Oligoclonal Pattern Research Articles

Thymic Function Following Nonmyeloablative Allografting for the Treatment of Hematological Malignancies

The introduction of nonmyeloablative/reduced intensity conditionings has increased the eligible age for allografting up to 65–70 years. The thymic function is fundamental for the generation of T-cell diversity following allografting even though it is generally considered to decline with age. Until recently, thymic function could not be monitored as a consequence of the absence of adequate technology to differentiate true recent thymic emigrants from naive T cells. The generation of TCR diversity occurs in the thymus through the recombination of gene segments encoding the variable parts of the TCR alpha and beta chains. During this process, by-products of the rearrangements are generated in the form of signal joint T-cell receptor excision circles (sjTRECs). As sjTRECs are stable extrachromosomal DNA fragments, they are not replicated during mitosis and thus diluted with each round of cell division. They are therefore more frequent in T cells that have recently left the thymus.Thymic output was assessed in 52 patients, median age 50 (range 26–67) years, conditioned with low dose TBI (200 cGy), with/without fludarabine (90 mg/m2 total), or cyclophosphamide-thiotepa followed by G-CSF mobilised peripheral blood stem cell infusion from HLA identical siblings or volunteer donors. Diagnoses included: multiple myeloma (no=36), acute myeloid leukemia (no=2), myelodisplastic syndrome (no=4), chronic myeloid leukemia (no=1), Hodgkin disease (no=3), and chronic lymphocytic leukemia (no=6).Genomic DNA was purified from highly enriched CD3–CD4 pos and CD3–CD8 pos T cells by cell sorting (median purity: 97%) at 3, 6, 12, 18 and 24 months post-transplant. Real Time PCR analysis was performed with sjTREC specific primers: forward 5′-TGGTTTTTGTAAAGGTGCCCAC-3′ (50nM), reverse 5′-GTGCCAGCTGCAGGGTTT-3′ (50nM) and the oligo 5′(FAM) CATAGGCACCTGCACCCCGTGC(TAMBRA)p-3′ (250nM) as a detection probe. The GAPDH gene was amplified to standardize DNA content. Amplification reactions (25μl) contained 100ng of genomic DNA, TaqMan universal PCR master mix (Perkin Elmer Applied Biosystems, Foster City, CA, USA), and the appropriate primers and probes. All reactions were performed in the Model 7900 Sequence Detector using standard parameters and analysed using the GeneAmp software (Perkin Elmer Apllied Biosystems). All samples were measured in duplicate PCR reactions.Median sjTRECs values/100 ng DNA from CD3–CD4 pos T cells were as follows: 5.47; 7.09; 11.05; 15.42; 30.45 at 3, 6, 12, 18 and 24 months respectively, while sjTRECs values/100 ng DNA from CD3–CD8 pos T cells were as follows: 2.95; 2.33; 6.64; 10.49; 12.65 at 3, 6, 12, 18 and 24 months respectively. Healthy donors had significantly higher sjTRECs values at the time of donation compared to recipients. Importantly, sjTRECs were not detected in a 60-year-old leukemic patient thymectomized 10 years before allografting for a thymoma. CDR3 spectratyping analysis, evaluated on cDNA samples from the same T cell populations showed an oligoclonal pattern of the TCR repertoire during the first 6 months post-transplant that gradually expanded.The recovery of naive CD4+CD62L+CD45RA+bright T cells and of memory CD4+CD62L+CD45R0+bright T cells, evaluated by flow cytometry, was also gradual over the two-year period. A significant correlation between the levels of sjTRECs and the number of very naive CD62L + T cells was observed (p<0.0001).Correlation between the thymic activity and clinical variables such as graft-vs-host disease, graft-vs-tumor effects and infections are being evaluated and will be presented at the meeting.Overall, our findings provide evidence that adult thymus activity contributes to a slow T cell immune reconstitution during the first two years post-transplant. To enhance the thymus activity, future therapeutic interventions with agents such as recombinant human keratinocyte growth factor-1 or IL-7 may be investigated in clinical phase I trials.

Chromosome 14 Copy Number-Dependent IGH Gene Rearrangement Patterns in High Hyperdiploid Childhood B Cell Precursor ALL: Implications for Leukemia Biology and Minimal Residual Disease Analysis.

