ofAcinetobacter Baumannii Research Articles

A protein-free vaccine stimulates innate immunity and protects against nosocomial pathogens.

Traditional vaccines are difficult to deploy against the diverse antimicrobial-resistant, nosocomial pathogens that cause health care-associated infections. We developed a protein-free vaccine composed of aluminum hydroxide, monophosphoryl lipid A, and fungal mannan that improved survival and reduced bacterial burden of mice with invasive blood or lung infections caused by methicillin-resistant Staphylococcus aureus, vancomycin-resistant Enterococcus faecalis, extended-spectrum beta-lactamase-expressing Escherichia coli, and carbapenem-resistant strains of Acinetobacter baumannii, Klebsiella pneumoniae, and Pseudomonas aeruginosa. The vaccine also conferred protection against the fungi Rhizopus delemar and Candida albicans. Efficacy was apparent by 24 hours and lasted for up to 28 days after a single vaccine dose, with a second dose restoring efficacy. The vaccine acted through stimulation of the innate, rather than the adaptive, immune system, as demonstrated by efficacy in the absence of lymphocytes that were abrogated by macrophage depletion. A role for macrophages was further supported by the finding that vaccination induced macrophage epigenetic alterations that modulated phagocytosis and the inflammatory response to infection. Together, these data show that this protein-free vaccine is a promising strategy to prevent deadly antimicrobial-resistant health care-associated infections.

The promiscuous and highly mobile resistome of Acinetobacter baumannii.

Antimicrobial resistance (AR) is a major global threat to public health. Understanding the population dynamics of AR is critical to restrain and control this issue. However, no study has provided a global picture of the whole resistome of Acinetobacter baumannii , a very important nosocomial pathogen. Here we analyse 1450+ genomes (covering >40 countries and >4 decades) to infer the global population dynamics of the resistome of this species. We show that gene flow and horizontal transfer have driven the dissemination of AR genes in A. baumannii . We found considerable variation in AR gene content across lineages. Although the individual AR gene histories have been affected by recombination, the AR gene content has been shaped by the phylogeny. Furthermore, many AR genes have been transferred to other well-known pathogens, such as Pseudomonas aeruginosa or Klebsiella pneumoniae . Despite using this massive data set, we were not able to sample the whole diversity of AR genes, which suggests that this species has an open resistome. Our results highlight the high mobilization risk of AR genes between important pathogens. On a broader perspective, this study gives a framework for an emerging perspective (resistome-centric) on the genomic epidemiology (and surveillance) of bacterial pathogens.

A New Pharmacokinetic-Pharmacodynamic Model To Characterize the Inoculum Effect of Acinetobacter baumannii on Polymyxin B In Vitro.

The inoculum effect (i.e., reduction in antimicrobial activity at large starting inoculum) is a phenomenon described for various pathogens. Given that limited data exist regarding inoculum effect of Acinetobacter baumannii, we evaluated killing of A. baumannii by polymyxin B, a last-resort antibiotic, at several starting inocula and developed a pharmacokinetic-pharmacodynamic (PKPD) model to capture this phenomenon. In vitro static time-kill experiments were performed using polymyxin B at concentrations ranging from 0.125 to 128 mg/L against a clinical A. baumannii isolate at four starting inocula from 105 to 108 CFU/mL. Samples were collected up to 30 h to quantify the viable bacterial burden and were simultaneously modeled in the NONMEM software program. The expression of polymyxin B resistance genes (lpxACD, pmrCAB, and wzc), and genetic modifications were studied by RT-qPCR and DNA sequencing experiments, respectively. The PKPD model included a single homogeneous bacterial population with adaptive resistance. Polymyxin B effect was modeled as a sigmoidal Emax model and the inoculum effect as an increase of polymyxin B EC50 with increasing starting inoculum using a power function. Polymyxin B displayed a reduced activity as the starting inoculum increased: a 20-fold increase of polymyxin B EC50 was observed between the lowest and the highest inoculum. No effects of polymyxin B and inoculum size were observed on the studied genes. The proposed PKPD model successfully described and predicted the pronounced in vitro inoculum effect of A. baumannii on polymyxin B activity. These results should be further validated using other bacteria/antibiotic combinations and in vivo models.

