Okra Yellow Vein Mosaic Virus Research Articles

Prevalence of Okra Yellow Vein Mosaic Viral Disease and its Correlation with Vector Population in Sindh, Pakistan

Okra (Abelmoschus esculentus (L.) Moench) being an important vegetable crop is widely grown in tropical and subtropical regions of the world. Whitefly (Bemisia tabaci) is not only a major insect pest of okra in Pakistan but also the vector insect of Begomoviruses including okra yellow vein mosaic virus which causes okra yellow vein mosaic viral disease (OYVMVD). Regional monitoring of insect vectors and disease prevalence is being emphasized for proper management, therefore this study was focused on determining the intensity of OYVMVD in the fields and the correlation between the disease and vector population. For this purpose, the virus infection was confirmed with DNA sequencing. The disease and vector population was visually assessed approximately 65-70 days after sowing of okra under field conditions at commercial farmer fields in district viz., Hyderabad, Tando Allahyar, Matiari, and Sanghar of Sindh, Pakistan during the growing season of 2016. Ten okra plants with three replications (N = 30) at ten different locations of each district were assessed. Results of nucleotide alignment of DNA amplified from diseased plants confirmed that yellowing and vein clearing were due to the virus infection. The visual assessment showed that the disease was prevailing throughout all region monitored in this study and the disease was significantly correlated with the vectors population. However, maximum disease incidence and severity were recorded in Tando Allahyar. Therefore, it is recommended to validate various management practices at such high disease risk points for better management

Genetic enhancement of okra [Abelmoschus esculentus (L.) Moench] germplasm through wide hybridization.

The introgression of genetic material from one species to another through wide hybridization and repeated back-crossing, plays an important role in genetic modification and enriching the cultivated gene-pool with novel genetic variations. Okra (Abelmoschus esculentus [(L.) Moench)] is a popular vegetable crop with high dietary fibre and protein, rich in essential amino acids, lysine and tryptophan. The wild Abelmoschus genepool has many desirable traits like ornamental value, short internodal length, more number of productive branches, extended bearing, perennation tendency, reduced fruit length (more consumer preferred trait), high mucilage content (medicinal value), abiotic stress tolerances such as drought, high temperature and biotic stress resistances such as okra Yellow Vein Mosaic Virus (YVMV) and Enation Leaf Curl Virus (ELCV) diseases. The repeated use of elite breeding lines led to narrowing of the genetic base of the okra crop, one of the major factors attributed to breakdown of resistance/ tolerance to biotic stresses. YVMV and ELCV are the two major diseases, causing significant yield loss in okra. Hence, wide hybridization was attempted to transfer tolerance genes from wild species to the cultivated genepool to widen the genetic base. The screening of germplasm of wild Abelmoschus species at hotspots led to the identification of tolerant species (Abelmoschus pungens var. mizoramensis, A. enbeepeegeearensis, A. caillei, A. tetraphyllus and A. angulosus var. grandiflorus), which were further used in a wide-hybridization programme to generate interspecific hybrids with the cultivated okra. Presence of pre- and post-zygotic barriers to interspecific geneflow, differences in ploidy levels and genotype specific variations in chromosome numbers led to varying degrees of sterility in F1 plants of interspecific crosses. This was overcome by doubling the chromosome number of interspecific hybrids by applying Colchicine at the seedling stage. The 113 cross derivatives generated comprising amphidiploids in the F1 generation (30), F3 (14), one each in F2 and F4 generations, back cross generation in BC1F2 (03), BC1F3 (25), and BC2F3 (02), crosses between amphidiploids (27), multi-cross combinations (07) and inter-specific cross (between A. sagittifolius × A. moschatus subsp. moschatus) selfed derivatives at F8 generation (03) were characterized in the present study. Besides they were advanced through selfing and backcrossing. The amphidiploids were found to possess many desirable genes with a considerable magnitude of linkage drag. Majority of the wide cross derivatives had an intermediate fruit morphology and dominance of wild characters viz., hispid fruits, stem, leaves, tough fruit fibre, vigorous perennial growth habit and prolonged flowering and fruiting. The fruit morphology of three BC progenies exhibited a high morphological resemblance to the cultivated okra, confirming successful transfer of useful genes to the cultivated okra genepool. The detailed morphological characteristics of the various combinations of Abelmoschus amphidiploids and the genetic enhancement of the genepool achieved in this process is reported here.