B cell precursor (BCP) ALL is usually a monoclonal disease in which the number of IGH rearrangements per cell does not exceed the number of the IGH alleles on chromosome 14. Consequently, a clone with disomy 14 can have a maximum of two unique rearrangements. In contrast, monoclonal high hyperdiploid (HeH) cases with a trisomy 14 can harbor either a maximum of three unique or two unique rearrangements together with a third that may share particular sequences with the one or the other The pattern of IGH rearrangements in cases with trisomy 14 may therefore be misinterpreted to be oligoclonal if the chromosome 14 copy number is not known. Since oligoclonal IGH rearrangements may be instable at relapse, they generally are not used for minimal residual disease (MRD) analysis. Thus, in HeH patients seemingly oligoclonal IGH rearrangements may undeserved be skipped as MRD target. We investigated the association between IGH allele copy numbers and the IGH rearrangement patterns in 90 consecutively recruited HeH BCP ALL. This cohort was used for assessing overall frequencies. To enrich the number of small subgroups, 40 selected HeH cases were added. Cytogenetic and FISH analyses were performed according to standard procedures. IGH rearrangements were determined according to standardized ESG-MRD protocols. Even though the majority of HeH cases (78/90, 87%) had an extra chromosome 14, there was a small but distinct subgroup comprising 13% (12/90) of HeH cases with a disomy 14. Overall, IGH rearrangements were present in about 95% of leukemias representing incomplete DJH rearrangements in about 40% of cases. More than two IGH rearrangements and/or related rearrangements were found in 44% of the same HeH cohort with an overall frequency of 16% “true” oligoclonality after correction for the actual number of chromosomes 14. Of note, leukemias with only two copies of chromosome 14 revealed a significantly higher frequency of apparent oligoclonality compared to those with three copies of chromosome 14 (36% versus 13%). Monoclonal HeH leukemias with trisomy 14 could neither be distinguished from their oligoclonal counterparts nor from oligoclonal TEL-AML1 positive and “not further genetically discriminated” BCP ALLs based on the number of IGH rearrangements per cases and the type of secondary rearrangements (VH or DH to DJH or VH replacement). However, the patterns of secondary rearrangements had shifted from a predominantly VH to DJH recombination in the former towards VH replacement in the latter two groups. Our data have implications for MRD analysis, since oligoclonal patterns of IGH rearrangements account for about 25–30% of childhood BCP ALL. Hence, the interpretation of whether a particular IGH rearrangement pattern is really clonal or not may be crucial in some of these cases and may be better defined by taking into account at least the genetic subtype of the respective leukemia (i.e. hyperdiploid versus those with various fusion genes). If necessary the quality of this information can be further refined by enumerating chromosomes 14 with karyotyping or IGH alleles with interphase FISH. The data provide also insights into the biology of HeH leukemia suggesting that nondisjunction of chromosomes - leading to a HeH karyotype - affects a cell at the beginning of IGH recombination, which is a more undifferentiated B progenitor cell than the cell of origin of the TEL-AML1 positive leukemias and the group of other BCP ALLs.

Disappearance of bone marrow B cell clonal expansion in patients with type II hepatitis C virus-related cryoglobulinemic glomerulonephritis after clinical efficient rituximab therapy

Preliminary data provided encouraging results on efficacy and safety of B cell depletion with rituximab in active glomerulonephritis in the course of mixed cryoglobulinemia (MC).1 2 B cell oligomonoclonal expansion...

Disseminated Mucor infection and thrombotic microangiopathy in lymphoma-associated hemophagocytic syndrome

A 23-year-old Japanese man was admitted to our hospital because of high fever, hepatosplenomegaly, and pancytopenia. Laboratory data on admission were as follows: WBC 2.4 9 10/L, Hb 7.9 g/dL, Plt 22.0 9 10/L, AST 348 IU/ L, ALT 343 IU/L, LDH 1,302 IU/L, T-Bil 5.65 mg/dL, CRP 2.5 mg/dL, ferritin 23,724 ng/mL, and soluble CD25 32,163 U/mL. Computed tomography showed severe splenomegaly containing multiple low density areas. Bone marrow examination showed a marked increase in hemophagocytic macrophages. Although presence of abnormal cells were not apparent, oligoclonal pattern of Epstein-Barr virus (EBV) terminal repeat and abnormal karyotype with [48, XY, ?13, ?22] were detected in the specimen. He was diagnosed as lymphoma-associated hemophagocytic syndrome. HLH2004 protocol (dexamethazone 18 mg/d, cyclosporine 300 mg/d and etoposide 270 mg 9 2/week) had been started. The following two courses of ESHAP chemotherapy (etoposide 68 mg/d d1–4, methylprednisolone 500 mg/d d1–5, araC 3.4 g/d d5, and cisplatin 42 mg/ d d1–4) relieved the fever, splenomegaly, and liver dysfunction only transiently. During the subsequent CHOP chemotherapy (cyclophosphamide 900 mg, adriamycin 80 mg, and vincristine 0.5 mg on d1 without prednisolone because of continuous administration of dexamethasone), a nodular lesion measuring 2 cm appeared in the right upper lung field, and progressively increased to more than 10 cm. Because b-D glucan level was high and pharyngeal culture detected Candida species, 400 mg of fluconazole and 100 mg of micafungin sodium were started. However, fragmentation of the red blood cells became apparent in the peripheral blood smear and haemolytic markers increased in a few days. To maintain platelet count around 20.0 9 10/L, daily platelet transfusion was necessary. The value of FDP remained almost within the normal range. These results indicated the presence of thrombotic microangiopathy (TMA). Hematemesis and tarry stool followed, and panendoscopy revealed acute gastric mucosal lesions and duodenal ulcer, which needed multiple crippings. Antifungal agents were changed after seven days of treatment to 125 mg daily of amphotericin B lipid preparation (AmBisome). However, he died of hemorrhagic infarctions in the cerebellum and brain stem only in three days. Autopsy showed a white nodule with massive necrosis and fibrosis in the spleen. Microscopic examination revealed infiltration of lymphoma cells with prominent nucleoli to both red and white pulps of the spleen, and also to cervical and mediastinal lymph nodes. Immunostaining of the spleen revealed lymphoma cells positive for LCA, CD3, CD8, CD45RO, TIA-1 and granzyme B, and negative for CD4, CD5, CD20, CD56, CD57, and CD79a. The cells were also EBER-positive. These results strongly suggested that the present case was hepatosplenic T cell lymphoma associated with EBV and having an activated cytotoxic profile previously reported by Ohshima et al. [1]. Pneumonic lesion contained angiodestructive infiltration of Mucor and scattered cytomegalovirus (CMV) inclusion bodies (Fig. 1). Extensive vascular occlusion and multiple emboli including Mucor and intracellular owl eyes were N. Inagaki K. Sugimoto (&) Y. Isobe Y. Yamamoto M. Sasaki A. Kato T. Mori K. Oshimi Division of Hematology, Department of Internal Medicine, Juntendo University School of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421, Japan e-mail: ksugimot@juntendo.ac.jp