Distinctive Roles of Two Acinetobactin Isomers in Challenging Host Nutritional Immunity.

ABSTRACTThe human pathogen Acinetobacter baumannii produces and utilizes acinetobactin for iron assimilation. Although two isomeric structures of acinetobactin, one featuring an oxazoline (Oxa) and the other with an isoxazolidinone (Isox) at the core, have been identified, their differential roles as virulence factors for successful infection have yet to be established. This study provides direct evidence that Oxa supplies iron more efficiently than Isox, primarily owing to its specific recognition by the cognate outer membrane receptor, BauA. The other components in the acinetobactin uptake machinery appear not to discriminate these isomers. Interestingly, Oxa was found to form a stable iron complex that is resistant to release of the chelated iron upon competition by Isox, despite their comparable apparent affinities to Fe(III). In addition, both Oxa and Isox were found to be competent iron chelators successfully scavenging iron from host metal sequestering proteins responsible for nutritional immunity. These observations collectively led us to propose a new model for acinetobactin-based iron assimilation at infection sites. Namely, Oxa is the principal siderophore mediating the core Fe(III) supply chain for A. baumannii, whereas Isox plays a minor role in the iron delivery and, alternatively, functions as an auxiliary iron collector that channels the iron pool toward Oxa. The unique siderophore utilization mechanism proposed here represents an intriguing strategy for pathogen adaptation under the various nutritional stresses encountered at infection sites.

Diagnostic Value of Multiplex Polymerase Chain Reaction in Detection of Acinetobacter baumannii, Pseudomonas aeruginosa, and Stenotrophomonas maltophilia from Sepsis in Pediatrics.

Proper identification of the causative organism in pediatric sepsis is crucial for early diagnosis and prevention of septic shock and organ failure. The aim of the present study was to evaluate the multiplex polymerase chain reaction (PCR) for detection of Acinetobacter baumannii, Pseudomonas aeruginosa, and Stenotrophomonas maltophilia from positive blood cultures for these pathogens isolated from children with hospital- acquired sepsis compared to the conventional biochemical reactions for identification of these organisms. This study was a cross-sectional study performed on 100 isolates from pediatric blood cultures, including Acinetobacter baumannii, Pseudomonas aeruginosa, and Stenotrophomonas maltophilia. The study also included 100 isolates of Escherichia coli as a negative control. All isolates were identified by API 20NE and the multiplex PCR with primers specific to the 3 tested bacteria. Multiplex PCR was positive in 96% of isolates and 4 isolates had negative results. Falsepositive results were reported with three E. coli strains. Multiplex PCR identified all the isolates of Acinetobacter baumannii, 29 isolates of Pseudomonas aeruginosa and 27 isolates of Stenotrophomonas maltophilia. The diagnostic value of the multiplex PCR compared to the biochemical identification revealed sensitivity 96.04%, specificity 96.9%, positive predictive value 97.00%, negative predictive value 96.00% and accuracy 96.50%. The present study highlights the diagnostic value of multiplex PCR to identify Acinetobacter baumannii, Pseudomonas aeruginosa, and Stenotrophomonas maltophilia from positive blood cultures. Multiplex PCR was sensitive, specific and accurate. The accuracy differs according to the organisms with 100% accuracy for Acinetobacter baumannii.

In Vitro Activity of Cefiderocol, a Siderophore Cephalosporin, against Multidrug-Resistant Gram-Negative Bacteria.