Field survey and molecular characterization of a bipartite begomovirus causing okra yellow vein mosaic virus disease in the Rajshahi region of Bangladesh

Field survey and molecular characterization of a bipartite begomovirus causing okra yellow vein mosaic virus disease in the Rajshahi region of Bangladesh

Use of Agro-Insecticide, Plant Extracts and Resistance Inducers to Manage Yellow Vein Mosaic of Okra

Production of okra is under threat due to certain biotic and abiotic factors. Okra yellow vein mosaic virus (OYVMV) is a devastating disease of okra, caused by monopartite and bipartite begomovirus and transmitted by whiteflies (Bemisia tabaci Gen.). Yield loss due to this virus is quite high, up to 80-94 percent is reported under heavy infection. The efficacy of Malathion with botanicals and resistance inducers were tested against OYVMV in the field conditions for the effective management of the disease. The result revealed that among all the treatments malathion 50 EC (2 ml/litre) in combination with sarpagandha leaves extract (10%) had recorded the lowest terminal per cent disease index (PDI) (15.55%) during all the observation periods as compared to untreated check plot (71.68%). The fruit yield was also recorded highest (3833.20 kg/ha) in this treatment as compared to control (1811.15 kg/ha) and other treatments. For the evaluation of resistance inducers, the seeds were soaked in salicylic acid with concentrations of 50, 100 and 150 mg/litre water and Trichoderma viride @ 5 g/litre water at the time of sowing and later sprayed with the same doses at 15 days interval. Amongst different treatments, salicylic acid @ 150 mg/litre as seed priming and spray @ 150 mg/litre water recorded significantly less terminal PDI (28.89%) as well as the highest fruit yield as compared to other treatments and untreated check plot (73.33%). The treatment with bioagent Trichoderma viride @ 5 g/litre as seed priming and spray @ 5 g/litre water also effective in reducing the disease severity and increasing fruit yield significantly as compared to control.

Management of Yellow Vein Mosaic Virus Disease of Okra through Cultural Approaches

Okra (Abelmoschus esculentus L. Moench) cultivation is threatened in the tropics due to the high incidence of okra yellow vein mosaic virus (OYVMV) disease. The experiment was conducted under field conditions to evaluate different dates of sowing and row to row spacing with a susceptible cultivar of okra 'Pusa Sawani' in a split-plot design during kharif 2018. The disease incidence and percent disease index (PDI) of OYVMV of okra were strongly impacted by the date of sowing and row to row spacing of the okra crop. Early (15th June) sown crop with closer row spacing of 30 cm had the lowest terminal disease incidence (49.30%), while late (14th July) sown crop with wider (60 cm) spaced crop had the highest (73.96%). The PDI was also lowest (47.82%) in an early (15th June) sown crop with 30 cm row spacing and greatest (68.19%) in a late (14th July) sown crop with 60 cm row spacing. During the study, it was observed that the early date of sowing with closer row to row spacing was decrease the incidence and severity of OYVMV disease.

Population assessment of Bemisia tabaci (Gennadius.) and disease occurrence of Begomovirus in okra, Abelmoschus esculentus L