A patient with clinicopathologic features of small plaque parapsoriasis presenting later with plaque-stage mycosis fungoides: Report of a case and comparative retrospective study of 27 cases of “nonprogressive” small plaque parapsoriasis

It is unsettled whether small plaque parapsoriasis (SPP) represents an inflammatory dermatosis or has a potential to transform into mycosis fungoides (MF) or is, in fact, MF. The literature contains no fully documented example of progression of SPP into MF. The purpose of our study was to present a patient with clinical features of SPP who later developed plaque-stage MF, as seen both clinically and pathologically and to compare the clinicopathologic features of this unique case with 27 "nonprogressive" SPP cases. This study is a prospective and retrospective evaluation of 28 patients, using light microscopy, immunohistochemistry, and molecular biology. A 56-year-old man with a 3-year history of persistent SPP with typical small (<5 cm), elongated and "digitate" lesions presented with newly developed larger patches and plaques. Whereas histologic examination of the patch lesion revealed relatively nonspecific features, a specimen of the crusted plaque showed a dense lymphoid infiltrate composed of small cerebriform lymphocytes, medium-sized lymphoid cells, and occasional large hyperchromatic cells that infiltrated the basal layer of the epidermis and formed small collections. There were atypical mitotic figures. Immunohistochemically, an aberrant immunophenotype with the loss of CD5 expression was found in the plaque specimen. T-cell receptor (TCR)-gamma gene rearrangement studies detected clones in the plaque and in the peripheral blood (biallelic in blood), while the patch tested polyclonal. The 27 SPP patients included 23 men and 4 women, ranging in age from 29 to 75 years. They were followed up and treated for 1.2 to 52 years (mean 10); no patient's SPP progressed into MF. All patients presented with small patch lesions measuring 3 to 6 cm lengthwise and 0.5 to 2 cm in width. Histologic features were nonspecific. Molecular genetic studies revealed the following results: two cases tested polyclonal, 3 cases demonstrated the oligoclonal pattern, whereas the remaining 13 specimens showed a pattern which can be interpreted as oligoclonal or pseudomonoclonal. Oligoclonal and monoclonal patterns were overrepresented in the SPP group, which may be due to the low amount and, probably, suboptimal quality of DNA used in the TCR-gamma rearrangement studies. Occasionally patients with the clinical and pathologic presentation of SPP may develop typical features for MF. This event seems to be extremely rare; at present there appears to be no means to predict such a course. The vast majority of SPP patients will never have disease progression to MF.

ORIGINAL ARTICLE: Repertoire and Clonality of T‐Cell Receptor Beta Variable Genes Expressed in Endometrium and Blood T Cells of Patients with Recurrent Spontaneous Abortion

Recurrent spontaneous abortion (RSA) is a relatively common disorder, the underlying causes of which are thought to be immunological in most cases. Expression profile and clonality pattern of T-cell receptor beta variable (TCRBV) genes in endometrium and blood of patients with RSA were investigated by semi-quantitative reverse transcriptase polymerase chain reaction (RT-PCR) using BV gene-specific primers. Relative expression of each BV family was determined and clonal expansion of the over-expressed genes was assessed by analysis of CDR3 length polymorphism. Compared to blood, relative expression of four TCRBV genes was significantly higher in the endometrium of RSA group. Over-expressed genes, except for TCRBV3, all had restricted and oligoclonal patterns of expression in the endometrium. Endometrial T cells have a skewed TCRBV repertoire with restricted transcript heterogeneity, which is shared by both groups and minor variations observed in this pattern in RSA patients may reflect more recent and/or repeated exposure to nominal antigens or superantigens.

Oligoclonal IgG band patterns in inflammatory demyelinating human and mouse diseases

We evaluated oligoclonal IgG band (OCB) patterns obtained by analyzing paired cerebrospinal fluid (CSF) and serum samples of 77 patients with acute demyelinating encephalomyelitis (ADEM) and 411 patients with multiple sclerosis (MS). OCBs were searched with isoelectric focusing and capillary immunoblotting. CSF-restricted OCBs were found in 89% of MS patients and 10% of ADEM patients ( p < 0.0001). Identical serum and CSF OCBs (‘mirror pattern’), or no OCBs, were detected in 10% of MS patients and 84% of ADEM patients ( p < 0.0001). OCBs were also analyzed in 27 mice with proteolipid protein-induced experimental autoimmune encephalomyelitis (EAE). In this animal model, the ‘mirror pattern’ was the most frequently detected pattern (74%), with the immunizing antigen being the main OCB target. These results indicate that CSF analysis can help differentiate between MS and ADEM and that, similarly to EAE, the ‘mirror pattern’ observed in ADEM accounts for a predominantly systemic immune activation.

