Oligospermic Men Research Articles

Evaluation of protamine 2 genes in spermatozoa of teratospermic and oligospermic men in Nigeria

There have been several reports of single nucleotide polymorphisms (SNPs) linked to different kinds of male infertility. The aim of the study was to evaluate single nucleotide polymorphisms in protamine 2 gene (PRM2) in spermatozoa of teratospermic and oligospermic infertile men in Nigeria. At some fertility clinics in Lagos, Nigeria, twenty-two (22) teratospermic and thirty-five (35) oligospermic infertile men as well as thirty (35) normospermic fertile men (control) who volunteered and gave consent were recruited for the cross-section study after meeting the inclusion criteria and confirmation of their fertility statuses by the use of computer-Assisted Sperm Analyzer (CASA). Semen was collected from the participants under the WHO guideline for semen collection and processing. Spermatozoa’s DNA was extracted with the use of Proteinase K Storage Buffer. Nanodrop 1000 spectrophotometer was used to quantify the isolated genomic DNA. PRM II F: 5-AGGGCCCTGCTAGTTGTGA-3' and PRM II R: 3'- CAGATCTTGTGGGCTTCTCG -5, were used as primers. Sequencing of sperm DNA was done using the BigDye Terminator kit on a 3510 ABI sequencer by Inqaba Biotechnological, Pretoria South Africa. Agarose gel electrophoresis was used to show the amplified PRM2. In the study, 7 SNPs in the teratospermic infertile men, 8 SNPs in the oligospermic infertile men and 7 SNPs in the normospermic fertile men were discovered. The SNPs between the teratospermic infertile men and the oligospermic infertile men are significantly different. We propose that considerably larger genome-wide investigations are required to confidently validate these SNPs and find new SNPs linked with male infertility.

Idiopathic secondary azoospermia occurrence in men with oligospermia over time.

To investigate the occurrence of idiopathic secondary azoospermia (ISA) in men with oligospermia over time and identify risk factors for ISA in this population. This was a retrospective cohort study conducted in a university-affiliated male infertility clinic. A total of 1056 oligospermic men (concentration < 15 million/ml (M/ml) and no azoospermia) with at least two SA done between 2000 and 2019 were included. The primary outcome was the occurrence of ISA by oligospermia severity. In the entire cohort, 31 patients (2.9%) eventually became azoospermic with time. The ≤ 1M/ml extremely severe oligospermia (ESO) group (283 patients) had significantly higher rates of ISA in each time period compared to the 1-5M/ml severe oligospermia (SO) (310 patients) and 5-15M/ml mild oligospermia (MO) (463 patients) groups (p < 0.05 for all comparisons), with rates of 21.1% in the ESO, 4.8% in the SO, and 0% in the MO group (p = 0.02) after 3-5years, reaching 32% after 5years in the ESO group compared to no cases in the other two groups (p = 0.006). Parameters shown to predict ISA were initial concentration < 1M/ml (OR 22.12, p < 0.001) and time interval of > 3 and 5years (OR 4.83 and 6.84, p = 0.009 and < 0.001, respectively), whereas testosterone levels were negatively associated with ISA (OR 0.88, p = 0.03). Men with ≤ 1M/ml, especially those with low testosterone levels, have a dramatically increased chance of becoming azoospermic with time. Therefore, sperm banking should be recommended in these cases. Men with a sperm concentration above 1M/ml have low chances of becoming azoospermic, even after 3 or more years.

Elucidating the impact of Y chromosome microdeletions and altered gene expression on male fertility in assisted reproduction.

Genetic abnormalities like Y chromosome microdeletions are implicated in male infertility. This study investigated the association of azoospermia factor (AZF) region microdeletions with unsuccessful assisted reproductive techniques (ART), including in vitro fertilization (IVF) and intracytoplasmic sperm injection (ICSI). This cross-sectional analysis study examined 80 Iranian oligospermic men (mean age 34years) with prior failed ICSI and IVF cycles (IR.IAU.TNB.REC.1401.041). Semen analysis evaluated quantity/quality parameters based on World Health Organization guidelines. Participants were stratified by sperm DNA fragmentation (SDF) levels into: control (SDF < 15%, n = 20), mild elevation (15% ≤ SDF ≤ 30%, n = 60), and high (SDF > 30%, n = 20). Multiplex PCR mapped AZF microdeletions in the high SDF group. The AZF-associated genes were selected by RNA Seq analysis, and the candidate genes were checked for expression level by real-time PCR. High SDF individuals exhibited poorer semen metrics, including 69% lower sperm concentration (P = 0.04) than those without SDF. Of this subset, 45% (9/20 men) harboured predominately AZF microdeletions. Men with AZF microdeletions showed higher SDF (32% vs 21%, P = 0.02) and altered AZF-associated genes expression. As USP9Y 3-fold, UTY 1.3-fold, and BPY2 1-fold revealed up-regulation, while IQCF1 8-fold, CDY 6.5-fold, DAZ 6-fold, and DDX3Y 1-fold underwent down-regulation. The PAWP gene was also down-regulated (5.7-fold, P = 0.029) in the IVF/ICSI failure group. AZF microdeletions significantly impact male infertility and ART outcomes. High SDF individuals exhibited poorer semen metrics, with 45% AZF microdeletions. These microdeletions altered AZF-associated genes expression, affecting fertility mediator PAWP independently. Dual AZF and SDF screening enables personalized management in severe male infertility, potentially explaining IVF/ICSI failures.

