence intervals (95% CI) were estimated using the Greenwood formula.ResultsA total of 92 patients were included (median age was 47 years, IQR 35–64). The median overall survival (OS) was 142.3 months in patients with no residual disease (RD), 86.4 months for RD 1–10 mm and 35.2 months for RD >10 mm (p = 0.002). Progression-free survival (PFS) was inversely related to RD after primary cytoreductive surgery (RD = 0 vs RD = 1–10 mm vs RD >10 mm, p = 0.002). On multivariate analysis, RD 1–10 mm (HR = 2.30, 95% CI 1.30–4.06, p = 0.004), RD >10 mm (HR = 3.89, 95% CI 1.92–7.88, p = 0.0004), FIGO stage IV (p = 0.001), and neoadjuvant chemotherapy (NACT) (p = 0.010) were independent predictors of PFS. RD >10 mm (HR = 3.13, 95% CI 1.52–6.46, p = 0.004), FIGO stage IV (p <0.0001) and NACT (p = 0.030) were significantly associated with a lower OS.ConclusionsOptimal cytoreductive surgery improves survival outcomes in advanced stage LGSOC s . When complete debulking is impossible, a RD <10 mm confers better OS compared to an RD >10 mm in this setting of patients.

Peroperative extent of peritoneal metastases affects the surgical outcome and survival in advanced ovarian cancer

ObjectiveDetermining whether cytoreductive surgery (CRS) is feasible in patients with advanced ovarian cancer and whether extensive surgery is justified is challenging. Accurate patient selection for CRS based on pre- and peroperative parameters will be valuable. The aim of this study is to assess the association between the extent of peritoneal metastases as determined during surgery and completeness of interval CRS and survival. MethodsThis single-center observational cohort study included consecutive patients with newly diagnosed stage III-IV epithelial ovarian cancer who received neoadjuvant chemotherapy and underwent interval CRS. The 7 Region Count (7RC) was recorded during surgical exploration to systematically quantify the extent of peritoneal metastases. Logistic regression analysis was performed to predict surgical outcomes, and Cox regression analysis was done for survival outcomes. ResultsA total of 316 patients were included for analyses. The median 7RC was 4 (interquartile range: 2–6). Complete CRS was performed in 58%, optimal CRS in 30%, and incomplete CRS in 12% of patients. A higher 7RC was independently associated with lower odds of complete or optimal CRS in multivariable analysis (odds ratio [OR] = 0.45, 95% confidence interval [CI]: 0.33–0.63, p < 0.001). Similarly, a higher 7RC was independently associated with worse progression-free survival (hazard ratio [HR] = 1.17, 95% CI 1.08–1.26, p < 0.001) and overall survival (HR = 1.14, 95% CI 1.04–1.25, p = 0.007). ConclusionThe extent of peritoneal metastases, as expressed by the 7RC during surgery, is an independent predictor for completeness of CRS and has independent prognostic value for progression-free survival and overall survival in addition to completeness of CRS.

Highly specific selenium nanosystems for fluorescent image-guided rapid diagnosis and pathological grading of ovarian malignant tumors

Comprehensive surgical staging or optimal tumor cytoreductive surgery of malignant ovarian cancer directly affects disease prognosis. Therefore, a fluorescent selenium nanoparticle (Se@RGD/S2.2) decorated with cancer-targeting Arg-Gly-Asp (RGD) peptides and GCAGTTGATCCTTTGGATACCCTGG aptamer (S2.2) was developed for use as a diagnostic agent to achieve rapid, noninvasive diagnosis and visualization of microinvasive lesions during surgery for malignant ovarian cancer.

NIPEC with Single-Dose Intraperitoneal Cisplatin and Paclitaxel in Stage III Epithelial Ovarian Cancer.

Sanjay M. DesaiObjectives Epithelial ovarian cancer (EOC) is a heterogeneous, essentially peritoneal disease. Standard treatment consists of staging, cytoreductive surgery (CRS), and adjuvant chemotherapy. In this study, we intended to assess the effectiveness of single-dose intraperitoneal (IP) chemotherapy in optimally debulked advanced EOC patients. Materials and Methods A prospective randomized study of 87 patients with advanced EOC was done from January 2017 to May 2021 in a tertiary care center. Patients who underwent primary and interval cytoreduction received a single dose of IP chemotherapy for 24 hours after being divided into four groups: group A, IP cisplatin; group B, IP paclitaxel; group C, IP paclitaxel and cisplatin; and group D, saline. Pre- and postperitoneal IP cytology was assessed along with possible complications. Statistical Analysis Logistic regression analysis was used to assess for intergroup significance in cytology and complications. Kaplan-Meir analysis was done to assess disease-free survival (DFS). Results Of 87 patients, 17.2% of patients had FIGO stage IIIA, 47.2% had IIIB, and 35.6% had IIIC. Also, 22 (25.3%) patients were in group A (cisplatin), 22 (25.3%) patients in group B (paclitaxel), 23 (26.4%) in group C (cisplatin and paclitaxel), and 20 (23%) in group D (saline). Cytology samples taken during staging laparotomy were positive, and 48 hours post-IP chemotherapy, 2 (9%) of 22 samples in cisplatin group and 14 (70%) of 20 samples in saline group were positive; all of the post-IP samples in groups B and C were negative. No major morbidity was noted. In our study, DFS in saline group was 15 months, while in IP chemotherapy group it was 28 months and was statistically significant based log-rank test. However, there was no significant difference in DFS between different IP chemotherapy groups. Conclusion Complete or optimal CRS in advanced EOC does have a possibility of microscopic peritoneal residue. Adjuvant locoregional strategies should be considered to prolong DFS. Single-dose normothermic IP chemotherapy can be offered to the patients with minimal morbidity, and its prognostic benefits are comparable to hyperthermic IP chemotherapy. Future clinical trials are required to validate these protocols.

