One-dimensional Nuclear Overhauser Enhancement Research Articles

Strategy for NMR metabolomic analysis of urine in mouse models of obesity— from sample collection to interpretation of acquired data

The mouse model of monosodium glutamate induced obesity was used to examine and consequently optimize the strategy for analysis of urine samples by NMR spectroscopy. A set of nineteen easily detectable metabolites typical in obesity-related studies was selected. The impact of urine collection protocol, choice of 1H NMR pulse sequence, and finally the impact of the normalization method on the detected concentration of selected metabolites were investigated. We demonstrated the crucial effect of food intake and diurnal rhythms resulting in the choice of a 24-hour fasting collection protocol as the most convenient for tracking obesity-induced increased sensitivity to fasting. It was shown that the Carr-Purcell-Meiboom-Gill (CPMG) experiment is a better alternative to one-dimensional nuclear Overhauser enhancement spectroscopy (1D-NOESY) for NMR analysis of mouse urine due to its ability to filter undesirable signals of proteins naturally present in rodent urine. Normalization to total spectral area provided comparable outcomes as did normalization to creatinine or probabilistic quotient normalization in the CPMG-based model. The optimized approach was found to be beneficial mainly for low abundant metabolites rarely monitored due to their overlap by strong protein signals.

Novel triterpenoid from Citrus aurantium L. possesses chemopreventive properties against human colon cancer cells

Potential cancer preventive constituents of sour orange ( Citrus aurantium L.) were isolated and identified from EtOAc extract of sour orange. Crude EtOAc extract was purified using silica gel column chromatography to isolate two putative bioactive compounds. The purity of the isolated compounds was analyzed by TLC and HPLC. The structures of the two compounds were identified by one-dimensional ( 1H, 13C) and two-dimensional ( 1H–H and 1H– 13C) NMR experiments as isolimonic acid and a novel compound named as ichanexic acid. Stereochemical assignment of the protons for both the compounds was made using one-dimensional nuclear Overhauser enhancement (nOe) experiments. The identified compounds were tested for the inhibition of human colon cancer cells (HT-29) proliferation, apoptosis, and on non-cancerous (COS-1 fibroblast) cells. Cell proliferation, arrest of cell growth, and induction of apoptosis were determined by MTT assay, flow cytometry, and nuclear staining methods, respectively. The MTT assay indicated that both the compounds exhibited differential inhibition at various concentrations. Significant arrest of cell growth by isolimonoic acid was noticed within 24 h of treatment on the HT-29 colon cancer cells at a concentration as low as 5.0 μM ( P = 0.005) and by ichanexic acid at 10.0 μM ( P = 0.011). None of the compounds exerted any apparent cytostatic effects on the non-cancerous COS-1 fibroblast cells. Both the compounds exerted nearly 4- to 5-fold increase in the counts of G2/M stage cells at 5 μ M indicating a potential role in the cell cycle arrest as well as possible lead structures for the development of cancer chemopreventive and therapeutic agents. To the best of our knowledge, this is the first report on isolation, identification of isolimonic acid in its native form, and compound 2 was found to a novel and identified as ichanexic acid.

Conformational analysis of the thrombin receptor agonist peptides SFLLR and SFLLR-NH2 by NMR: evidence for a cyclic bioactive conformation.

The conformational properties of the pentapeptide Ser-Phe-Leu-Leu-Arg (P5), a human thrombin receptor-derived sequence forming part of a tethered ligand which activates the thrombin receptor, and its more active amide derivative Ser-Phe-Leu-Leu-Arg-NH2 (P5-NH2), have been studied by proton NMR spectroscopy in dimethylsulfoxide. Measurements of nuclear Overhauser effects, performed using two-dimensional rotating frame nuclear Overhauser (ROESY) and one-dimensional nuclear Overhauser enhancement (NOE) spectroscopy, revealed that P5 exists mainly in an extended conformation. However, proton-proton 1D-NOEs between Phe C alpha H and Ser C alpha H Leu3 C alpha H and Leu3 NH, and Leu4 C alpha H and Leu4 NH, as well as between the Ser and Arg sidechains, also implicated a minor conformer for P5 having a curved backbone and a near-cyclic structure. In contrast to P5, measurements of NOEs and ROEs for P5-NH2 revealed a more stabilized cyclic structure which may account for its higher biological potency. Thus strong interresidue sequential NH (i)-NH (i + 1) interactions, as well as C-terminal carboxamide to N-terminal side-chain interactions, i.e., Arg CONH2 to Phe ring and Arg CONH2 to Ser C alpha/C beta beta', observed at lower levels of the ROESY spectrum, supported a curved backbone structure for SFLLR-NH2. Since the higher potency P5-NH2 analogue adopts predominantly a cyclic structure, a cyclic bioactive conformation for thrombin receptor agonist peptides is suggested.