Okra [ Abelmoschus esculentus (L.) Moench] is an essential vegetable cultivated primarily for its delicious green pods. Whitefly, Bemisia tabaci (Genn.) attacks it and damages the foliage by sap-sucking, and also, it transmits Phyto-viruses like Okra Yellow Vein Mosaic Virus and Okra Leaf Curl Virus. The okra production losses due to Whitefly and transmitted viruses are prodigious. This research investigated the population fluctuations of whitefly and the Begomoviruses Percent Disease incidence (PDI) and Disease Severity Index (DSI) in different okra varieties. The Whitefly population's first incidence was recorded in early May, while it peaked in July and vanished in August. The highly susceptible variety was the native Peshawar-local (3.37 Whitefly/ 3 leaf), and the most resistant variety was Sabz-Pari (1.00 Whitefly/3 leaf). The highest disease incidence and severity were recorded on Peshawar-Local (PDI = 72.6, DSI = 69.0), followed by Ganga (PDI = 66.0, DSI = 54.8), while the most resistant variety against the virus infection was Sabz-Pari having lower PDI = 6.00 and DSI = 1.20. The viral infection is characterized by Polymerase Chain Reaction (PCR) through specific primers. Okra Yellow Vein Mosiac Virus was found to be the most prevailing and was amplified (800 bp) in all varieties apart from two resistant one’s, Peshawar-Local and Swat-Green, while Okra Leaf Curl Virus found to be the milder strain, and infection amplified (1600 bp) only in two varieties (Rama-Krishna and Peshawar-Local). The current finding insinuates that due to frequent use of the Peshawar-Local variety, it becomes susceptible to the whitefly and associated viruses; thus, this variety cultivation should be replaced by a resistant variety Sabz-Pari alongside proper monitoring of whitefly masses for expedient management.

Biological Resistance to Okra yellow vein mosaic virus Using Three Biological Agents on Three Okra Cultivars

Jadoua, J.A. and M.A.W. Al-Fahd. 2022. Biological Resistance to Okra yellow vein mosaic virus Using Three Biological Agents on Three Okra Cultivars. Arab Journal of Plant Protection, 40(2): 148-157. https://doi.org/10.22268/AJPP-40.2.148157 A study was conducted in Al-Alam District, Salah Al-Din Governorate, Iraq, during the fall season 2019-2020, with the goal of diagnosing the local isolate of Okra yellow vein mosaic virus (OYVMV) from infected plants using polymerase chain reaction. A genomic segment of OYVMV with a size of 750 was amplified using polymerase chain reaction (PCR) and a set of specific primers. By amplifying a 750 bp band on agarose gel, the field isolate tested was identified as a member of the genus Begomovirus, which was related to an Indian isolate of the same virus. The study included determining the efficacy of three biological factors: (A) a medicinal plant preparation from A. Paniculara, (H) a preparation from Lion's mushroom (H. erinaceus and (P) a preparation from P. florescence bacteria which has impact on virus infection, as well as determining the response of three okra varieties to virus infection. The use of the three combined factors (A+H+P) outperformed other treatments reducing virus infection rate of the Petra okra variety to 26.67 % and severity to 10.66 % as compared to 100% for the control. The findings showed that there were substantial variation in the peroxidase enzyme activity and chlorophyll content, with the A+H+P treatment producing 59.14 units/mg protein for the Petra variety and 40.81 Spad for the Hasnawi variety. The results also showed that there were extremely significant differences in yield, with the triple treatment (A+H+P) yielding 833.96 gm/plant for the Star variety compared to 537.44 gm/plant for the infected control that was not treated. Keywords: Biological control, viruses, okra

Influence of weather variables on whitefly population build-up and progression of okra yellow vein mosaic virus disease

Influence of weather variables on whitefly population build-up and progression of okra yellow vein mosaic virus disease

Integrated management of whitefly; the vector of okra yellow vein mosaic virus through diverse germplasm and plant extracts

The present research was conducted to study the population incidence of whitefly (Bemisia tabaci) on 15 okra cultivars using four plant extracts with a control for its management under field conditions. The data regarding to population incidence of whitefly was recorded. Minimum whitefly population was recorded on Sabz pari (7.67%) and Sanam (9.22%) followed by Kiran (17%), Green wonder (17.33%), Okra-1548 (19%), Click-5769 (20.33%), A. Selection (20.44%), Laxmy (20.78%), Okra-7100 (21%), Pusa Swani (21.89%), Pk-0k-1 (23.44%), Pmf Beauty (26.11%), Okra-7080 (26.78%), Jk-tetra-6 (28.78%) and Super star (31.11%). Among plant extracts Azadirachta indica was 24.4% effective as compared to Eucalyptus camaldulensis (25.9%), Melia azedarach (27.1%), Cassia fistula (28.1%) and control (31.9%) and minimum whitefly was recorded at okra-7100 (26.8%) followed by laxmy (26.8%), okra-7080 (27.5%), jk-tetra-6 (28.2%) and pmf beauty (28.2%). Azadirachta indica and variety okra-7100 performed better among all extracts and varieties.

