Onset Spinal Muscular Atrophy Research Articles

150P Patient, caregiver and healthcare professionals’ perspective on spinal bracing in early onset spinal muscular atrophy in the UK: a national survey

150P Patient, caregiver and healthcare professionals’ perspective on spinal bracing in early onset spinal muscular atrophy in the UK: a national survey

Survival analysis and life expectancy of pediatric patients with spinal muscular atrophy in Thailand

BackgroundSurvival data for Thai patients with 5q spinal muscular atrophy (SMA), the leading cause of infant mortality worldwide, are lacking. ObjectiveThis study aimed to determine the survival rates and life expectancies of pediatric patients with SMA types 1, 2, and 3. MethodsWe conducted a retrospective cohort analysis of genetically confirmed 5q SMA patients aged 0–18 years who were treated between 1999 and 2021 at the pediatric neuromuscular clinic of Siriraj Hospital, Bangkok, Thailand. Mortality data were sourced from the Civil Registration Office. ResultsThe study included 113 patients: 37 with SMA type 1, 53 with type 2, and 23 with type 3. Life expectancy varied significantly by SMA type: 2.2 years for type 1, 11 years for type 2, and 16.5 years for type 3. The median survival times for SMA type 1 and 2 were 1.9 and 19 years, respectively. In SMA type 2, early onset (<1 year) correlated with a shorter median survival than later onset (≥1 year) (log-rank test P = 0.009). Early onset SMA type 2 had a median survival time of 15.9 years, while 75 % of those with later onset SMA type 2 survived until the age of 19 years. Cox proportional hazards analysis revealed that each month's delay in disease onset reduced the annual mortality risk by 17 % for type 1 patients and by 20 % for type 2 patients. Compared with female patients, male patients with type 2 disease had a 12-fold increased mortality risk. ConclusionsAge at onset is a significant predictor of survival and life expectancy in patients with SMA types 1 and 2. These insights are crucial for genetic counseling and prognostic discussions in clinical settings.

Polysomnography findings and respiratory muscle function in infants with early onset spinal muscular atrophy after gene replacement as monotherapy: A prospective study

BackgroundGene replacement therapy (onasemnogene abeparvovec) is associated with an improvement of the prognosis of children with spinal muscular atrophy, but information on long-term respiratory outcome is scarce. The aim of this study was to report the polysomnography findings and respiratory muscle function of infants with treatment-naive spinal muscular atrophy type 1 and 2 up to 24 months after onasemnogene abeparvovec monotherapy. MethodsA clinical and motor evaluation, respiratory muscle function testing, and polysomnography were performed repeatedly. ResultsFifteen spinal muscular atrophy patients (1 presymptomatic, 7 type 1b, 6 type 1c, and 1 type 2) were included at a median age of 8.6 months (range 3.8–12.6) and followed for 24 months. The thoracic over head circumference ratio was close to normal at baseline (median 1.00 (range 0.90–1.05)) and increased significantly over time. All polysomnography and nocturnal gas exchange parameters were within normal ranges at baseline (median apnea-hypopnea index 2.5 events/hour (range 0.4–5.3)) and follow-up. The inspiratory muscle strength was normal at baseline but tended to slightly decrease over time and the expiratory muscle strength was low at any time especially for patients with recurrent respiratory infections (median (range) at baseline in cmH2O: crying esophageal pressure 54 (30–110), crying transdiaphragmatic pressure 65 (35–107), gastric pressure during maximal cough 26 (10–130), esophageal pressure during maximal cough 61 (38–150)). Only 3 patients required noninvasive ventilation. ConclusionA continuous respiratory monitoring of spinal muscular atrophy patients during the first years of life following onasemnogene abeparvovec monotherapy seems recommended despite the normality of polysomnography parameters.

Brain Magnetic Resonance Imaging (MRI) in Spinal Muscular Atrophy: A Scoping Review.