Cefiderocol is a parenteral siderophore cephalosporin with a catechol-containing 3' substituent. We evaluated its MICs against Gram-negative bacteria, using iron-depleted Mueller-Hinton broth. The panel comprised 305 isolates of Enterobacterales, 111 of Pseudomonas aeruginosa, and 99 of Acinetobacter baumannii, all selected for carbapenem resistance and multidrug resistance to other agents. At 2 and 4 μg/ml, cefiderocol inhibited 78.7 and 92.1%, respectively, of all Enterobacterales isolates tested, with rates of 80 to 100% for isolates with all modes of carbapenem resistance except NDM enzymes (41.0% inhibited at 2 μg/ml and 72.1% at 4 μg/ml) or combinations of extended-spectrum β-lactamase (ESBL) and porin loss (61.5% inhibited at 2 μg/ml and 88.5% at 4 μg/ml). Cefiderocol also inhibited 81.1 and 86.5% of all P. aeruginosa isolates at 2 and 4 μg/ml, respectively, with rates of 80 to 100% for isolates with VIM, IMP, GES, or VEB β-lactamases and slightly lower rates for those with NDM (45.5% at 2 μg/ml and 72.7% at 4 μg/ml) and PER (66.7% at 2 μg/ml and 73.3% at 4 μg/ml) enzymes; 63.3% of P. aeruginosa isolates were inhibited at the FDA's 1-μg/ml breakpoint. Lastly, cefiderocol at 2 and 4 μg/ml inhibited 80.8 and 88.9% of the A. baumannii isolates, respectively, with rates of >85% for isolates with OXA-51-like, -23, -24, or -58 enzymes and 50% at 2 μg/ml and 80% at 4 μg/ml for those with NDM carbapenemases. Dipicolinic acid and avibactam weakly potentiated cefiderocol against Enterobacterales isolates with metallo-β-lactamases (MBLs) and serine carbapenemase, respectively, indicating incomplete β-lactamase stability.

In Vitro Activity of the Ultra-Broad-Spectrum Beta-Lactamase Inhibitor QPX7728 in Combination with Meropenem against Clinical Isolates of Carbapenem-Resistant Acinetobacter baumannii.

QPX7728 is a recently discovered ultra-broad-spectrum beta-lactamase inhibitor (BLI) with potent inhibition of key serine and metallo-beta-lactamases. QPX7728 enhances the potency of many beta-lactams, including carbapenems, in beta-lactamase-producing Gram-negative bacteria, including Acinetobacter spp. The potency of meropenem alone and in combination with QPX7728 (1 to 16 μg/ml) was tested against 275 clinical isolates of Acinetobacter baumannii (carbapenem-resistant A. baumannii [CRAB]) collected worldwide that were highly resistant to carbapenems (MIC50 and MIC90 for meropenem, 64 and >64 μg/ml). Addition of QPX7728 resulted in a marked concentration-dependent increase in meropenem potency, with the MIC90 of meropenem alone decreasing from >64 μg/ml to 8 and 4 μg/ml when tested with fixed concentrations of QPX7728 at 4 and 8 μg/ml, respectively. In order to identify the mechanisms that modulate the meropenem-QPX7728 MIC, the whole-genome sequences were determined for 135 isolates with a wide distribution of meropenem-QPX7728 MICs. This panel of strains included 116 strains producing OXA carbapenemases (71 OXA-23, 16 OXA-72, 16 OXA-24, 9 OXA-58, and 4 OXA-239), 5 strains producing NDM-1, one KPC-producing strain, and 13 strains that did not carry any known carbapenemases but were resistant to meropenem (MIC ≥ 4 μg/ml). Our analysis indicated that mutated PBP3 (with mutations localized in the vicinity of the substrate/inhibitor binding site) is the main factor that contributes to the reduction of meropenem-QPX7728 potency. Still, >90% of isolates that carried PBP3 mutations remained susceptible to ≤8 μg/ml of meropenem when tested with a fixed 4 to 8 μg/ml of QPX7728. In the absence of PBP3 mutations, the MICs of meropenem tested in combination with 4 to 8 μg/ml of QPX7728 did not exceed 8 μg/ml. In the presence of both PBP3 and efflux mutations, 84.6% of isolates were susceptible to ≤8 μg/ml of meropenem with 4 or 8 μg/ml of QPX7728. The combination of QPX7728 with meropenem against CRAB isolates with multiple resistance mechanisms has an attractive microbiological profile.