Optimization of Multiplex-PCR Technique To Determine Azf Deletions in infertility Male Patients.

To optimize the multiplex polymerase chain reaction (M-PCR) technique to diagnose microdeletions of azoospermia factors (AZF) on the Y chromosome and initially apply the technique to diagnose male patients with sperm density less than 5×106 million sperm/mL was assigned to do a test to check for AZF microdeletions on the Y chromosome. Based on the positive control samples which belong to male subjects who have had 2 healthy children without any assisted reproductive technologies, the M-PCR method was developed to detect simultaneously and accurately AZF microdeletions on 32 male patients with sperm densities below 5×106 million sperm/mL of semen at the Department of Biology and Medical Genetics - Vietnam Military Medical University. Successful optimization of the M-PCR technique including 7 reactions arranged according to each AZFabc region using 24 STS/gene on the Y chromosome. Initial application to diagnose AZF deletion on 32 azoospermic and oligospermic men reveals that AZFa deletion accounts for 6.25% (2/32); deletion of all 3 regions AZFa,b,c with 18.75% (6/32 cases); The combined deletion rate of AZFb,c is highest, accounting for 56.24% (18/32 patients). Successfully optimized the M-PCR technique in identifying AZF microdeletions using 24 sequence tagged sites (STS)/gene for azoospermic and oligozoospermic men. The M-PCR technique has great potential in the application of AZF deletion diagnosis.

Reduced SIRT1 and SIRT3 and Lower Antioxidant Capacity of Seminal Plasma Is Associated with Shorter Sperm Telomere Length in Oligospermic Men.

Infertility affects millions of couples worldwide and has a profound impact not only on their families, but also on communities. Telomere attrition has been associated with infertility, DNA damage and fragmentation. Oxidative stress has been shown to affect sperm DNA integrity and telomere length. Sirtuins such as SIRT1 and SIRT3 are involved in aging and oxidative stress response. The aim of the present study is to determine the role of SIRT1 and SIRT3 in regulating oxidative stress, telomere shortening, and their association with oligospermia. Therefore, we assessed the protein levels of SIRT1 and SIRT3, total antioxidant capacity (TAC), superoxide dismutase (SOD), malondialdehyde (MDA) and catalase activity (CAT) in the seminal plasma of 272 patients with oligospermia and 251 fertile men. We also measured sperm telomere length (STL) and leukocyte telomere length (LTL) using a standard real-time quantitative PCR assay. Sperm chromatin and protamine deficiency were also measured as per standard methods. Our results for oligospermic patients demonstrate significant reductions in semen parameters, shorter STL and LTL, lower levels of SOD, TAC, CAT, SIRT1 and SIRT3 levels, and also significant protamine deficiency and higher levels of MDA and DNA fragmentation. We conclude that a shorter TL in sperms and leukocytes is associated with increased oxidative stress that also accounts for high levels of DNA fragmentation in sperms. Our results support the hypothesis that various sperm parameters in the state of oligospermia are associated with or caused by reduced levels of SIRT1 and SIRT3 proteins.

Molecular genetic analysis of 1,980cases of male infertility.