5q Spinal Muscular Atrophy (SMA) is a prototypical lower motor neuron disorder. However, the characteristic early motor impairment raises the question on the scope of brain involvement with implications for further investigations on the brain as a potential therapeutic target. To review changes across the SMA clinical spectrum reported on brain magnetic resonance imaging (MRI). We conducted a scoping review of existing literature on PubMed and EMBASE. Two reviewers searched and retrieved relevant articles on magnetic resonance brain imaging in individuals with SMA censoring to April 2022. Full-text articles published in peer-reviewed journals or abstracts accepted to conferences in English and French were included. Twelve articles were identified describing a total of 39 patients [age range: 11 days to 41 years old, type 0 (n = 5), type 1 (n = 4), type 2 (n = 2), type 3 (n = 22), type 4 (n = 6)]. All reported structural changes and did not explore other MRI modalities. In individuals with infantile onset SMA, cortical and subcortical brain abnormalities in white matter, basal ganglia, thalamus, hippocampus, and high intensity areas around lateral ventricles and thalami were reported over time. In individuals with later-onset SMA, reduced cerebellar and lobular volume were observed as well as increased grey matter density in motor areas. Limited data on brain imaging in SMA highlights both cortical and subcortical involvement in SMA, supporting the hypothesis that changes are not restricted to lower motor neuron pathways. Further studies are needed to determine the extent and prevalence of structural and functional brain changes across SMA types.

Identification of Novel CSF-Derived miRNAs in Treated Paediatric Onset Spinal Muscular Atrophy: An Exploratory Study.

The availability of disease modifying therapies for spinal muscular atrophy (SMA) have created an urgent need to identify clinically meaningful biomarkers that provide insight into disease progression and therapeutic response. microRNAs (miRNA) have been shown to be involved in the pathogenesis of SMA and have the potential to provide insight within the field of SMA. miRNA-sequencing was utilized to identify differential miRNA expression in the cerebrospinal fluid (CSF) in six children with SMA treated with nusinersen in this exploratory study. Fourteen differentially expressed miRNAs were significantly altered in CSF from baseline to follow-up during treatment with nusinersen. The greatest magnitude of change was noted in miR-7-5p, miR-15a-5p, miR-15b-3p/5p, miR-126-5p, miR-128-2-5p and miR-130a-3p which encompassed a spectrum of functions predominantly in neurogenesis, neuronal differentiation and growth. The dominant signaling pathways identified in this study were the mammalian target of rapamycin and the mitogen-activated protein kinase signaling pathways. This study identified multiple miRNAs that were involved in the complex interplay between neurodevelopment and neurodegeneration.

Inflammatory markers in cerebrospinal fluid of paediatric spinal muscular atrophy patients receiving nusinersen treatment.

Spinal muscular atrophy (SMA) is a progressive motor neuron disease with onset during infancy or early childhood. Recent therapeutic advances targeting the genetic defect that underlies SMA improved survival in patients with infantile onset SMA (type 1) and improved motor function in SMA type 1-3. The most commonly used therapy for SMA, the antisense oligonucleotide nusinersen, is delivered by repeated intrathecal injections. The long-term safety effects of this procedure, however, have not yet been investigated in detail. We here present case reports of three children with SMA in which routine laboratory investigation revealed increased leukocyte counts in cerebrospinal fluid (CSF) collected during the course of nusinersen treatment. To further characterize this observation, we used a multiplex method to analyse a broad spectrum of inflammatory markers in the CSF of these patients. We found that interleukin-10 (IL10) was consistently elevated in CSF with increased leukocyte counts, but other inflammatory markers were not. Based on this analysis we selected 7 markers for further analysis in a cohort of 38 children with SMA and determined their expression during the course of nusinersen therapy. No consistent association was found between levels of inflammatory markers and the duration of nusinersen therapy in individual patients. However, monocyte chemoactive protein 1 (MCP1/CCL2) -a neuroprotective protein secreted by astrocytes and previously associated with SMA- levels increased over the course of nusinersen treatment, indicating a possible neuroprotective mechanism associated with nusinersen therapy. In summary, our findings confirm that repeated intrathecal injections are safe and do not trigger unwanted immune responses.