The solution conformations of a mutant trp operator determined by n.m.r. spectroscopy

The principal conformational features of the mutant trp operator [d(CGTACTGATTAATCAGTACG)2] have been determined by n.m.r. at different temperatures. The sugar puckers were determined from J-resolved spectroscopy and high-resolution homonuclear Hartmann-Hahn spectroscopic (HOHAHA) experiments. Extensive one-dimensional nuclear-Overhauser-enhancement (NOE) data sets were acquired at 25 degrees C using irradiation times of 50, 100, 200, 300 and 500 ms to generate sufficient NOE information to determine the individual nucleotide conformations, and place limits on the local helical parameters, using multi-spin least-squares fitting and searching in conformation space with the program NUCFIT [Lane (1990) Biochim. Biophys. Acta 1049, 189-204]. The conformations of the nucleotides are well determined, and show significant sequence-dependent variation. Pyrimidine residues on average have a wider range of sugar conformations and smaller glycosidic torsion angles than purine residues. The helical parameters are in general less well determined, though clear evidence was obtained for sequence-dependent variation of the helical twist. The overall mean fractional deviation of the calculated from the observed NOEs was 0.108. The conformations of the base-pairs TAAT are temperature-dependent [Lane (1989) Biochem. J. 259, 715-724]. NOESY spectra were recorded at 10, 25 and 40 degrees C, using mixing times inversely proportional to the overall tumbling time to allow changes in the conformation to be described. A more detailed analysis was made using one-dimensional NOEs collected for nucleotides involved in the conformational transitions. There are significant temperature-dependent changes in the conformations of the central base-pairs from T9 to T13 with the largest changes in the glycosidic torsion angle occurring for A11 and A12 (up to 30 degrees). The orientation of the base-pairs T9-A12:T10-A11 also changes, with an increase in the base-pair roll and an unwinding of the helix as the temperature is increased. The conformational changes are qualitatively similar to those observed in a related sequence (Lefèvre, Lane & Jardetzky (1988) Biochemistry 27, 1086-1094]. The conformation is also similar to the wild-type sequence and to that observed in the crystal state in the complex with the trp holorepressor. The similarity suggests that the mutation produces a poorer operator by virtue of removal of essential functional groups within the major groove.

The determination of the conformational properties of nucleic acids in solution from NMR data

A program, NUCFIT, has been written for simulating the effects of conformational averaging on nuclear Overhauser enhancement (NOE) intensities for the spin systems found in nucleic acids. Arbitrary structures can be generated, and the NOE time courses can be calculated for truncated one-dimensional NOEs, two-dimensional NOE and rotating frame NOE spectroscopy (NOESY and ROESY) experiments. Both isotropic and anisotropic molecular rotation can be treated, using Woessner's formalism (J. Chem. Phys. (1962) 37, 647–654). The effects of slow conformational averaging are simulated by taking population-weighted means of the conformations present. Rapid motions are allowed for by using order parameters which can be supplied by the user, or calculated for specific motional models using the formalism of Tropp (J. Chem. Phys. (1980) 72, 6035–6043). NOE time courses have been simulated for a wide variety of conformations and used to determine the quality of structure determinations using NMR data for nucleic acids. The program also allows grid-searching with least-squares fitting of structures to experimental data, including the effects of spin-diffusion, conformational averaging and rapid internal motions. The effects of variation of intra and internucleotide conformational parameters on NOE intensities has been systematically explored. It is found that (i) the conformation of nucleotides is well determined by realistic NOE data sets, (ii) some of the helical parameters, particularly the base pair roll, are poorly determined even for extensive, noise-free data sets, (iii) conformational averaging of the sugars by pseudorotation has at most second-order influence on the determination of other parameters and (iv) averaging about the glycosidic torsion bond also has, in most cases, an insignificant effect on the determination of the conformation of nucleotides.