Screening of wild okra (Abelmoschus moschatus) germplasm for okra yellow vein mosaic disease resistance in India

Okra yellow vein mosaic disease (OYVMD) is a major viral disease of okra crop caused by Okra yellow vein mosaic virus (OYVMV). The disease is responsible for direct yield loss in terms of both quantity and quality of capsules (fruits). Initially, DNA-A of coat protein, intergenic region and partial rep protein sequences were determined using OY2395F/OY680R specific primer and the amplified 1.2 Kb band product showed presence of OYVMV. Two years field screening of wild okra accessions (Abelmoschus moschatus ssp. moschatus) carried out during kharif 2017 and 2019 against OYVMD in agro-ecological conditions of New Delhi. Among seventy six (76) wild okra accessions 10 accessions, viz. EC360586, EC360794, EC360830, EC360900, EC359730, EC359836, EC359870, EC360351, EC361171 and EC361111 exhibited resistant (R) response in kharif 2017. While in 2019, out of these 10 promising accessions, four accessions, viz. EC360794, EC360586, EC360830 and EC361171 further showed R response. Rest of the tested lines showed either moderately resistant (MR) or susceptible (S) response. Average percent disease incidence (PDI) value was 19.51% and range value was 4.46 to 64.06% for the first year of field screening. Whereas the recorded average PDI were 21.77% with the range value of 4.36 to 67.33% in the second year. For both the years, out of 76 accessions, four accessions, viz. EC360794, EC360586, EC360830 and EC361171 were found promising and exhibited R response consistently. These promising lines could be utilized in breeding programmes for development of varieties resistant to OYVMV.

Management of Okra Yellow Vein Mosaic Virus (OYVMV) Through Selected Insecticides and Light Reflecting Colored Mulches

A field experiment was conducted to evaluate the effect of light reflecting colored mulches and only one time spraying with selected insecticides to control the insect vector of Okra Yellow Vein Mosaic Virus (OYVMV) whitefly (Bemisia tabaci) at the central farm of Sher-e-Bangla Agricultural University, Dhaka-1207. The experiment was carried out in three blocks layouted with RCBD comprising eight treatments viz. T0 (control/no spray), T1 (1 time spray with imitaf), T2 (1 time spray with protect), T3 (1 time spray with tiddo plus), T4 (1 time spray with terbine), T5 (light reflecting silver color mulch), T6 (light reflecting red color mulch) and T7 (light reflecting black color mulch) with three replications. The mulches were used before sowing and insecticides were sprayed at 30 DAS. It was observed that among the light reflecting colored mulches, the lowest disease incidence (11.48%) was recorded in the plots which mulched with red color mulch (T6). Among the insecticides, the lowest disease incidence (30.17%) was recorded in plots that was sprayed with terbine (one time). Yield and yield contributing characters, morphological and physiological features of okra plant that changes due to disease infection which cause damages in okra production and reduce the fruit quality as well as market value was also the part of this study. Yield and yield contributing characters showed significant variance among the selected treatments. In the relationship study, it was noticed that the yield and plant height was showed negative relationship with disease incidence. However, considering all measuring parameters, spraying with terbine (one time) and used red color mulch may be recommended as good management approaches that will give higher okra production and lower disease incidence of Okra Yellow Vein Mosaic Virus (OYVMV).