The present study aimed to investigate the occurrence of chromosomal karyotype abnormalities and azoospermia factor (AZF) microdeletion on the long arm of the Y chromosome (Yq) in infertile men, and to determine their association with infertility to ultimately improve clinical outcomes in these patients. A total of 1,980 azoospermic and oligospermic men from the outpatient department of the Fujian Maternity and Child Health Hospital (Fuzhou, China) were recruited between January 2016 and December 2019. Peripheral blood was used for karyotype analysis; AZF microdeletion analysis of the Yq was performed using capillary electrophoresis. Among the 1,980 patients, 178 had chromosomal abnormalities (9.0%; 178/1,980), of whom 98 had an abnormal number of chromosomes. Among the abnormal karyotypes, the most common was 47, XXY (80/178; 44.9%). AZF microdeletion on the Yq occurred at a rate of 10.66% (211/1,980); the most common type was the AZFb/c deletion (sY1192; 140/211; 66.4%). The present findings showed that karyotype abnormalities and AZF gene microdeletion are important drivers of male infertility. Specifically, men with Yqh- and del(Y)(q11) had a higher risk of AZF microdeletion. These results suggested that patient treatment could be personalized based on routine molecular genetic analysis, which could further alleviate the economic and emotional burden of undergoing redundant or ineffective treatments.

The Effects of Medium-Term Intake of Hydrogen-Rich Water on Sperm Quality Biomarkers in Normospermic and Oligospermic Men: A Randomized Controlled Pilot Trial

The main aim of this randomized controlled pilot trial was to evaluate the effects of hydrogen-rich water on spermiogram parameters in normospermic and oligospermic men. As many as 12 healthy young men (age 29.1 ± 5.9 years; n = 6 normospermic; n = 6 oligospermic) volunteered. Participants were allocated in a double-blind manner to receive 1 L of hydrogen-rich water per day or 1 L of tap water fortified with magnesium for 8 weeks. Following hydrogen-rich water supplementation, sperm concentration and morphology tended to increase by 12.4 million per milliliter (95% CI; –31.8 to 56.6), and live cells increased by 3.8% (95% CI; –12.5 to 20.1), respectively (P ≤ 0.30). A significant difference between the two interventions was found in sperm vitality (P = 0.03), with hydrogen-rich water being superior to the placebo in terms of an increase in the number of live sperm cells. Subgroup analyses revealed no significant differences between interventions in sperm viability outcomes in oligospermic men (P &gt; 0.05). However, sperm count increased by over 20 million in two of the three oligospermic men (66.7%) receiving hydrogen-rich water, while no oligospermic men in the placebo group increased sperm concentration to euspermic levels (P &lt; 0.01). These preliminary findings suggest hydrogen-rich water is an effective intervention for improving some aspects of male subfertility; further large-sample trials are warranted to corroborate our results.

Impact of Seasonal Variations on Semen Parameters: A Retrospective Analysis of Data from Subjects Attending a Tertiary Care Fertility Centre.

Seasonal variations in semen parameters have been detected in many previous studies, mostly conducted in the West and Mediterranean countries. Located in a tropical region, we have only three seasons - summer, winter and rainy season. Literature search did not reveal studies from Indian subcontinent. Our objective was to find if our climate produced seasonal variations in semen parameters such as sperm concentration (SC), total motile SC, morphology and vitality, which may have implications in fertility management. This is a descriptive study, conducted at a tertiary level hospital. Semen analysis reports of male partners of all infertile couples during the 4-year period from 2019 to 2022 were analysed. The data were collected from records of all infertile couples registered for the treatment in the department during the study period. Semen analysis reports of male partners of all infertile couples attending outpatient department of the Reproductive Medicine Department during the 4-year period from January 2019 to December 2022 were collected. The data of azoospermic and severe oligospermic (<5 million/mL) men and those receiving hormone treatment were excluded. Data were analysed using SPSS 23 and variables expressed as mean and standard deviation. Changes in mean values over years and over seasons were evaluated using F-test. Post hoc analysis was done using Sidak method. P < 5% was considered statistically significant. The data of 2326 patients were analysed. SC was lowest during summer but was not statistically significant. Sluggishly motile sperm per cent was maximum in rainy season (P = 0.002). Post hoc analysis showed significant variations in summer samples compared to both rainy and winter seasons. Head defect (HD) and tail defects showed a significant seasonal variation (P = 0.011 and P = 0.024, respectively), lowest HD seen in rainy season. Semen parameters showed seasonal variations, with favourable features in colder climates, and may need to be considered in infertility management, especially if the male is oligospermic.