ChemInform Abstract: Synthetic Oligosaccharides Related to Group B Streptococcal Polysaccharides. The Rhamnotriose Moiety of the Common Antigen.

AbstractControlled acetolysis of the pyranoside (I) yields the derivative (II), which reacts with (I) to give the disaccharide (III).

Synthetic oligosaccharides related to Group B streptococcal polysaccharides. The rhamnotriose moiety of the common antigen

The methyl glycoside (1) of the α-L-Rhap-(1 → 2)-α-L-Rhap-(1 → 2)-α-L-Rhap-(1 → portion of the group-specific, common antigen polysaccharide of Group B Streptococci has been synthesized. The key compound of the synthesis was methyl 3,4-di-O-benzyl-α-L-rhamnopyranoside (4). Controlled acetolysis of 4 gave 1,2-di-O-acetyl-3,4-di-O-benzyl-α-L-rhamnopyranose (10), which upon reaction with 4 under catalysis by trimethylsilyl trifluoromethanesulfonate (TMS-Tf) yielded the α-(1 → 2)-linked dirhamnoside. Subsequent rhamnosylation followed by deprotection gave 1. TMS-Tf was also used in rhamnosylation reactions with tetra-O-acetyl-α-L-rhamnopyranose. Acetylation of acceptor alcohols was found to be a major side reaction in the TMS-Tf assisted glycosylations. One-dimensional nuclear Overhauser enhancement differential spectroscopy indicated that, in solution, 1 takes up a bent instead of an extended conformation.

Conformation of the ATP binding peptide in actin revealed by proton NMR spectroscopy.

The actin peptide 106-124 exists in a completely conserved region of the sequence and binds strongly to both ATP and tripolyphosphate. Binding particularly affects residues 116 and 118 and generally affects the two segments 115-118 and 121-124 [Barden, J. A., & Kemp, B. E. (1987) Biochemistry 26, 1471-1478]. One-dimensional nuclear Overhauser enhancement difference spectroscopy was used to detect molecular interactions between both adjacent and nonadjacent residues. The N-terminal segment 106-112 was found to be largely extended. A sharp bend was detected between Pro-112 and Lys-113. The triphosphate moiety binds to the strongly hydrophilic central segment of the peptide. Evidence was obtained for a reverse turn involving residues 121-124. Amide proton temperature coefficients and coupling constants provide evidence for a type I beta-turn. A model of the ATP binding site is proposed together with its relationship to other parts of the actin structure and to the phalloidin binding site.

NMR of a synthetic peptide spanning the triphosphate binding site of adenosine 5'-triphosphate in actin.

The amino acid residues 114-118 in actin were found to be implicated strongly in the binding of nucleotide, and as would be expected for such an important binding site, they are located in a completely conserved region of the actin sequence. A 19-residue peptide with the actin sequence 106-124 was synthesized in order to span the putative triphosphate binding site. Proton NMR spectra of the actin peptide 114-118 in the presence and absence of ATP indicated that Arg-116 and Lys-118 are particularly involved in binding ATP. A strong binding of ATP to the peptide 106-124 also was measured. Tripolyphosphate bound to the peptide 106-124 somewhat more weakly than ATP. Binding involved residues 115-118 and 121-124, indicating the presence of a reverse turn between these segments. Proton resonances were assigned by using two-dimensional double quantum correlated spectroscopy, one-dimensional spin decoupling techniques, one-dimensional nuclear Overhauser enhancement difference spectroscopy, and pH titration. The alpha CH resonances of Ala-3 and Asn-6 are markedly shifted downfield with respect to values in small unstructured peptides due to their close proximity to the side chains of Pro-4 and Pro-7, respectively. Several other resonances display chemical shifts which are indicative of a structured environment. Assignment of the amide proton resonances in H2O and measurements of the coupling constant 3JHNCH and the chemical shifts of the amide protons reveal that much of the synthetic peptide, particularly the backbone, exhibits a highly structured environment and represents a good model for the triphosphate binding site in actin.