Yellow Vein Mosaic Disease in Okra (Abelmoschus esculentus L.): An Overview on Causal Agent, Vector and Management

Okra (Abelmoschus esculentus L.) belongs to the Malvaceae family and is one of the most essential and popular vegetables globally. It is rich in proteins, carbohydrates, and vitamins. Abiotic and biotic factors threaten okra productivity. Okra yellow vein mosaic disease (OYVMD) is the most destructive disease of okra. The causal agent, [(i.e., Okra yellow vein mosaic virus (OYVMV)] of this disease belongs to the family Geminiviridae and genus Begomovirus. OYVMV is a monopartite with additional ssDNA molecule. This virus has two components DNA-A for protein coding and DNA-B for symptoms induction. Whitefly transmits OYVMV in persistent manner. Characteristic symptoms of OYVMV infected okra plants are chlorosis, dwarfing, and yellowing of veins and fruits. High temperatures with moderate rainfall enhance the development of OYVMV disease and the whitefly population. However, high humidity with low temperature and rainfall has no significant role in developing the OYVMD and whitefly population. Moreover, the virus also affects the secondary metabolites in the infected okra plants. The virus can be managed through various strategies including the application of plant defense activators, the development of resistant varieties and by controlling its vector via pesticides and plant extracts. Various plant defense activators such as monopotassium phosphate (KH2PO), salicylic acid, benzoic acid, and citric acid enhance resistance in okra against OYMVD. In addition, the resistance to OYMVD can also be achieved by successfully incorporating high yielding but resistant cultivars of acceptable quality. In this review, we have discussed history, economic impact, symptomology, disease development under a natural environment, genetics and management of OYVMV.

EVALUATION OF ORGANIC AMENDMENTS AND INSECTICIDES AGAINST OKRA YELLOW VEIN MOSAIC VIRUS AND ITS VECTOR

Okra (Abelmoschus esculentus L.) is susceptible to number of diseases like Yellow Vein Mosaic Virus disease, Damping Off, Fusarium wilt, Powdery Mildew and Enation Leaf Curl. The Okra is favorite host of whitefly which transmits the okra Yellow Vein Mosaic Virus (OYVMV). OYVMV disease causes considerable yield losses in Okra. Experiment was conducted to check the efficacy of organic matter (poultry manure, leaves) and insecticides (Acetamiprid, Diafenthiuron, Pyridine Carboxamide) against OYVMV and its whitefly vector. In this experiment, ten okra varieties were sown in randomized complete block design (RCBD). Organic matter and insecticides were applied at recommended doses (@5ml/L) on weekly intervals. Among insecticides, Acetamiprid showed the best result to manage whitefly infestation with 60.01% mortality and OYVMV disease severity with 53.98% efficiency. Polo (Diafenthiuron) also showed good results to manage whitefly (56.36%) and OYVMVD (46.34%), but Ulala (Pyridine Carboxamide) insecticide was least effective to control whitefly population (47.27%) and to manage the infection of OYVMV disease (43.91%). Leaf manure was more effective with 61.16% efficiency as compared to poultry manure (56.01%) against OYVMV disease severity. New chemistry insecticide (acetamiprid) gave the most effective control of whitefly and transmission of OYVMV and could be used in place of conventional insecticides. Leaf manure proved significant defense activator in okra plants with effective control of disease and could be used as eco-friendly management approach.

Evaluation of okra (Abelmoschus esculentus L. Moench) cultivars for resistance to okra mosaic virus and okra yellow vein mosaic virus