PD39-01 A DNA METHYLATION SIGNATURE TO PATERNAL GERMLINE AGE AND ASSOCIATION WITH INFERTILITY

You have accessJournal of UrologyInfertility: Basic Research & Pathophysiology (PD39)1 Sep 2021PD39-01 A DNA METHYLATION SIGNATURE TO PATERNAL GERMLINE AGE AND ASSOCIATION WITH INFERTILITY Kristin Brogaard, Ryan Miller, Bryce Daines, John Sullivan, Kevin Campbell, and Larry Lipshultz Kristin BrogaardKristin Brogaard More articles by this author , Ryan MillerRyan Miller More articles by this author , Bryce DainesBryce Daines More articles by this author , John SullivanJohn Sullivan More articles by this author , Kevin CampbellKevin Campbell More articles by this author , and Larry LipshultzLarry Lipshultz More articles by this author View All Author Informationhttps://doi.org/10.1097/JU.0000000000002049.01AboutPDF ToolsAdd to favoritesDownload CitationsTrack CitationsPermissionsReprints ShareFacebookLinked InTwitterEmail Abstract INTRODUCTION AND OBJECTIVE: Epigenetic studies have highlighted the relationship between lifestyle and fertility, including effects of alcohol, smoking, and obesity on DNA methylation profiles within germ cells. We have shown that altered epigenetics have been associated with non-chronological, accelerated sperm aging and reproductive failure. Here we compare the association of chronological and biological sperm age in male patients being treated for reproductive failure. METHODS: DNA methylation from 60 sperm samples was measured using methylation arrays and targeted methylation sequencing. Semen parameters, hormones, medications, health history, fertility treatments and outcomes were provided for each sample. A published machine learning linear regression model capable of predicting biological sperm age with an R2 of 0.89 was then applied to the data. Associations between biological sperm age, chronological age, fertility biomarkers, and comorbidities were examined using supervised and unsupervised learning techniques. RESULTS: Analysis was completed on all samples; however, we chose to sub-stratify samples from patients that were treated with FSH, HCG, anastrozole, or had history of testosterone use. By initially examining oligospermic men considered “truly infertile”, associations were seen between predicted sperm age and semen parameters associated with infertility. The predicted sperm age was observed to be negatively correlated with testosterone levels (R=-0.3) as well as with the % sperm motility (R=-0.31). Higher predicted sperm age was also observed in patients with a high body mass index (BMI) (R=0.5), a factor associated with male infertility. Biological sperm age was more highly correlated with % motility and BMI than chronological age at collection (R=-0.27, R=0.23 respectively). Expanding the sample set to all untreated patients, we still observed a negative correlation between epigenetic sperm age and % motility (R=-0.2), and testosterone (R=-0.2), but the correlations were less pronounced. We also found a statistically significant correlation between hyper-accelerated aging of epigenetic sperm and Cardiovascular risk (p=0.02). CONCLUSIONS: We observed associations between epigenetically-determined sperm age with both semen parameters and BMI. This finding provides further evidence that environmental and epigenetic factors contribute to the health of sperm. If replicated, this use of epigenetic profiling to predict sperm health will become a useful tool in informing discussions with patients regarding the impact of lifestyle and paternal preconception health on fertility success. Source of Funding: None © 2021 by American Urological Association Education and Research, Inc.FiguresReferencesRelatedDetails Volume 206Issue Supplement 3September 2021Page: e668-e668 Advertisement Copyright & Permissions© 2021 by American Urological Association Education and Research, Inc.MetricsAuthor Information Kristin Brogaard More articles by this author Ryan Miller More articles by this author Bryce Daines More articles by this author John Sullivan More articles by this author Kevin Campbell More articles by this author Larry Lipshultz More articles by this author Expand All Advertisement Loading ...

P–092 The more, the merrier: does ejaculatory frequency influence seminal parameters in oligospermic men?