New results for risdiplam in spinal muscular atrophy

Spinal muscular atrophy type 1 is a severe, progressive neuromuscular disease with symptom onset before age 6 months. Without disease modifying therapy, infants usually die of respiratory failure before age 2 years. Previous results from the FIREFISH study, an open-label clinical trial of risdiplam in patients with type 1 or infantile onset spinal muscular atrophy, have indicated that oral risdiplam might be safe and efficacious when given over 12 months to children with this type of spinal muscular atrophy. In The Lancet Neurology, Riccardo Masson and colleagues 1 Masson R Mazurkiewicz-Bełdzińska M Rose K et al. Safety and efficacy of risdiplam in patients with type 1 spinal muscular atrophy (FIREFISH part 2): secondary analyses from an open-label trial. Lancet Neurol. 2022; (published online Oct 13.)https://doi.org/10.1016/S1474-4422(22)00339-8 Summary Full Text Full Text PDF PubMed Scopus (1) Google Scholar report the results of secondary analyses from FIREFISH, including safety and efficacy data at 24 months. These analyses clearly show that patients continued to benefit from up to 24 months of treatment, with attainment of motor milestones not seen in untreated patients in natural history studies. Furthermore, the safety profile seen at 12 months was maintained at 24 months. Safety and efficacy of risdiplam in patients with type 1 spinal muscular atrophy (FIREFISH part 2): secondary analyses from an open-label trialTreatment with risdiplam over 24 months resulted in continual improvements in motor function and achievement of developmental motor milestones. The FIREFISH open-label extension phase will provide additional evidence regarding long-term safety and efficacy of risdiplam. Full-Text PDF

Epidemiology, healthcare resource utilization and healthcare costs for spinal muscular atrophy in Alberta, Canada

Aims Spinal muscular atrophy (SMA) is a progressive neuromuscular disease associated with the degeneration of motor neurons in the brainstem and spinal cord. Studies examining the epidemiology and economic impact of SMA are limited in Canada. This study aimed to estimate the epidemiology as well as healthcare resource utilization (HRU) and healthcare costs for children with SMA in Alberta, Canada. Materials and methods We conducted a retrospective study using anonymized data from administrative healthcare databases provided by Alberta Health. Data from 1 April 2010 to 31 March 2018, were extracted for patients <18 years of age identified with SMA. Five-year incidence and prevalence were calculated for cases identified between 1 April 2012 and 31 March 2017. HRU and healthcare costs were assessed one year after SMA diagnosis, including hospitalizations, physician visits, ambulatory care visits and long-term care admissions. Results The five-year incidence and prevalence of pediatric onset SMA were 1.03 per 100,000 person-years and 9.97 per 100,000 persons, respectively. General practitioner, specialist, and ambulatory care visits were common among children with SMA in the first-year post-diagnosis. The mean (SD) total annual direct cost per patient in the first-year post-diagnosis was $29,774 ($38,407); hospitalizations accounted for 41.7% of these costs ($12,412 [$21,170]), followed by practitioner visits at 32.3% ($9,615 [$13,054]), and ambulatory care visits at 26.0% ($7,746 [$9,988]). Conclusions Children with SMA experience substantial HRU, particularly for hospitalizations and practitioner visits, following diagnosis. Given the high costs of SMA, timely access to effective treatment strategies, such as the novel survival motor neuron (SMN)-restoring treatments recently approved for use, are needed to improve health outcomes and HRU.

Metabolic and Nutritional Issues Associated with Spinal Muscular Atrophy.