Okra (Abelmoschus esculentus L. Moench) serves as a vegetable of great food, medicinal and industrial value. The production of the crop is, however, constrained by lack of improved high yielding, virus and pest resistant varieties. The current study sought to identify resistance in ten okra cultivars to okra mosaic disease and okra yellow vein mosaic disease within the coastal savannah agro-ecological zone of Ghana. Enzyme-linked immunosorbent assay (ELISA) detected Okra mosaic virus (OkMV) and Okra yellow vein mosaic virus (OYVMV) in symptomatic leaves of the ten cultivars. Okra mosaic disease was the most frequently detected in cultivar Adom while okra yellow vein mosaic disease was most abundant in cultivar Labadi dwarf. Mixed infection of OkMV and OYVMV was found in eight cultivars while cultivars F1-Sahari and F1-Kirene were singly infected by OkMV. The highest index of symptom severity for all plants (ISSap) was found in cultivar Kwabenya (2.80) while Togo and Adom had the least (0.30). The index of symptom severity for diseased plants only (ISSdp) varied significantly and was highest in cultivar Kwabenya (3.85). Based on disease incidence and severity, cultivars Adom, Togo, Asutem, Labadi dwarf, Kirikou-F1 and Kwabenya were rated as tolerant while F1-Sahari and Lucky-19F1 were rated as moderately susceptible. F1-Kirene and Clemson Spineless were rated as highly susceptible with disease incidence of 88.6% and 88.5% respectively.

Genetic analysis of Okra Yellow Vein Mosaic Virus disease resistance in wild relative of okra Abelmoschus angulosus Wall. ex Wight & Arn

AbstractWild relative of okra, Abelmoschus angulosus Wall. ex Wight & Arn. was identified as a resistant germplasm for Okra Yellow Vein Mosaic Virus (OYVMV) which is the devastating disease for okra cultivation in Sri Lanka. The mode of resistance of OYVMV in A. angulosus was studied with the aim of tagging responsible genes for the disease resistance. Wide hybridization was performed between A. angulosus and highly virus susceptible A. esculentus variety, MI-7. Very poor seed setting was observed in F1 and F2 generations due to post zygotic abortion. Disease screening was carried out using F1 and F2:3 populations along with parents in the field under induced disease pressure. Disease severity index and area under disease progress curve were calculated to measure disease severity. Number of genes segregating for OYVMV disease resistance was calculated for the F2:3 generation. Modified Wright's formula was used to estimate the effective gene number and mode of inheritance by a quantitative method. A χ2 test was performed for qualitative analysis. Plants of A. angulosus were totally free of virus incidence while 100% disease incidence was observed in the variety MI-7. F2:3 population showed between and within progeny segregation for disease incidence. Results indicated that the disease susceptibility was dominant over resistance. χ2 analysis revealed that the segregation of disease severity was significantly fit to the gene model of 9:6:1 (χ2 = 0.1757 at P ≤ 0.05) suggesting the disease resistance in A. angulosus is governing by two recessive genes in an additive manner. Result was confirmed by the quantitative analysis.

Weather based prediction models for whitefly Bemisia tabaci and Okra yellow vein mosaic virus disease in Okra

Field trials were carried out to study the impact of abiotic factors on the population dynamics of whitefly vector and okra yellow vein mosaic virus (OYVMV) incidence in okra at National Bureau of Plant Genetic Resources (NBPGR) Regional Station, Rajendranagar, Hyderabad, during summer, 2015 and 2016. The weather parameters like minimum temperature, evening relative humidity and evaporation significantly influenced the population build up of whiteflies, while minimum temperature, evaporation, morning and evening relative humidity played an important role in the infestation of OYVMV. Weather parameters of preceding two weeks had more significant effect on the population buildup and OYVMV incidence than the preceding one week weather. The multiple regression equations developed for whitefly and OYVMV incidence with weather parameters predicted the whitefly population to an extent of 86 to 92%, while they predicted the OYVMV incidence to an extent of 94 to 96%.

Varietal Screening of Okra (Abelmoschus esculentusl. Moench ) Against Okra Yellow Vein Mosaic Virus Under Different Management Practices at Paklihawa, Rupandehi, Nepal