Abstract Study question Does ejaculatory frequency during the three months preceding semen collection influence semen parameters in oligospermic men? Summary answer A frequency of 2–3 ejaculations/week during the three months preceding semen collection significantly optimizes sperm motility, without any reduction in sperm concentration. What is known already Male gametes undergo crucial physiological and biochemical changes during epididymal transit, but a longer storage is known to have negative effects on semen quality, especially on motility. Previous studies focused on abstinence prior to semen collection, while few data are available on the effect of ejaculation frequency. On one hand, a longer storage could increase exposure to reactive oxygen species and a pro-inflammatory environment, with a reduction in vitality and motility. On the other, an increased ejaculation frequency could cause a reduction in sperm volume and concentration. The effects of ejaculatory frequency are particularly understudied in men with oligospermia. Study design, size, duration This is a retrospective study performed at a tertiary level public infertility center. We included all semen samples, collected both for diagnostic purposes and ART cycles between September 2019 and September 2020, with a sperm concentration of 15 million/ml or less, and an abstinence of 3- 5 days. Exclusion criteria were surgically collected or collected for fertility preservation semen samples. Participants/materials, setting, methods Standard demographic and clinical data were recorded, as well as semen parameters. Ejaculation frequency was considered “optimal” (at least 2–3/week) or “reduced” (&amp;lt;1/week). The potential predictive role of ejaculation frequency, age, BMI, smoking habits, previous cryptorchidism, varicocele, days of abstinence on semen parameters was evaluated by univariate and then by multivariate analysis for all factors significant in the univariate models. P &amp;lt; 0.05 was considered statistically significant. Main results and the role of chance: Out of 738 men, 491 reported an optimal ejaculation frequency, 247 had &amp;lt;1 ejaculation/week, no one reported everyday ejaculations. Total sperm mobility (35.91±22.84% vs. 32.28±16.91%, p = 0.02) and sperm rapid progressive motility (5.56±6.09% vs. 4.20±6.1%, p = 0.006) were significantly higher in the group with optimal ejaculation frequency. Ejaculation frequency remained predictive of total mobility (p = 0.04) and rapid progressive mobility (p = 0.03) in a multivariate linear regression model with age and sperm concentration. Sperm volume (2.92±1.56 ml vs. 2.91±1.54 ml, p=NS) and concentration (5.74±5.05 mil/ml vs. 6.05±4.78 mil/ml, p=NS) did not significantly differ depending on the declared ejaculation frequency. Limitations, reasons for caution The study is retrospective and ejaculatory frequency was self-reported as an estimate of the mean of the number of ejaculations per week. Wider implications of the findings: Optimizing ejaculatory frequency may improve ART outcomes as well as success of spontaneous conceptions. There is no reason to limit ejaculatory frequency in oligospermic men for a hypothesized benefic in sperm concentration. Trial registration number Not applicable

The Effect of L-Carnitine and Coenzyme Q10 on the Sperm Motility, DNA Fragmentation, Chromatin Structure and Oxygen Free Radicals During, before and after Freezing in Oligospermia Men.

The aim of the presentstudyis to assess the effect of L-carnitine and Coenzyme Q10 (CoQ10) on human sperm motility, DNA fragmentation, chromatin structure, and reactive oxygen species (ROS) during, before and after freezing in oligospermia men. Semen was collected from 30 oligospermic men, who referred to infertility clinic of Beasat Hospital in Sanandaj, Iran. The samples of each individual were divided into 8 equal parts: 1. control group before freezing; 2. incubated with L-carnitine; 3. incubated with coenzyme Q10; 4. incubated with the combination of L-carnitine + CoQ10; 5. control freezing group; 6. the experimental freezing group with L-carnitine; 7. the experimental freezing group with coenzyme Q10 and 8. the experimental freezing with the combination of L-c + CoQ10. Sperm motility was assessed by WET MOUNT method. DNA fragmentation was evaluated by SCD (Sperm Chromatin Desperation), ROS, was evaluated by quantitative fluorescence reaction, and chromatin deficiency was determined by chromatin staining (CMA3). Antioxidant treatments, significantly reduced the number of ROS + in the pre and post freezing groups. Significant improvement was seen in the sperm motility of class B in the pre freezing groups with L-carnitine. Antioxidants also reduced the percentage of DNA fragmentation and protamine deficiency in pre-and post-freezing. Addition of Coq10 and L-carnitine to human sperm medium significantly reduced the number of ROS. This reduction in ROS reduced sperm damage during cryopreservation.

Current Status of Y Chromosome Microdeletions: Prevalence, Distribution, Implication and Association with Male Infertility in Indian Men- A Review