DNA-based vaccines: the future of multiple sclerosis therapy?

Multiple sclerosis (MS) is the most common human inflammatory, demyelinating and degenerative disorder of the CNS. Based mostly on work in experimental autoimmune encephalomyelitis, CD4+ T cells were long thought to play the crucial role in MS pathogenesis. Only more recently has it been recognized that other effector cell types, including CD8+ T cells, γδ-T cells and B lymphocytes may also have an important role in disease initiation and perpetuation. The expression of soluble inflammatory mediators, including cytokines and free radicals, may be one of the late pathways mediating CNS tissue damage. In addition, in virtually all patients with MS, an oligoclonal banding pattern of antibodies can be detected in the cerebrospinal fluid (CSF). However, the cause of MS still remains unknown. Specifically, no single foreign or self antigen has been identified to account for clinical disease activity or the presence of surrogate disease markers. All approved pharmacotherapies have anti-inflammatory or immunoregulatory properties and work in early stages of the disease. In a recent clinical trial, BHT-3009, a DNA vaccine encoding full-length human myelin basic protein, was tested in patient with MS. BHT-3009 was safe and well tolerated. In addition, immunization with BHT-3009 induced anti-inflammatory antigen-specific immune changes consisting of a marked decrease in T-cell proliferation of IFNγ production and a reduction in titers of myelin-specific autoantibodies in the CSF. This review will discuss these intriguing observations and the overall potential of DNA vaccination in MS.

A new animal model for primary and persistent Epstein–Barr virus infection: Human EBV‐infected rabbit characteristics determined using sequential imaging and pathological analysis

Most adults have persistent Epstein-Barr virus (EBV)-infection. Adolescents and young adults with primary EBV-infection frequently develop infectious mononucleosis. Latent EBV-infection is associated with various diseases, neoplasms, and hematological disorders. In vivo animal models of human EBV infection, such as non-human primates, have had limited success. A new rabbit model for primary human EBV-infection is described in this study. Seven male rabbits inoculated intravenously with EBV were sequentially imaged by ultrasonography and computed tomography, and examined for anti-EBV-VCA titer and EBV-DNA levels in blood. Six rabbits demonstrated transient splenomegaly, increased anti-EBV-VCA titers and/or EBV-DNA in blood. Transient infiltration of some EBER1-positive lymphocytes was observed in biopsied liver tissues. After splenomegaly, two rabbits tested continuously negative, two alternatively positive and negative, and one consistently positive EBV detection in blood for 470 days. One tested negative for both EBV DNA and splenomegaly. On the 14th day, mild to moderate numbers of EBER1-positive lymphocytes expressing LMP1, EBNA2, or ZEBRA infiltrated mainly in enlarged white pulps of two splenectomized materials. These cells included both B and T cells. EBV clonality analysis revealed an oligoclonal pattern. These indicate that EBV-inoculated rabbits exhibiting heterogenous host reactions are a good model for primary and persistent human EBV infection.

Computer-assisted detection of monoclonal components: results from the multicenter study for the evaluation of CASPER (Computer Assisted Serum Protein Electrophoresis Recognizer) algorithm

To investigate the potential use of Artificial Neural Network (ANN) in the evaluation of serum protein electrophoresis, we set up a multicenter study involving six Italian laboratories. For this purpose, we developed an algorithm named CASPER (Computer Assisted Serum Protein Electrophoresis Recognizer). A total of 59,516 samples from the six centers were divided into three groups. Training and validation sets were used to develop the neural network, whereas evaluation set was used to test the performance of CASPER in recognizing abnormal electrophoretic profiles. CASPER showed 93.0% sensitivity and 47.4% specificity. CASPER sensitivity and specificity ranged in the six sites from 88% (site 3) to 97% (site 5) and from 36% (site 6) to 53% (site 3), respectively. Sensitivity for gamma zone was 94.6%, for beta zone 89.7% and for oligoclonal patterns 92.0%. The sensitivity of the CASPER algorithm does not allow us to recommend its use as a replacement for the visual inspection, but it could be helpful in avoiding accidental misclassifications by the operator. Moreover, the CASPER algorithm may be a useful tool for training operators and students. This study evidenced a high inter-observer variability, which should be addressed in a dedicated study. Data set to train and validate ANNs should contain a huge range and an adequate number of different abnormalities.

Clonal Large Granular Lymphocyte (LGL) Expansion Associated with Dasatinib Therapy.