Spinal muscular atrophy (SMA), the main genetic cause of infant death, is a neurodegenerative disease characterized by the selective loss of motor neurons in the anterior horn of the spinal cord, accompanied by muscle wasting. Pathomechanically, SMA is caused by low levels of the survival motor neuron protein (SMN) resulting from the loss of the SMN1 gene. However, emerging research extends the pathogenic effect of SMN deficiency beyond motor neurons. A variety of metabolic abnormalities, especially altered fatty acid metabolism and impaired glucose tolerance, has been described in isolated cases of SMA; therefore, the impact of SMN deficiency in metabolic abnormalities has been speculated. Although the life expectancy of these patients has increased due to novel disease-modifying therapies and standardization of care, understanding of the involvement of metabolism and nutrition in SMA is still limited. Optimal nutrition support and metabolic monitoring are essential for patients with SMA, and a comprehensive nutritional assessment can guide personalized nutritional therapy for this vulnerable population. It has recently been suggested that metabolomics studies before and after the onset of SMA in patients can provide valuable information about the direct or indirect effects of SMN deficiency on metabolic abnormalities. Furthermore, identifying and quantifying the specific metabolites in SMA patients may serve as an authentic biomarker or therapeutic target for SMA. Here, we review the main epidemiological and mechanistic findings that link metabolic changes to SMA and further discuss the principles of metabolomics as a novel approach to seek biomarkers and therapeutic insights in SMA.

Genetic and Disability Discrimination During COVID-19.

Genetic and Disability Discrimination During COVID-19.

SMA - CLINICAL: P.81 Nusinersen experience in later onset spinal muscular atrophy: A tertiary center

Spinal muscular atrophy (SMA) is a neuromuscular disorder characterized by progressive muscular atrophy and weakness. Nusinersen treatment has been paid by insurance for SMA 2 and 3 patients since February 2019 in Turkey. The aim of our study is to share the nusinersen experience of our patients. Spinal muscular atrophy 2 and -3 patients were retrospectively screened for age, gender, onset time of symptoms, age at genetic diagnosis, age of beginning nusinersen treatment and initial Hammersmith Functional Motor Scale-Expanded (HFMSE) scores, treatment side effects, and current status of treatment.

SMA – THERAPY: P.267 Minimally invasive fusionless surgery offers satisfactory early and definitive treatment for scoliosis in SMA children: Our experience over a decade

Scoliosis and pelvic obliquity are common in spinal muscular atrophy (SMA). When conservative treatment is not sufficient, fusionless surgeries are advocated to avoid early definitive spine fusion and preserve trunk growth. They are however thought to be a transitory solution, before final fusion at term. To evaluate an original minimally invasive fusionless surgery in SMA scoliosis. We retrospectively reviewed data from 2011 to 2019 for all the children with early onset SMA scoliosis who underwent minimally invasive fusionless technique.

SMA – THERAPY: P.265 Escalating dose and randomized, controlled study of high-dose nusinersen in SMA; study design and updated enrollment for the DEVOTE Study

The Phase 2/3 DEVOTE study (NCT04089566) is a 3-part study that will examine the safety and efficacy of nusinersen administered intrathecally at higher doses in participants with 5q spinal muscular atrophy (SMA). Part A is an open-label safety evaluation of later onset SMA participants (n=6, age 2-15 years, inclusive; SMA onset age >6 months) who will receive three 28 mg loading doses at 14-day intervals followed by two 28 mg maintenance doses every 4 months. After safety evaluation, Part B will enrol ≤126 participants with infantile-onset (age ≤7 months at informed consent; 2 SMN2 copies; SMA onset age ≤6 months) or later-onset SMA (age 2 to <10 years; SMA onset age >6 months; sat but not walking independently; HFMSE score ≥10 to ≤54).

Survival motor neuron protein regulates oxidative stress and inflammatory response in microglia of the spinal cord in spinal muscular atrophy

The deficiency of survival motor neuron (SMN) protein can result in the onset of spinal muscular atrophy (SMA), an autosomal recessive disorder characterized by a progressive loss of motor neurons and skeletal muscle atrophy. The mechanism underlying SMA pathology remains unclear. Here, we demonstrate that SMN protein regulates oxidative stress and inflammatory response in microglia. Antisense oligonucleotide, which increases SMN protein expression (SMN-ASO), attenuated SMA model mice phenotypes and suppressed the activation of microglia in the spinal cord. The expression of oxidative stress marker in microglia was decreased by SMN-ASO injection in SMA model mice. Increased reactive oxygen species production and subsequent antioxidative stress reaction was observed in SMN protein-depleted RAW264.7. Furthermore, nuclear factor kappa B (NFκB) and c-Jun amino terminal kinase (JNK) signaling, which mainly mediate the inflammatory response, are activated in SMN protein-depleted RAW264.7. Tumor necrosis factor-α (TNF-α) production is also increased in SMN protein-depleted RAW264.7. These findings suggest that SMN protein regulates oxidative stress and inflammatory response in microglia, supporting current claims that microglia can be an effective target for SMA therapy.