Molecular docking, dynamics and free energy analyses of Acinetobacter baumannii OXA class enzymes with carbapenems investigating their hydrolytic mechanisms

Introduction. Acinetobacter baumannii is a critical priority pathogen listed by the World Health Organization due to increasing levels of resistance to carbapenem classes of antibiotics. It causes wound and other nosocomial infections, which can be life-threatening. Hence, there is an urgent need for the development of new classes of antibiotics.Aim. To study the interaction of carabapenems with class D beta-lactamases (oxacillinases) and analyse drug resistance by studying enzyme-substrate complexes using modelling approaches as a means of establishing correlations with the phenotypic data.Methodology. The three-dimensional structures of carbapenems (doripenem, ertapenem, imipenem and meropenem) were obtained from DrugBank and screened against class D beta-lactamases. Further, the study was extended with their variants. The variants' structure was homology-modelled using the Schrödinger Prime module (Schrödinger LLC, NY, USA).Results. The first discovered intrinsic beta-lactamase of Acinetobacter baumannii, OXA-51, had a binding energy value of -40.984 kcal mol-1, whereas other OXA-51 variants, such as OXA-64, OXA-110 and OXA-111, have values of -60.638, -66.756 and -67.751 kcal mol-1, respectively. The free energy values of OXA-51 variants produced better results than those of other groups.Conclusions. Imipenem and meropenem showed MIC values of 2 and 8 µg ml-1, respectively against OXA-51 in earlier studies, indicating that these are the most effective drugs for treatment of A. baumannii infection. According to our results, OXA-51 is an active enzyme that shows better interactions and is capable of hydrolyzing carbapenems. When correlating the hydrogen-bonding interaction with MIC values, the predicted results are in good agreement and might provide initial insights into performing similar studies related to OXA variants or other antibiotic-enzyme-based studies.

An Improved Medium for Colistin Susceptibility Testing.

The plasmid-located colistin resistance gene mcr-1 confers low-level resistance to colistin, a last-line antibiotic against multidrug-resistant Gram-negative bacteria. Current CLSI-EUCAST recommendations require the use of a broth microdilution (BMD) method with cation-adjusted Mueller-Hinton (CA-MH) medium for colistin susceptibility testing, but approximately 15% of all MCR-1 producers are classified as sensitive in that broth. Here we report on an improved calcium-enhanced Mueller-Hinton (CE-MH) medium that permits simple and reliable determination of mcr-1-containing Enterobacteriaceae Colistin susceptibility testing was performed for 50 mcr-1-containing Escherichia coli and Klebsiella pneumoniae isolates, 7 intrinsically polymyxin-resistant species, K. pneumoniae and E. coli isolates with acquired resistance to polymyxins due to mgrB and pmrB mutations, respectively, and 32 mcr-1-negative, colistin-susceptible isolates of Acinetobacter baumannii, Citrobacter freundii, Enterobacter cloacae, E. coli, K. pneumoniae, and Salmonella enterica serovar Typhimurium. A comparison of the colistin MICs determined in CA-MH medium and those obtained in CE-MH medium was performed using both the BMD and strip-based susceptibility test formats. We validated the data using an isogenic IncX4 plasmid lacking mcr-1 Use of the CE-MH broth provides clear separation between resistant and susceptible isolates in both BMD and gradient diffusion assays; this is true for both mcr-1-containing Enterobacteriaceae isolates and those exhibiting either intrinsic or acquired colistin resistance. CE-MH medium is simple to prepare and overcomes current problems associated with BMD and strip-based colistin susceptibility testing, and use of the medium is easy to implement in routine diagnostic laboratories, even in resource-poor settings.

A Simplified Derivative of Human Defensin 5 with Potent and Efficient Activity against Multidrug-Resistant Acinetobacter baumannii.

The increasing incidence of multidrug-resistant Acinetobacter baumannii (MDRAb) infections worldwide has necessitated the development of novel antibiotics. Human defensin 5 (HD5) is an endogenous peptide with a complex architecture and antibacterial activity against MDRAb In the present study, we attempted to simplify the structure of HD5 by removing disulfide bonds. We found that the Cys2-4 bond was most indispensable for HD5 to inactivate MDRAb, although the antibacterial activity of the derivative was significantly attenuated. We then replaced the noncationic and nonhydrophobic residues with electropositive Arg to increase the antibacterial activity of HD5 derivative that contains a Cys2-4 bond, obtaining another derivative termed HD5d5. The in vitro antibacterial assay and irradiation-wound-infection animal experiment both showed that HD5d5 was much more effective than HD5 at eliminating MDRAb Further investigations revealed that HD5d5 efficiently bound to outer membrane lipid A and penetrated membranes, leading to bacterial collapse and peptide translocation. Compared to HD5, more HD5d5 molecules were located in the cytoplasm of MDRAb, and HD5d5 was more efficient at reducing the activities of superoxide dismutase and catalase, causing the accumulation of reactive oxygen species that are detrimental to microbes. In addition, HD5 failed to suppress the pathogenic outer membrane protein A of Acinetobacter baumannii (AbOmpA) at concentrations up to 50 μg/ml, whereas HD5d5 strongly bound to AbOmpA and exhibited a dramatic toxin-neutralizing ability, thus expanding the repertoire of drugs that is available to treat MDRAb infections.