Introduction: Infertility affects about 15% of couples attempting pregnancy and in approximately 50% of these cases, male factors are responsible. Male infertility is clinically characterised by azoospermia and oligozoospermia depending on the amount of loss of genetic material and the size of the affected region on the Y Chromosome Microdeletions (YCM). The majority of genes located in the Y chromosome are involved in male related functions such as spermatogenesis in human, in addition to other endocrine and physiological factors. These microdeletions are located on q arm of Y chromosome, specifically Azoospermia Factor (AZF) region, hence called Yq microdeletions. These deletions are in form of complete/ incomplete, recombination; mutations and Copy Number Variations (CNV) and vary in frequency depending on region, ethnicity, lifestyles and other epigenetic factors. Hence, this study is well reviewed in Indian men with infertility caused by AZF a,b,c and other partial deletions. So, it is important to the one who is affected by these mutations and infertile couples who adopt Assisted Reproductive Technologies (ARTs) after counseling. It is further useful for prediction of testicular sperm retrieval chances. Aim: To review the current status of Yq microdeletion frequency in infertile Indian men with the available data and their correlation with testicular phenotypes as well as other factors. These would also reckon as a supportive to other clinical findings for diagnosis of specific deletion of infertility to adopt ARTs to the infertile couple. Materials and Methods: Various studies including our data were collected to European Molecular Genetics Quality Network (EMQN) as well as analyse these Yq microdeletions screened using specific Sequence Tagged Sites (STS) of available kit like European Academy of Andrology (EAA) and non-EAAs using Polymerase Chain Reaction (PCR) technology. Various researchers from various zones of India contributed to microdeletion screening of Y chromosome using various STS to AZF locus. These data from 30 study groups were compared to geographical areas/zones, Indian populations, environment, selection criteria and other factors in this review. Results: The data on thousands of Y chromosome analysis confirmed that the frequency of microdeletions are affected by sample size, selection criteria of subjects, different geographical regions, ethnicity, Oxidative Stress (OS), Deoxyribonucleic Acid (DNA) fragmentation and food styles in addition to genetic defects. In Indian subcontinent, these deletions contribute to 8.33% from screening of 5435 Y chromosomes (453/5435). Lower percent (5.37%) of Yq microdeletions in Western India than other parts was observed, being highest in South East (20.52%) and North East zones (17.77%) as mentioned in the present study. These variations in Yq microdeletions are attributed to geographic region, foodstyle, other environmental factors and others. AZFc deletions were more prevalent and correlated to azoospermia (referred/ selected, 66%; deleted 61%) from 30/15 citations respectively in present cohort over oligospermic and/or severe oligospermic men followed by b and a sub-regions including b+c, a+b and others in AZF locus. Amongst 30 study groups, 27 exhibited AZFc deletions at higher rate. Conclusion: From these data in India, it was hence noticed that screening of Yq microdeletion is an important criterion and its correlation with spermeograms is very necessary to infer degree of infertility in men. Such cases are strongly suggested to undergo genetic counselling before adoption of ARTS as deletions increase risk of genetic anomalies, low birth weight and congenital malformations in New Births (NB) of Intracytoplasmic Sperm Injection and Testicular Sperm Ejaculates (ICSI/TESE) adopted cases. Thus, Y deletion evaluation reckons the diagnosis of type of male infertility and its prevention in the next generation propagation through ARTs adopting infertile couples after counselling.

Genetic counseling prior to assisted reproductive technology.

BackgroundReproductive medicine deals with fertility and is closely related to heredity. In reproductive medicine, it is necessary to provide genetic information for the patients prior to assisted reproductive technology (ART). Japan Society for Reproductive Medicine (JSRM) requires doctors involved in reproductive medicine to have standard knowledge of reproductive genetics and knowledge of reproductive medicine, which is covered in their publication, “required knowledge of reproductive medicine.”MethodsWith the aim of providing straightforward explanations to patients in the clinical situation at pre‐ART counseling, we provide the following five topics, such as (a) risk of birth defects in children born with ART, (b) chromosomal abnormalities, (c) Y chromosome microdeletions (YCMs), (d) possible chromosomal abnormal pregnancy in oligospermatozoa requiring ICSI (intracytoplasmic sperm injection), and (e) epigenetic alterations.Main findingsThe frequency of chromosome abnormalities in infertile patients is 0.595%‐0.64%. YCMs are observed in 2%‐10% of severe oligospermic men. High incidence of spermatozoa with chromosomal abnormalities has been reported in advanced oligospermia and asthenozoospermia that require ICSI. Some epigenetic alterations were reported in the children born with ART.ConclusionCertain genetic knowledge is important for professionals involved in reproductive medicine, even if they are not genetic experts.

A NEW METHOD FOR ACCURATE PREDICTION OF SPERMATOGENESIS: FSH/T AND T IN SEMINAL PLASMA

A NEW METHOD FOR ACCURATE PREDICTION OF SPERMATOGENESIS: FSH/T AND T IN SEMINAL PLASMA

Frequency of Y Chromosome Microdeletions in Azoospermic and Oligospermic Iranian Infertile Men