Discovery of specific mutations in spinal muscular atrophy patients by next-generation sequencing.

Spinal muscular atrophy (SMA) is a type of autosomal recessive genetic disease, which seriously threatens the health and lives of children and adolescents. We attempted to find some genes and mutations related to the onset of SMA. Eighty-three whole-blood samples were collected from 28 core families, including 28 probands with clinically suspected SMA (20 SMA patients, 5 non-SMA children, and 3 patients with unknown etiology) and their parents. The multiplex ligation probe amplification (MLPA) was performed for preliminary diagnosis. The high-throughput sequencing technology was used to conduct the whole-exome sequencing analysis. We analyzed the mutations in adjacent genes of SMN1 gene and the unique mutations that only occurred in SMA patients. According to the MLPA results, 20 probands were regarded as experimental group and 5 non-SMA children as control group. A total of 10 mutations were identified in the adjacent genes of SMN1 gene. GUSBP1 g.[69515863G>A], GUSBP1 g.[69515870C>T], and SMA4 g.[69515738C>A] were the top three most frequent sites. SMA4 g.[69515726A>G] and OCLN c.[818G>T] have not been reported in the existing relevant researches. Seventeen point mutations in the DYNC1H1 gene were only recognized in SMA children, and the top two most common mutations were c.[2869-34A>T] and c.[345-89A>G]; c.[7473+105C>T] was the splicing mutation that might change the mRNA splicing site. The mutations of SMA4 g.[69515726A>G], OCLN c.[818G>T], DYNC1H1 c.[2869-34A>T], DYNC1H1 c.[345-89A>G], and DYNC1H1 c.[7473+105C>T] in the adjacent genes of SMN1 gene and other genes might be related to the onset of SMA.

Transforaminal intrathecal delivery of nusinersen for older children and adults with spinal muscular atrophy and complex spinal anatomy: an analysis of 200 consecutive injections

BackgroundNusinersen is the only approved treatment for all spinal muscular atrophy (SMA) subtypes and is delivered intrathecally. Distorted spinal anatomy and instrumentation preclude standard approaches for intrathecal access, necessitating alternative...

G.P.234: A family with late-onset spinal muscular atrophy with remarkable phenotypic variability, influenced by SMN2 copy number

Spinal muscular atrophy (SMA) is a heterogeneous neuromuscular disease of progressive degeneration of anterior horn motor neuron due to homozygous mutation of the survival motor neuron gene (SMN1). Recently, the difference in the SMN2 copy number is considered a critical factor influencing the severity of the disease. We present 2 patients of the same family diagnosed as late onset SMA, genetically confirmed to have homozygous deletion of exon 7 and 8 in SMN1 but showed marked intra-familial variability due to difference in the SMN2 copy number variation. A 43-year old female patient presented with progressive proximal limb weakness which started during high school but did not deteriorate until her age of 40. She visited our clinic at the age of 43 when she started to have difficulty in hiking. Her elder brother was also affected but remarkably more severe in weakness. He had running difficulties during high school but his limb weakness significantly deteriorated to lose independent ambulation since late teen. After nerve conduction study, needle electromyography, muscle imaging and genetic studies, SMN1 revealed the deletion of exon 7 and 8 to make genetic diagnosis of late onset type III SMA. We also measured copy number of SMN2 by MLPA method. Interestingly, SMN2 copy number inversely matched with the severity showing 4 copies with the proband, 3 copies with her brother. We clearly demonstrated the presence of phenotypic variability within the same family, clinically and neuro-radiologically, and it matched with the difference in SMN2 copy numbers. We suggest that SMN2 copy number may be a valuable tool to explain intra-familial variability of SMA severity, and to predict the prognosis with better precision.