In addition to therapeutic efficacy in imatinib-resistant BCR-ABL positive malignancies, dasatinib may have off-target immunomodulatory effects by inhibiting kinases (e.g. SRCs, c-KIT) in immune effector cells. In a proportion of patients, dasatinib treatment is associated with non-infectious pleural effusions and panniculitis, which may reflect aberrant immune reactivity. Here we describe a marked expansion of clonal LGL lymphocytes in blood among 11 BCR-ABL positive patients on dasatinib therapy (5 CML CP, 1 CML AP, 1 CML BC, 4 Ph+ALL). All patients were previously exposed to imatinib without similar changes in lymphocyte count or morphology. The median time to LGL lymphocytosis was 2 months from the start of dasatinib (range 1–8 months). It developed abruptly, with a peak lymphocyte count of 4–20 ×109/L, and was often preceded by low-grade fever. In all evaluable cases, lymphocyte counts normalized after drug discontinuation. By immunophenotyping, 6 patients had a CD3/CD8+ cytotoxic T-cell phenotype and 4 patients had a CD56+ NK-cell phenotype. The LGL lymphocytes were BCR-ABL negative. All CD3-positive cases had a clonal rearrangement of TCR gamma/delta genes by PCR; clonality was not detected in samples prior to dasatinib therapy (n=3). In TCR beta gene repertoire assay, oligoclonal patterns were seen in selected genes. All patients with HLA data had the A2 allele (n=8). Dasatinib-related complications were common: pleural effusions and/or pulmonary infiltrates (n=8), modest CMV reactivation (n=5), severe colitis (n=5), which developed after appearance of LGL lymphocytosis. Immunophenotyping was available from 2 patients with pleural effusions: in both cases the majority of cells were CD3+CD8+ T-cells and no leukemic cells were detected. TCR gamma assay was done from one patient sample and it showed similar clonal pattern as in peripheral blood. However, despite frequent side-effects, response to dasatinib treatment was very good in all cases, including complete molecular responses in 5 advanced phase patients. Transient clonal LGL lymphocytosis has been described in few patient cases with a primary herpesvirus infection. Our patients share striking pheno/genotypic similarities with LGL leukemia, in which an antigen driven expansion of LGLs precedes the occurrence of oncogenic events. However, in our patients LGL lymphocytosis appeared to be a benign phenomenon. We postulate that by virtue of inhibition of key non-BCR-ABL kinases, dasatinib induces a reversible state of autoimmune-like reactivity upon antigen challenge in a proportion of patients with a distinct genetic and/or environmental background. The aberrant immune response may also result in enhanced anti-leukemic control driven by the cytotoxic T/NK LGL cells. Dasatinib could be a valuable tool in uncovering the pathogenesis of LGL lymphoproliferation, putatively related to mutations in kinases targeted by the drug.

Atypical Serum Immunofixation Pattern (ASIP) Development during Induction Therapy with BiRD for Newly Diagnosed Multiple Myeloma Correlates with a High Rate of Complete Remission.

The excess production of monoclonal immunoglobulin is the hallmark of multiple myeloma (MM) diagnosis and is an essential element of the determination of disease response to therapy. The development of new monoclonal immunoglobulins that are distinct from the baseline diagnostic paraprotein during the course of MM therapy can therefore pose a challenge in assessing disease response or potential relapse. There are prior reports of the development of abnormal protein banding (APB) after autologous stem cell transplantation for MM comprised of transient non-myeloma related mono- or oligoclonal protein bands that have been correlated with higher rates of event-free and overall survival. We now report the development of atypical serum immunofixation patterns (ASIPs) for the first time outside of the setting of stem cell transplant during the course of MM induction therapy with the BiRD (Biaxin® [clarithromycin], Revlimid® [lenalidomide], Dexamethasone) regimen. 72 patients with newly diagnosed Stage II and III MM (Salmon-Durie Criteria) were treated in a phase 2 clinical study of BiRD. The BiRD treatment regimen was given in 28-day cycles as follows: Clarithromycin 500mg po BID for days 1 – 28, Lenalidomide 25mg po daily for days 1 – 21, and Dexamethasone 40mg po weekly on days 1, 8, 15, and 21. The median age of the patients was 63 (range 36–83), and the baseline monoclonal immunoglobulins detected on serum immunofixation were as follows: 61% IgG, 22% IgA, 17% light chain only. 24 patients (33%) developed one or more ASIPs with either a mono- or oligoclonal banding pattern during the course of BiRD therapy. The new protein bandsvaried widely in duration of appearance (range 26–315 days) as well as isotype with IgM-κ, IgM-λ, IgG-κ, IgG-λ, IgA-λ, free λ light chain, and free IgM heavy chain all observed in one or more instances. The extent of therapy prior to first ASIP development was variable as well, (range 27– 724 days, median of 178 days). Patients with ASIPs had significantly better response to BiRD vs. non-ASIP patients (p = .00002), with CR+sCR rate of 71% vs. 23%, and a VGPR or better rate of 96% vs. 61%. The extent of BiRD therapy prior to development of first ASIP did not correlate with response rate (p = .7284). Bone marrow examination by histology, karyotype, FISH, and PCR IgH / IgK clonality analysis confirmed the disease response and furthermore showed no evidence for newly emergent plasma cell or other B-cell malignancy to account for ASIP generation suggesting molecular remission in some of the patients. Peripheral blood analysis by flow cytometry also showed no evidence for a circulating B-cell neoplasm to account for the new immunoglobulin production. We propose that ASIP development during myeloma therapy with a lenalidomide-based regimen heralds a robust tumor reduction with a hitherto unprecedented rate of complete remission. The immune phenomena that contribute to ASIP generation are unclear at present, however it is neither due to a new clonal B-cell population or transformation of the original MM plasma cell clone.