The experiment was conducted in the Horticulture farm of Institute of Agriculture and Animal Science, Paklihawa, Rupandehi, Nepal from March, 2017 to June, 2017 to screen the varieties of okra against Okra yellow vein mosaic virus under different management practices. The experiment was laid out in two factorial Split plot design and replicated three times. Five varieties of okra viz. Parvati, Arka Anamika, NOH-15, Super Green and Julie were used and five treatments viz. Jholmol (1:5), Azadiracthin (5ml/L), Imidacloprid (2ml/L), cow milk (100ml/L) and control (distilled water) were used as foliar spray on plants. The chlorophyll content of the leaves was higher in Julie followed by Arka Anamika. The white fly count was found to be reduced after the application of treatments in the succeeding date in almost all varieties. The efficiency of the management practices was found to be significant with Super Green and Julie varieties with least Percent Disease Incidence(PDI) value and in par with each other. Imidacloprid and Azadiractin had the leastPDI value and the combination of Super Green variety with Imidacloprid, Super Green with Jholmol, Super Green with cow milk, Julie with Imidacloprid, NOH-15 with Imidacloprid were found resistant. Similarly, the highest yield was obtained in Julie with Imidaclropid combination. However, due to the maximum waiting period of this chemical as well as its negative impact on human and plant health, Julie with Azadirachtin combination can be suggested to farmers to have eco-friendly management of Okra yellow vein mosaic virus.

First Report on Association of Okra yellow vein mosaic virus With Yellow Vein Mosaic Disease of Okra (Abelmoschus esculentus) in Sri Lanka

HomePlant DiseaseVol. 101, No. 7First Report on Association of Okra yellow vein mosaic virus With Yellow Vein Mosaic Disease of Okra (Abelmoschus esculentus) in Sri Lanka PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report on Association of Okra yellow vein mosaic virus With Yellow Vein Mosaic Disease of Okra (Abelmoschus esculentus) in Sri LankaC. J. Tharmila, E. C. Jeyaseelan, U. Ihsan, A. C. Wetten, D. M. De Costa, and M. W. ShawC. J. TharmilaSearch for more papers by this author, E. C. JeyaseelanSearch for more papers by this author, U. IhsanSearch for more papers by this author, A. C. WettenSearch for more papers by this author, D. M. De CostaSearch for more papers by this author, and M. W. ShawSearch for more papers by this authorAffiliationsAuthors and Affiliations C. J. Tharmila E. C. Jeyaseelan , Department of Botany, University of Jaffna, Sri Lanka U. Ihsan A. C. Wetten , School of Agriculture, Policy and Development, University of Reading, U.K. D. M. De Costa , Department of Agricultural Biology, Faculty of Agriculture, University of Peradeniya, Sri Lanka M. W. Shaw , School of Agriculture, Policy and Development, University of Reading, U.K. Published Online:14 Apr 2017https://doi.org/10.1094/PDIS-10-16-1492-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Yellow vein mosaic disease (YVMD) is a major biotic constraint on okra (Abelmoschus esculentus) cultivation in Sri Lanka. Diseased plants show characteristic symptoms of mosaic and vein yellowing on leaves and small and yellowish green fruits. Disease incidence was 55 to 70% in three districts (Jaffna, Trincomalee, and Vavuniya) of northern Sri Lanka in 2015. To confirm the identity of the pathogen, symptomatic leaf samples were collected from the above three districts in May and June 2015. In each district, three diseased plant samples were collected from three different farms. DNA of the samples was amplified by PCR using begomovirus specific primers to detect DNA-A (Deng et al. 1994), DNA-B (Rojas et al. 1993), and β-satellite DNA (Briddon et al. 2002). For all samples (27 DNA samples of infected plants), the presence of DNA-A and β-satellite DNA of a monopartite begomovirus was confirmed; however, DNA-B was not detected. A full-length PCR amplified product of the β-satellite DNA of each district was cloned and sequenced. The resulting sequences (GenBank KX174318, KX174319, and KX174322) have several features of begomovirus DNA-β, namely, a conserved nonanucleotide TAATATTAC, which is found in all geminiviruses, a coding sequence for the protein beta-C1, an adenine rich region, and a highly conserved stretch of ∼100 nucleotides upstream of the predicted stem-loop structure. The sequences showed great similarity with several isolates of Bhendi yellow vein mosaic betasatellite (BYVB) in GenBank and were distantly related to begomoviruses previously identified in Sri Lanka: Tomato leaf curl virus associated DNA beta (AJ542493) and Ageratum yellow vein virus associated DNA beta (AJ542498). The complete nucleotide sequences of DNA-A were amplified with three sets of degenerate overlapping primers (Venkataravanappa et al. 2012). The DNA-A sequences assembled from the cloned segments (KX698087, KX698088, and KX698090) have the genome organization characteristic of begomoviruses, encoding six ORFs with two ORFs (AV1 and AV2) in the virion sense strand and four ORFs (AC1-AC4) in the complementary strand, separated by an intergenic region (IR). The IR contains a stem loop structure with the expected conserved nonanucleotide sequence, TAATATTAC. The nucleotide sequence comparisons showed that the genome of DNA-A of the isolates shared 97 to 98% sequence identity with Okra enation leaf curl virus isolates (KT390458, KX553923) and also 97% identity with Mesta yellow vein mosaic virus (KJ462074), and 91% with Indian isolates of Bhendi yellow vein mosaic virus, while it showed ≤80% similarity with other identified Sri Lankan begomoviruses, such as Ageratum yellow vein virus (NC_002981), Chilli leaf curl virus (JN555600), and Cassava mosaic virus (AJ314737). Hence, the virus associated with YVMD of okra has been identified as an isolate of Okra yellow vein mosaic virus. Furthermore, leaf samples collected from infected plants showed positive results to dot blot hybridization using a digoxigenin labeled DNA probe (DIG DNA labeling and detection kits, Sigma Aldrich, U.S.A.), which had been prepared specifically to beta-satellite DNA using the primer pair (BetaF: GGTTCGTTTACATCCATTCCCA, BetaR: TCCATTCGACTTCAACGGT). To our knowledge, this is the first report of Okra yellow vein mosaic virus (OYVMV) associated with yellow vein mosaic disease of okra in Sri Lanka. Identification of OYVMV association with okra will provide the platform for further study, prevention, and control of the disease.