Aspects of destructive and degenerative diseases of early life

The chronology of fetal and neonatal HIE In comparison to the relatively stereotypical consequences of noxious events in the mature brain, the pathology resulting from any insult, and particularly hypoxia-ischaemia, during the extended perinatal period is extraordinarily variable. This is a critical period for rapid developmental change and brain growth, with an 18-fold increase in brain weight and a multiplicity of organisational events, such as neuronal differentiation, gliogenesis and myelination occurring alongside maturational changes in tissue responses, including an optimal capacity for plasticity and repair. Against this rapidly changing background, the effects of any hypoxic-ischaemic insult are somewhat time-locked. In this overview, aspects of these pathological lesions will be considered in relation to developmental changes influencing their pathogenesis. Spinal muscular atrophy: more than the motor neuron Proximal recessively inherited spinal muscular atrophy (SMA), the second most frequently lethal genetic disorder in childhood, is characterised by progressive degeneration of bulbo-spinal lower motor neurons and concomitant skeletal muscle atrophy. The three clinical forms of childhood onset SMA [acute early onset severe type 1 Werdnig-Hoffman disease (WH), chronic intermediate type 2, and chronic mild type 3 or Kugelberg-Welander] are caused by abnormally low levels of the ubiquitous protein ‘survival of motor neuron’ (SMN) resulting from a combination of homozygous deletions or mutations of the telomeric copy of the gene SMN1 on chromosome 5q and the presence of one or more copies of SMN2, an almost identical but partially functional centromeric copy, unique to man, which may modulate the clinical phenotype. Now that we know the genetic basis, and have a genetically engineered mouse model, it is time to re-evaluate the pathology. Available morphological data in genetically proven cases is limited, but suggests that earlier pathological reports were accurate and show a wider spectrum of pathology than has generally been appreciated, particularly involving the thalamus and dorsal root ganglia. In the most severe fetal onset cases which have the lowest copy number of SMN2, neurodegenerative changes encompass many other regions suggesting differential thresholds to reduction in SMN protein level among different cell populations.

A humanized Smn gene containing the SMN2 nucleotide alteration in exon 7 mimics SMN2 splicing and the SMA disease phenotype

Proximal spinal muscular atrophy (SMA) is a neurodegenerative disease caused by low levels of the survival motor neuron (SMN) protein. In humans, SMN1 and SMN2 encode the SMN protein. In SMA patients, the SMN1 gene is lost and the remaining SMN2 gene only partially compensates. Mediated by a C>T nucleotide transition in SMN2, the inefficient recognition of exon 7 by the splicing machinery results in low levels of SMN. Because the SMN2 gene is capable of expressing SMN protein, correction of SMN2 splicing is an attractive therapeutic option. Although current mouse models of SMA characterized by Smn knock-out alleles in combination with SMN2 transgenes adequately model the disease phenotype, their complex genetics and short lifespan have hindered the development and testing of therapies aimed at SMN2 splicing correction. Here we show that the mouse and human minigenes are regulated similarly by conserved elements within in exon 7 and its downstream intron. Importantly, the C>T mutation is sufficient to induce exon 7 skipping in the mouse minigene as in the human SMN2. When the mouse Smn gene was humanized to carry the C>T mutation, keeping it under the control of the endogenous promoter, and in the natural genomic context, the resulting mice exhibit exon 7 skipping and mild adult onset SMA characterized by muscle weakness, decreased activity and an alteration of the muscle fibers size. This Smn C>T mouse represents a new model for an adult onset form of SMA (type III/IV) also know as the Kugelberg-Welander disease.