Free light chains

Those of us ‘of a certain age’ have seen huge changes in the way labs work during our careers. Mattingly cortisols, Lieberman Burchard reagent for cholesterol and Kober reagent for oestriols are nowhere to be found in a modern Clinical Chemistry Lab. Bence Jones protein (BJP), however, has stood the test of time. It is the earliest described ‘tumourmarker’and still provides a high index of suspicion for B-cell malignancy. Henry Bence Jones described a precipitate that was formed on the addition of nitric acid to urine. This precipitate redissolved on heating and formed again on cooling and we now know that it is a protein. It is rather humbling that all Bence Jones had was a bit of acid and a £ame to make a discovery that is still in the common phrase book of pathologists around the world. Today, we ask for serum and urine samples to investigate patients with suspected B-cell malignancy and we use sensitive and reliable electrophoretic techniques to look for the presence of monoclonal proteins, to con¢rm clonality and to identify the heavy and/or light chain types of the monoclonal proteins. However, over the last few years there have been suggestions that this investigation process needs to be updated and in particular, checking urine for BJP should be a thing of the past! In 2001, Bradwell et al. reported the development of a sensitive automated immunoassay for immunoglobulin (Ig) free light chains. The FREELITE test measures free k and free l light chains and, because it is reported that k/l ratio remains normal except in the presence of monoclonal plasma cell proliferations, Katzmann et al. use the calculated k/lratio to infer amonoclonal excess of one particular light chain. There has been considerable interest in this approach for the investigation of patients with suspected and con¢rmed B-cell dyscrasias. However, as with any new test, we have to establish that it is better than the existing tests.We need to decide, based on our knowledge and experience, whether the test can do what we ask of it.We need to thoroughly evaluate it, using the populations that would normally be investigated with that test. Finally, we need to de¢ne when and where and how it should be used. So before we decide to radically change our lab practices for the investigation of B-cell malignancy, wemust look verycarefullyat the FREELITE assays and assess its validity at both analytical and clinical levels. First, a reminder of basic physiology; we all produce small amounts of polyclonal free light chains as a result of normal B-cell function. These pass readily from the blood through the glomerulus and we can see them in normal urine by sensitive immuno¢xation. In patients with renal disease or an underlying in£ammatory process or even in the elderly, the production or excretion of free light chains can increase. In some urine samples the free light chains are seen as an oligoclonal or ladder pattern but they are not BJP. Free light chains can be monoclonal, oligoclonal or polyclonal but BJP consists of only monoclonal free light chains. Unfortunately, there is no antiserum available that has the capacity to distinguish monoclonal Igs from polyclonal Igs (or monoclonal light chains from polyclonal light chains) in serum or in urine.We know this from our routine Ig concentrations on patients with paraproteins and we see it in external quality assurance (EQA) results. Monoclonal proteins can behave strangely in immunoassay even when using highly speci¢c and puri¢ed antiserum. For example, an IgG concentration of 5 or 15 g/L or even of 50 g/L can all be due to polyclonal IgG, monoclonal IgG or oligoclonal IgG. The concentration does not tell us about the clonality of the IgG. Interpreting the IgG concentration with the IgA and IgM concentrations does not help much -the electrophoretic pattern is essential for assessing the clonality of the quantitative Ig results. Monoclonal Igs do not behave like polyclonal Igs in immunonephelometric or immunoturbidimetric assays. The reasons for this are varied but include marked diierences between the polyclonal protein used as the antigen for the antibody production, diierences between antigenicity of the monoclonal protein and the standard used to calibrate the assay and the marked variability in dilution curves for individual paraproteins. The wide range of possible concentrations of monoclonal proteins also makes the inclusion of robust antigen excess checks vital for quantitative assays where monoclonal proteins may be seen. Overall, the results given in immunoassays for monoclonal Igs generally do not provide an accurate quanti¢cation. We assess broad assay reliability by participation in EQA.The FREELITE assay is produced byonly one companyand the reagents and standards are from the same source. However, the results generated in the EQA scheme show dramatically high coe⁄cients of variation -across all the assays (and the ratio), over many distributions, across all the analytical platforms and

Oligoclonal immune response in cerebral cavernous malformations

Mechanisms of cerebral cavernous malformation (CCM) pathogenesis include genetic predisposition in some cases, but other factors are likely to be involved in lesion proliferation and clinical manifestations. Given the unique antigenic milieu of CCMs, there may be a characteristic immune response in these lesions. We hypothesize that the immunoglobulin (Ig) fraction in CCMs reflects an oligoclonal immune response not present in paired sera from the same patients or in other types of cerebrovascular malformations. Surgically excised lesions from five patients with CCMs, three patients with arteriovenous malformations (AVMs), and four normal brain control specimens obtained at autopsy were homogenized and extract tested for IgG clonality by isoelectric focusing in parallel with each patient's serum. The authors detected B cells in all three lesions examined, and plasmacytes in two out of three lesions examined. Four of five extracts of homogenized CCMs showed an oligoclonal pattern of IgG distinct from the polyclonal pattern seen in those patients' sera. Immununoglobulin G oligoclonality was not seen in AVMs or control brain specimens. The results of isoelectric focusing studies showed that CCM lesions had oligoclonal patterns of IgG unrelated to peripheral blood contamination, indicating selective synthesis of IgG within the lesions. This finding probably reflects a clonal expansion of B cells and/or plasmacytes in CCMs, an event that might be antigen-driven or a potential marker of inflammation.