Effect of Okra Yellow Vein Mosaic Virus (OYVMV) on Plant Growth and Yield

Okra yellow vein mosaic virus (OYVMV) is one of the most destructive diseases of okra plant. In the current study, effect of okra yellow vein mosaic virus (OYVMV) was assessed on plant growth and yield in naturally infected crop under agro-ecological conditions of Hyderabad district. The virus showed the significant reduction in plant height, number of leaves, flowers, fruits, and over all pickings and yield of all the locations wherever the crop was examined in the district. The significant reduction in plant height (48.67 cm) in infected plants as compared to healthy plants (62.96 cm) was recorded. Similarly, significant difference in the flowers formation per plant at all four locations was recorded in diseased (0.912) and healthy (2.165) plants. Fruit weight was also significantly reducing due to the disease prevalence at all four locations (73.25 g) as compared to healthy observed fruits (91.50 g). Interestingly, on overall basis there were more numbers of leaves (20.66) in infected plants as compared to healthy one (16.33). It is obvious from the results that virus (OYVMV) showed significant increase in number of leaves but reduced plant height, flowers, fruits and yield at all four observed locations, thus, pathologists and breeders are advised to work more on evaluation of resistant varieties using advanced molecular tools. The growers are also advised to adopt preventive as well as curative control measures so that the yield losses may be decreased.

Management of Okra Yellow Vein Mosaic Virus and its Vector through Plant Extracts

Four plants extract i.e. Azadirachta indica (neem), Allium sativum (garlic), Zingiber officinale (ginger) Allium cepa L (onion) were evaluated to manage OYVMV and its vector. For this purpose four Okra varieties Sabz pari, Pahuja, Pusa sawani and Lush green was sown under RCBD design. Data obtained from vector population and disease incidence was analyzed through ANOVA. Sabz pari was found moderately resistant. Pahuja showed tolerant behavior while Lush green and Pusa sawani showed moderately susceptible and susceptible response respectively. Among four plants extract Azadirachta indica (Neem) at 5% concentration was effective as compared to control and other extracts in reducing the whitefly and OYVMV disease incidence under field condition.