NMR studies of the interaction of chromomycin A3 with small DNA duplexes I.

1H and 31P NMR spectral analysis of a chromomycin/d(ATGCAT)2 complex provides strong evidence for a nonintercalative mode of drug binding. Investigation of the imino proton region of the duplex suggests a protection of one of the two guanine imino protons from fast exchange with the bulk water up to at least 45 degrees C by the drug. Subsequent one-dimensional nuclear Overhauser enhancement experiments place the exchangeable chromomycin chromophoric hydroxyl proton less than 0.45 nm from this guanine imino proton and the chromophore 7-methyl less than 0.45 from the internal thymine 6-proton and/or the guanine 8-proton. 1H two-dimensional NMR reveals that the duplex retains a right-handed B conformation but there are distortions at the TGC region of one chain and large deviations in the chemical shift of protons relative to the uncomplexed duplex in the other chain in the same TGC region. The data suggest that the chromomycin chromophore is oriented such that the hydrophilic side of the ring system is proximal to the helix center in the major groove near the TG region while the aromatic side of the ring is oriented away from the helix but is partially protected from the solvent by the aliphatic chain, which bends back over the two aromatic protons. Changes in the 31P spectrum of the duplex on binding of the drug are different from the effect of either actinomycin or netropsin on nucleic acid fragments.

Assignment of resonances in the 1H NMR spectrum of human lysozyme.

Assignments in the 1H NMR spectrum for more than 120 resonances arising from 38 of the 130 amino acid residues of human lysozyme are presented. Assignments have been achieved using a combination of one and two-dimensional NMR techniques. Two-dimensional double-quantum correlated spectroscopy and relayed coherence transfer spectroscopy were found to be particularly useful for the identification of spin systems in the aromatic and methyl regions of the spectrum. These spin systems were assigned to specific residues in human lysozyme with reference to the X-ray crystal structure using one-dimensional nuclear Overhauser enhancement (NOE) data and a computer-based search procedure. Unique assignments were found for resonances of 27 amino acid residues even when a distance constraint on NOE effects of 0.7 nm was used in the search procedure; for the remaining residues closer constraints or additional information were required. The assignments include all but one of the resonances in the aromatic region of the spectrum and all the methyl group resonances in the region upfield of 0.6 ppm. The assignments presented here provide a basis for a comparison of the NMR spectra of human lysozyme and the more widely studied hen lysozyme.

Consequences of methylation on the amino group of adenine. A proton two-dimensional NMR study of d(GGATATCC) and d(GGm6ATATCC).

A two-dimensional 500-MHz 1H-NMR study of two oligonucleotides, d(GGATATCC) and d(GGm6ATATCC), is presented in which we have investigated the effects of adenine methylation. The two-dimensional nuclear Overhauser spectra (NOESY) show that both oligonucleotides adopt a normal right-handed B-type helix and one-dimensional nuclear Overhauser enhancement (NOE) studies demonstrate that any difference in conformation must be small. However methylation drastically slows down the helix in equilibrium coil exchange which becomes slow on a proton NMR time scale. While d(GGATATCC) fits a two-site exchange model, d(GGm6ATATCC) does not and we invoke the presence of a third species which may be an intermediate in helix formation. NMR and ultraviolet spectroscopy show that methylation destabilizes the helix, measured by the melting temperature and enthalpy of dissociation.

Imino-proton resonances of yeast tRNAPhe studied by two-dimensional nuclear Overhauser enhancement spectroscopy.

Application of two-dimensional nuclear Overhauser enhancement (NOE) spectroscopy to yeast tRNAPhe in H2O solution demonstrates that all imino-proton resonances, related to the secondary structure, and nearly all imino proton resonances, originating from the tertiary structure, can be assigned efficiently by this method. The results corroborate the assignments of the imino-proton resonances of this tRNA as established previously by one-dimensional NOE experiments (only the assignment of base pairs G1 X C72 and C2 X G71 should be reversed). The advantages of two-dimensional NOE spectroscopy over one-dimensional NOE spectroscopy for the assignments of imino-proton resonances and the structure elucidation of tRNA are illustrated and discussed. Furthermore, the use of non-exchangeable proton resonances as probes of the molecular structure is explored.