Background and Aims: Azoospermia factor (AZF) region of the Ychromosome has several genes which are responsible for normal spermatogenesis. Microdeletions of these genes are associated with azoospermia and oligospermia. These microdeletions are too small to be detected by karyotyping. They can be easily identified using polymerase chain reaction. The aim of this study is to determine the frequencies of Ychromosome microdeletions in azoospermic and oligospermic Iranian infertile men and compare them with other studies in different ethnic groups. Materials and Methods: At first, karyotype analysis was performed in 80 infertile men and 30 healthy age-matched counterparts as control group using standard cytogenetic methods. Second, genomic DNA was extracted from all cases and genetic screening was conducted for Y chromosome microdeletions by multiplex polymerase chain reaction for AZF genes on both infertile and control men using 6 STS markers on the long arm of the Y chromosome. Results: Totally, 49 infertile men were azoospermic and 31 were oligospermic. Y-chromosome microdeletions in the AZFc region were detected in 4 of azoospermic patients. Y-chromosome microdeletions was not detected in any of the oligospermic patients and the control group. Conclusions: This finding recommends that genetic counseling and screening before starting assisted reproductive techniques such as in vitro fertilisation and intracytoplasmic sperm injection can prevent unnecessary treatment and transmission of genetic defects to offspring

Genetic testing in male infertility - reassessing screening thresholds.

Genetic testing in male infertility is an essential part of the process of diagnosis. Genetic abnormalities, such as Y-chromosome microdeletion, chromosomal abnormalities and mutations for cystic fibrosis, can all negatively impact a male's fertility and can be tested for during a fertility evaluation. Both Y-chromosome microdeletion and chromosomal abnormalities increase in prevalence as sperm concentrations decrease, and azoospermic men have the greatest frequency of genetic abnormalities. These genetic abnormalities can also be found in oligospermic men; however, on the basis of several recent studies, the prevalence of genetic abnormalities is lower in oligospermic men than previously thought. The current screening thresholds are devised from the previously determined prevalences and have not been revised based on the emerging data; thus, in this review of the literature, we will discuss this new evidence and whether screening thresholds should be changed.

The effect of antioxidants on male factor infertility: the Males, Antioxidants, and Infertility (MOXI) randomized clinical trial

To determine whether antioxidants improve male fertility, as measured by semen parameters and DNA fragmentation at 3 months and pregnancy resulting in live birth after up to 6 months of treatment, among couples with male factor infertility. Multicenter, double-blind, randomized, placebo-controlled trial with an internal pilot study. Nine fertility centers in the United States from December 2015 to December2018. Men (N = 174) with sperm concentration ≤15 million/mL, motility ≤40%, normal morphology ≤4%, or DNA fragmentation >25%, and female partners who were ovulatory, ≤40 years old, and had documented tubal patency. Males randomly assigned to receive an antioxidant formulation (n = 85) containing 500 mg of vitamin C, 400 mg of vitamin E, 0.20 mg of selenium, 1,000 mg of l-carnitine, 20 mg of zinc, 1,000 μg of folic acid, 10 mg of lycopene daily, or placebo (n = 86). Treatment lasted for a minimum of 3 months and maximum of 6 months, and couples attempted to conceive naturally during the first 3 months and with clomiphene citrate with intrauterine insemination of the female partner in months 4 through6. Primary outcome was live birth; secondary outcomes included pregnancy within 6 months of treatment. For the internal pilot, the primary outcomes were semen parameters and sperm DNA fragmentation index after 3 months of treatment. In the Males, Antioxidants, and Infertility (MOXI) study, after 3 months of treatment, the change in sperm concentration differed between the antioxidant group (median -4.0 [interquartile range-12.0, 5.7] million/mL) and placebo group (+2.4 [-9.0, 15.5] million/mL). However, there were no statistically significant differences between the two groups for changes in sperm morphology, motility, or DNA fragmentation. Among the 66 oligospermic men at randomization, sperm concentration did not differ at 3 months between the antioxidant and control groups: 8.5 (4.8, 15.0) million/mL versus 15.0 (6.0, 24.0) million/mL. Of the 75 asthenospermic men, motility did not differ at 3 months: 34% ± 16.3% versus 36.4% ± 15.8%. Among the 44 men with high DNA fragmentation, DNA fragmentation did not differ at 3 months: 29.5% (21.6%, 36.5%) versus 28.0% (20.6%, 36.4%). In the entire cohort, cumulative live birth did not differ at 6 months between the antioxidant and placebo groups: 15% versus 24%. Antioxidants do not improve semen parameters or DNA integrity among men with male factor infertility. Although limited by sample size, this study suggests that antioxidant treatment of the male partner does not improve invivo pregnancy or live-birth rates. NCT02421887.