Pityriasis lichenoides chronica: stratification by molecular and phenotypic profile

Pityriasis lichenoides (PL) has traditionally been classified as a benign papulosquamous disease. However, there is an increasing literature precedent that suggests that PL should instead be considered a form of cutaneous lymphoid dyscrasia. We prospectively encountered 46 patients with a diagnosis of PL and used immunohistochemical and multiplex polymerase chain reaction fragment size analysis to assess for phenotypic abnormalities and for T-cell clonal restriction, respectively. We categorized them into 2 groups based on the molecular profile, namely, those cases that showed a monoclonal and/or a restricted oligoclonal profile versus those cases that were polyclonal. Half of all the cases studied showed a monoclonal and/or an oligoclonal restricted T-cell repertoire. From a clinical perspective, 2 cases in this group manifested skin lesions compatible with mycosis fungoides (MF). All of the other cases demonstrated a persistent but nonprogressive clinical course characterized by periods of regression and recurrence. In any case in which there were multiple biopsies, the same T-cell dominant clonotypes, be it in the context of representing a true monoclonal and/or oligoclonal pattern, were implicated over time and at different biopsy sites, including 2 cases in which there was a subsequent evolution to MF. Substantial losses of CD7 and CD62L were seen in both monoclonal/oligoclonal and polyclonal cases of PL, although both values of percentage reduction were greater in the monoclonal/oligoclonal cases. A dominance of CD8 lymphocytes was seen in more than half of all the cases of PL and held to be reactive in nature, potentially directed against clonally restricted CD4 cells. CD4/CD25+ (Foxp3+) T cells averaged 24% in the polyclonal cases; it was 12% in the monoclonal variants of PL. We conclude that PL is a form of indolent cutaneous T-cell dyscrasia. The limited propensity for progression to MF may reflect internal countercheck mechanisms of controlling clonally restricted CD4+ T-cell proliferations via CD8 and CD4/CD25+ regulatory T cells.

Solid phase immunoadsorption for therapeutic and analytical studies on neuropathy-associated anti-GM1 antibodies

Autoimmune neuropathies including Guillain-Barré syndrome are frequently associated with anti-GM1 ganglioside antibodies. These are believed to play a pathogenic role and their clearance from the circulation would be predicted to produce therapeutic benefit. This study examines the conditions required for effective immunoadsorption of anti-GM1 antibodies using glycan-conjugated Sepharose as a matrix. In solution inhibition studies using a range of GM1-like saccharides in conjunction with mouse and human anti-GM1 antibodies, the whole GM1 pentasaccharide beta-Gal-(1-3)-beta-GalNAc-(1-4)-[alpha-Neu5Ac-(2-3)]-beta-Gal-(1-4)-beta-Glc was the favored ligand for maximal inhibiton of antibody-GM1 interactions in comparison with monosaccharides, Gal-(1-3)-beta-GalNAc-betaOMe, and synthetic GM1 mimetics. Immunoadsorption studies comparing binding of mouse monoclonal anti-GM1 antibodies to GM1-Sepharose and beta-Gal-(1-3)-beta-GalNAc-Sepharose confirmed the preference seen in solution inhibition studies. GM1-Sepharose columns were then used to adsorb anti-GM1 immunoglobulin G and immunoglobulin M antibodies from human neuropathy sera. Anti-GM1 antibodies subsequently eluted from the columns often showed a striking monoclonal or oligoclonal pattern, indicating that the immune response to GM1 is restricted to a limited number of B-cell clones, even in the absence of a detectable serum paraprotein. These data support the view that immunoadsorption plasmapheresis could potentially be developed for the acute depletion of serum anti-GM1 antibodies in patients with neuropathic disease, and also provide purified human anti-GM1 antibodies for analytical studies.

Detection of Subclinical Systemic Disease in Primary CNS Lymphoma by Polymerase Chain Reaction of the Rearranged Immunoglobulin Heavy-Chain Genes

To search for subclinical systemic disease in bone marrow and peripheral blood in patients with primary CNS lymphoma (PCNSL) to elucidate whether extracerebral relapse may represent a sequel of initial occult systemic disease rather than true extracerebral spread. Bone marrow and peripheral-blood specimens of 24 PCNSL patients were examined using polymerase chain reaction (PCR) for analysis of clonally rearranged immunoglobulin heavy-chain (IgH) genes. Identical dominant PCR products were found in bone marrow aspirates, blood samples, and tumor biopsy specimens of two patients, indicating that the same tumor cell population is present in the CNS and in extracerebral sites. Follow-up IgH PCR performed in one of these patients in complete remission 24 months after diagnosis yielded a persistent monoclonal product in the blood. An oligoclonal IgH rearrangement pattern was found in the tumor specimen of two other patients, whereas bone marrow and blood samples demonstrated the same dominant PCR products. Follow-up PCR showed a persistent monoclonal amplificate in blood in one of these patients 27 months after diagnosis. It could be demonstrated for the first time that subclinical systemic disease can be present in PCNSL patients at initial diagnosis. Our findings may have an impact on the understanding of PCNSL pathogenesis and the extent of staging and treatment.