Robotic assisted primary cytoreductive surgery for treatment of advanced stage ovarian cancer: A pilot study (553)

Robotic assisted primary cytoreductive surgery for treatment of advanced stage ovarian cancer: A pilot study (553)

Oncologic outcomes of secondary cytoreductive surgery in the era of poly (ADP-ribose) polymerase inhibitors maintenance (549)

Oncologic outcomes of secondary cytoreductive surgery in the era of poly (ADP-ribose) polymerase inhibitors maintenance (549)

Predicting value of HE4 and CA125 markers for optimal cytoreductive surgery in ovarian cancer patients.

We conducted a cross-sectional study to evaluate the role of serum levels of CA125 and HE4 in predicting optimal cytoreductive surgery. Eligible women who had been diagnosed with ovarian cancer based on both clinical and imaging criteria were enrolled in this study. Serum levels of CA 125 and HE4 were checked before surgery and all patients underwent complete surgical staging. After completion of the pathological evaluation, data were entered in SPSS version 23. One hundred and ten individuals were enrolled in our study. We divided cases between two groups: stage I to Ш b and stage Шc to IV. Serum level of HE4 >170 pmol/L can predict optimal cytoreductive surgery before operation. (sensitivity:80% and specificity 70%) and serum level of CA 125 > 320 UI/mL can predict optimal cytoreductive surgery before operation. (sensitivity:80% and specificity 70%). Our data demonstrated a negative predictive value of about 80% for both HE4 and CA125. Based on these cut-off, unnecessary surgery can be avoided in many cases, however, it is unwise to ignore clinical performance and radiological findings. Nevertheless, we can say the evaluation of tumor markers is feasible and helpful in predicting optimal surgery.

Outcomes in older patients with metastatic epithelial ovarian cancer: Are we providing equitable care? (600)

Outcomes in older patients with metastatic epithelial ovarian cancer: Are we providing equitable care? (600)

The Molecular Mechanisms of Actions, Effects, and Clinical Implications of PARP Inhibitors in Epithelial Ovarian Cancers: A Systematic Review

Ovarian cancer is the most lethal gynecologic malignancy in the United States. Some patients affected by ovarian cancers often present genome instability with one or more of the defects in DNA repair pathways, particularly in homologous recombination (HR), which is strictly linked to mutations in breast cancer susceptibility gene 1 (BRCA 1) or breast cancer susceptibility gene 2 (BRCA 2). The treatment of ovarian cancer remains a challenge, and the majority of patients with advanced-stage ovarian cancers experience relapse and require additional treatment despite initial therapy, including optimal cytoreductive surgery (CRS) and platinum-based chemotherapy. Targeted therapy at DNA repair genes has become a unique strategy to combat homologous recombination-deficient (HRD) cancers in recent years. Poly (ADP-ribose) polymerase (PARP), a family of proteins, plays an important role in DNA damage repair, genome stability, and apoptosis of cancer cells, especially in HRD cancers. PARP inhibitors (PARPi) have been reported to be highly effective and low-toxicity drugs that will tremendously benefit patients with HRD (i.e., BRCA 1/2 mutated) epithelial ovarian cancer (EOC) by blocking the DNA repair pathways and inducing apoptosis of cancer cells. PARP inhibitors compete with NAD+ at the catalytic domain (CAT) of PARP to block PARP catalytic activity and the formation of PAR polymers. These effects compromise the cellular ability to overcome DNA SSB damage. The process of HR, an essential error-free pathway to repair DNA DSBs during cell replication, will be blocked in the condition of BRCA 1/2 mutations. The PARP-associated HR pathway can also be partially interrupted by using PARP inhibitors. Grossly, PARP inhibitors have demonstrated some therapeutic benefits in many randomized phase II and III trials when combined with the standard CRS for advanced EOCs. However, similar to other chemotherapy agents, PARP inhibitors have different clinical indications and toxicity profiles and also face drug resistance, which has become a major challenge. In high-grade epithelial ovarian cancers, the cancer cells under hypoxia- or drug-induced stress have the capacity to become polyploidy giant cancer cells (PGCCs), which can survive the attack of chemotherapeutic agents and start endoreplication. These stem-like, self-renewing PGCCs generate mutations to alter the expression/function of kinases, p53, and stem cell markers, and diploid daughter cells can exhibit drug resistance and facilitate tumor growth and metastasis. In this review, we discuss the underlying molecular mechanisms of PARP inhibitors and the results from the clinical studies that investigated the effects of the FDA-approved PARP inhibitors olaparib, rucaparib, and niraparib. We also review the current research progress on PARP inhibitors, their safety, and their combined usage with antiangiogenic agents. Nevertheless, many unknown aspects of PARP inhibitors, including detailed mechanisms of actions, along with the effectiveness and safety of the treatment of EOCs, warrant further investigation.