Effect of senescence on some apoptosis and oxidative stress markers in infertile normozospermic and oligospermic men: A cross-sectional study

Male senescence may affect testicular function, sperm indices and generation of high levels of oxidants and apoptosis. This study evaluates the effect of male age on the expression of some apoptosis and oxidative stress markers in seminal fluid of males investigated for infertility in a tertiary health institution in Nigeria. In this cross-sectional study, 122 men aged 20-60 yr who were investigated for infertility and were stratified according to age into four groups. Seminal plasma caspase 3, cytochrome C, and total antioxidant capacity (TAC) were assayed by ELISA technique, while manual semen analysis was performed according to WHO standard. Seminal caspase 3, and cytochrome C activity increased while TAC and sperm indices decreased with increasing age. Cytochrome C (r=0.288; p=0.002) and caspase 3 (r=0.250; p=0.05) correlated significantly with age in normospermia while cytochrome C (r=0.314; p=0.02), caspase 3 (r=0.268; p=0.05), TAC (r=-0.342; p=0.01) and morphology percentage (r=-0.414; p=0.002) correlated with age in oligospermic infertile males. The measured apoptotic markers increased with increasing age while TAC and sperm indices decreased with increasing age of subjects evaluated. Although the levels of measured apoptosis and oxidative stress markers correlated with age in normozospermia, the effect on sperm indices was severe among oligospermia compare to normozospermia. Therefore, these markers may be assayed in aged men attending fertility clinics.

Infertility evaluation and access to assisted reproductive technologies among male military veterans: analysis of the South Florida Veterans Affairs experience.

BackgroundRecent legislation extended coverage for assisted reproductive technologies (ART) to male veterans within the United States Veterans Affairs (VA) healthcare system. We sought to characterize the appropriateness of male infertility diagnosis and access to assisted reproductive technologies (ART) among men within the local VA healthcare system after passage of the new legislation.MethodsWe retrospectively identified male patients within the South Florida VA Network who underwent semen analysis (SA) or were diagnosed with infertility between January 1999 and June 2017. Men were classified by infertility diagnosis and sperm concentration/mL (normal, oligospermia <15, severe oligospermia <5 million, azoospermia). We compared the number of oligospermic men before versus after the legislation. Men who did not receive ART were characterized according to eligibility criteria of military service connection to the infertility diagnosis.ResultsSix hundred twenty-seven men underwent SA or were diagnosed with infertility. Among 474 men with SA, 206 (43.5%) were diagnosed with infertility and 268 (56.5%) were not. Additionally, 153 men received an infertility diagnosis without SA. More men had oligospermia and severe oligospermia after the legislation (1 vs. 6, 1 vs. 10). Of 10 men with severe oligospermia post-legislation, 7 did not proceed to ART consultation due to lack of military service connection to the infertility diagnosis.ConclusionsA substantial proportion of veterans with abnormal sperm concentrations were not diagnosed with infertility, while others carrying an infertility diagnosis did not undergo SA. Most patients clinically eligible for ART did not proceed with further evaluation due to lack of military service connection to their infertility diagnosis.

NFKB1 rs28362491 and pre-miRNA-146a rs2910164 SNPs on E-Cadherin expression in case of idiopathic oligospermia: A case-control study

A notable proportion of idiopathic male infertility cases is accompanied by oligozoospermia; and yet, the molecular mechanisms of fertilization problem underlying this defect are still unclear. Epithelial cadherin has been involved in several calcium-dependent cell-to-cell adhesion events; however, its participation in gamete interaction has also not been fully investigated. The aim was to investigate the changes in the expression of E-cadherin, based on the frequency of Single nucleotide polymorphisms in Nuclear Factor Kappa-B 1 and pre-mir-146a in oligospermic men. In this case-control study, semen and blood samples of 131 oligospermic men as the case group and 239 fertile healthy men as the control group were analyzed. Variants single nucleotide polymorphisms rs28362491 and rs2910164 were performed using polymerase chain reaction-restriction fragment length polymorphism method and E-cadherin expression were determined by immunoprecipitation studies. ins/ins genotype of rs28362491 was determined as a risk factor for idiopathic oligospermia by 1.73 times (p=0.0218), whereas no significant differences were found between the groups concerning pre-mir-146a rs2910164 polymorphism (p=0.2274 in case of GC genotype and p=0.9052 in case of GG genotype). Combined genotype analysis results did not show any notable differences between the multiple comparisons of 28362491-rs2910164 in oligospermic men and control groups. In addition, E-cadherin expression of oligospermic men with ins/ins genotype was significantly lower than patients with del/ins genotype (p=0.0221). E-cadherin expression level was low in oligospermic men with respect to the control group in presence of ins/ins genotype of NFKB1 gene. These results suggest that ins allele prevents binding of surface proteins to spermatozoa, leading to a low affinity of sperm-oocyte interaction in oligospermic men.