Type II mixed cryoglobulinaemia as an oligo rather than a mono B-cell disorder: evidence from GeneScan and MALDI-TOF analyses

To identify and characterize rheumatoid factor (RF)-producing B-cells and cryoprecipitate immunoglobulin (Ig) M in hepatitis C virus (HCV)-positive patients. We purified and characterized, by peptide mass fingerprinting integrated with an NCBI IgBlast data bank search, the IgM component of cryoprecipitate and analysed the VDJ pattern of bone marrow B-cells by gene scan analysis of 17 HCV-positive patients with type II mixed-cryoglobulinaemia. IgM purified from all of the patients presented an RF specificity. In three of these patients a high and predominant B-cell clone (>or=30%) was found in the bone marrow. B-cell-receptor sequences were determined and immunophenotyping of these clones was performed. Peptide masses originating after tryptic digestion of the B-cell-receptor combinatory regions and those originating by tryptic digestion of the cryoprecipitated IgM from the same patient were comparable. In the remaining patients an oligoclonal/polyclonality was found. However, in some of these patients we were able to find peptides that matched with the B-cell-receptor sequences of overexpanded B cells, indicating that, even in the absence of a clear monoclonal expansion, a fraction of total cryoprecipated IgM may derive from overexpanded B-cell clones found in patients' bone marrow. In the majority of mixed cryoglobulinaemia-HCV-positive patients, both in the serum and in B cells from the bone marrow, an oligoclonal pattern is the main molecular picture. When a monoclonal B-cell clone is found, its B-cell-receptor shows an antigen-binding fragment identical to that of cryoprecipitable RF-IgM. Phenotypically, B cells are CD20-positive but CD5-negative, suggesting that the B-1 B-cell subset is not likely to produce high-affinity IgM-RF molecules.

Kaposi's sarcoma-associated herpesvirus/human herpesvirus 8-associated polyclonal body cavity effusions that mimic primary effusion lymphomas

Department of Clinical and Experimental Medicine, Amedeo Avogadro University of Eastern Piedmont, NovaraDear Sir,Kaposi’s sarcoma-associated herpesvirus/human herpesvirus8 (KSHV/HHV-8) is involved in the pathogenesis of Kaposi’ssarcoma (KS) and 2 lymphoproliferative diseases, primaryeffusion lymphoma (PEL) and the plasmablastic variant ofmulticentric Castleman’s disease (MCD). PEL is defined as aliquid-phase lymphoma harboring monoclonal rearrangementsof immunoglobulin (Ig) variable genes or, more rarely, of T-cell receptor (TCR) genes. As a rule, these elements are usedfor PEL diagnosis together with the demonstration of HHV-8infection of the tumor clone. However, as pointed out by Bou-langer and colleagues in the 1 July 2005 issue of the Interna-tional Journal of Cancer,

806. Immunologic Improvement after Gene Therapy in 3 Preadolescents with X-Linked Severe Combined Immunodeficiency (XSCID)

XSCID results from mutations in the IL2RG gene encoding the common gamma chain (|[gamma]|c) shared by several cytokine receptors. Gene therapy as primary treatment for XSCID infants can restore immunity, but 2 teenagers with XSCID did not benefit from gene transfer to autologous bone marrow CD34+ cells. We used retrovirally transduced autologous peripheral mobilized CD34+ cells to treat 3 XSCID preadolescents 10-14 years old with immunodeficiency despite haploidentical bone marrow transplants (BMT). After 6-24 m we found selective gene marking of T cells in all 3 patients, with variable evidence of immunologic improvement. Prior to gene therapy, they had growth failure, frequent infections, diarrhea, T lymphocytopenia, and poor T, NK and B cell function. Each received 30-40 million cells/kg transduced ex vivo with GALV-MFGS-|[gamma]|c. Patient 1 (P1) had a poly-A addition signal mutation allowing residual |[gamma]|c function and had rejected 4 BMTs. At 24 m post gene therapy P1 had provirus detected by quantitative PCR in 4.3% of T cells and 0.1% of both B and myeloid cells. In P2 proviral marking at 18 m was 110% (or average copy number of 1.1), 5% and 0.1% in T, B and myeloid cells, respectively. P3 at 6 m had 22% marking in T cells, with low levels in other leukocyte lineages. CD4+ T cell counts in all patients have increased, but remain below the normal range. P1 has experienced improvement in well-being and resolution of lifelong diarrhea, abdominal distention and rashes; he has not had infections except for an otitis externa 12 m after treatment. A 0.5 cm submandibular nodule consistent with a lymph node arose 6 m post gene therapy and has not changed. After gene therapy P2 has had less frequent diarrhea and respiratory infections. At 6 m post treatment his T cells developed normal proliferative responses to mitogens and Candida antigen. At 12 m, P2 acquired detectable CD4+CD45RA+ T cells and T cell receptor excision circles, indicating new thymic output; donor chimerism assay showed autologous T cell expansion from 49% before gene therapy to 87% at 12 m and beyond. P3 has also reported improved well-being, exercise tolerance and appetite at 6 m; he has had increases in T cell number and proliferative responses to mitogens. Analysis of retroviral insertion sites in P1 and P3 consistently showed polyclonality. T cells of P2 had an oligoclonal pattern by LAM-PCR, but linker-mediated PCR yielded a wide variety of insertions. Furthermore, both V|[beta]| TCR usage and spectratyping showed increasing diversity after gene therapy. Proviral insertions near LMO2, implicated in European XSCID leukemia cases, have not been identified. Our preliminary results suggest that gene therapy may benefit some XSCID patients who have failed previous BMT treatment. Prior production of allogeneic T cells in P2 may have helped to preserve his thymic function. Further follow-up will establish long-term safety, efficacy and indications for XSCID gene therapy in preadolescent subjects with XSCID.