The p.P56S mutation in the VAPB gene is not due to a single founder: the first European case

To the Editor: A dominant missense mutation p.P56S in the vesicle associated membrane protein associated protein B (VAPB) gene was described in eight Brazilian families of Portuguese descent showing a wide spectrum of motor neuron diseases (MNDs) including spinal muscular atrophy (SMA) and familial amyotrophic lateral sclerosis (ALS) (ALS8) (1, 2). Haplotype analysis indicated a common ancestor with a founding event 23 generations previously, when this ancestor was still living in Portugal (3). We report the first identification of the p.P56S mutation in the VAPB gene in a non-Brazilian patient. A 43-year-old man (III-1) showed slowly progressive muscular weakness for 2 years and a family history of autosomal dominant neuromuscular disease through at least three generations (Fig 1). The patient's mother (II-1) suffered from slowly progressive muscular weakness over 30 years. No pyramidal tract signs had been observed. She was wheelchair bound 20 years after onset and died at the age of 67. The maternal grandfather (I-1) had a history of progressive muscular weakness, had died aged 57 and had six siblings. Three (I-5, I-6, I-7) suffered from muscular weakness. One cousin of the patient's mother (II-2) was diagnosed with SMA. There was no family record of Portuguese or Brazilian ancestors in at least four previous generations. All family members originated from northern Germany. Fig. 1 Family tree. Family members who are deemed affected based upon family history are marked gray. It is not known if family members I-2, I-3, I-4, I-5, I-6, I-7, and II-2 are still alive. The index patient (III-1) showed paresis of the hip flexors and extensors (Medical Research Council (MRC) grade 4/5) and fasciculations in the proximal muscles of arms, legs on both sides. Deep tendon reflexes were normal except for absent Achilles tendon reflexes. There were no pyramidal tract signs. Needle electromyography showed fasciculations and signs of chronic denervation. Nerve conduction studies of tibial nerves revealed slightly reduced amplitudes on the left. Motor evoked potentials in both tibialis anterior muscles after magnetic stimulation of the motor cortex and the lumbar roots were normal. Genomic DNA of the index case was extracted from peripheral blood and amplified using primer pairs flanking all exons and exon/intron boundaries of the VAPB gene. Amplicons were purified and sequenced directly on an ABI PRISM 310 Genetic Analyzer (PE, Applied Biosystems). The p.P56S mutation was screened in 100 German healthy controls. Haplotype analysis was performed using microsatellite markers D20S100, D20S171 and D20S173 from the ABI Prism Linkage Mapping Set kit version 2 (Applied Biosystems, Foster City, CA) as reported previously (3). The forward 5′AAGACAAGCAAAACTAAAGAACTGC3′and reverse 5′TTCCCATTACCGGTTATCCA-3′ primers were used to amplify part of 3′ UTR sequence of the tubulin beta 1 (TUBB1) gene. A polymorphism in this region was used as intrafamilial marker. Polymerase chain reaction products were analyzed using a MegaBace 1000 DNA Sequencer (Amersham Bioscience, Little Chalfont, UK). DNA from the index patient was compared to three affected individuals from three different kindreds of the Brazilian families. Sequencing revealed a heterozygous p.P56S point mutation in exon 2 of the VAPB gene. This mutation was not present in 200 German control chromosomes. Haplotype analysis revealed that this patient had a different haplotype compared to the Brazilian families (Table 1). Table 1 Haplotype comparison of the German index patient and the patients from three different Brazilian families with the p.P56S vesicle associated membrane protein associated protein B (VAPB) gene mutationa The phenotype of our index case and his mother represented late onset SMA as observed in one-third of the Brazilian patients carrying the p.P56S VAPB mutation (1). Although we cannot entirely exclude the possibility of Brazilian or Portuguese ancestors, haplotype analysis showed that our patient's mutation is not due to the same founder as in the reported Brazilian patients. Therefore, we assume that the p.P56S mutation happened in at least two independent events. Several studies failed to identify VAPB mutations in cohorts of patients with ALS (4–6)]. Mutations in the VAPB gene seem to be rare in familial MNDs. However, our case report demonstrates that the p.P56S mutation can be observed outside Brazil, and should be considered as a rare differential diagnosis in familial MNDs.