Emergence of a Competence-Reducing Filamentous Phage from the Genome of Acinetobacter baylyi ADP1.

We observed the emergence of a novel filamentous phage (CRAϕ) from the genome of Acinetobacter baylyi ADP1 during a long-term laboratory evolution experiment. CRAϕ is the first bacteriophage reported to require the molecular machinery involved in the uptake of environmental DNA for infection. Reactivation and evolution of CRAϕ reduced the potential for horizontal transfer of genes via natural transformation in our experiment. Risk of infection by similar phages may limit the expression and maintenance of bacterial competence in nature. The closest studied relative of CRAϕ is the Vibrio cholerae CTXϕ phage. Variants of CRAϕ are found in the genomes of Acinetobacter baumannii strains, and it is possible that phage-encoded toxins contribute to the virulence of this opportunistic multidrug-resistant pathogen.

Genome Sequence of a Clinical Strain of Acinetobacter baumannii Belonging to the ST79/PFGE-HUI-1 Clone Lacking the AdeABC (Resistance-Nodulation-Cell Division-Type) Efflux Pump.

Increased expression of chromosomal genes for resistance-nodulation-cell division-type efflux systems plays a major role in the multidrug resistance of Acinetobacter baumannii. Little is known about the genetic characteristics of clinical strains of Acinetobacter baumannii lacking the AdeABC pump. In this study, we sequenced the genome of clinical strain Ab421 GEIH-2010 (belonging to clone ST79/PFGE-HUI-1 from the GEIH-REIPI Ab. 2010 project) which lacks this efflux pump.

Clinical Variants of the Native Class D β-Lactamase of Acinetobacter baumannii Pose an Emerging Threat through Increased Hydrolytic Activity against Carbapenems.

The threat posed by the chromosomally encoded class D β-lactamase of Acinetobacter baumannii (OXA-51/66) has been unclear, in part because of its relatively low affinity and turnover rate for carbapenems. Several hundred clinical variants of OXA-51/66 have been reported, many with substitutions of active-site residues. We determined the kinetic properties of OXA-66 and five clinical variants with respect to a wide variety of β-lactam substrates. The five variants displayed enhanced activity against carbapenems and in some cases against penicillins, late-generation cephalosporins, and the monobactam aztreonam. Molecular dynamics simulations show that in OXA-66, P130 inhibits the side-chain rotation of I129 and thereby prevents doripenem binding because of steric clash. A single amino acid substitution at this position (P130Q) in the variant OXA-109 greatly enhances the mobility of both I129 and a key active-site tryptophan (W222), thereby facilitating carbapenem binding. This expansion of substrate specificity represents a very worrisome development for the efficacy of β-lactams against this troublesome pathogen.

Preservation of Acquired Colistin Resistance in Gram-Negative Bacteria

Colistin-resistant mutants were obtained from 17 colistin-susceptible strains of Acinetobacter baumannii, Pseudomonas aeruginosa, Klebsiella pneumoniae, and Escherichia coli. The stability of colistin resistance in these mutants was investigated. Three of four colistin-resistant P. aeruginosa mutants recovered colistin susceptibility in colistin-free medium; however, colistin-susceptible revertants were obtained from only one strain each of A. baumannii and E. coli. No susceptible revertants were obtained from K. pneumoniae mutants.

Draft Genome Sequence of Extensively Drug-Resistant Acinetobacter baumannii Strain CUAB1 from a Patient in Hong Kong, China.

We report the draft genome sequence of an extensively drug-resistant strain of Acinetobacter baumannii, CUAB1, isolated from a patient in a local Hong Kong hospital. MIC testing was performed, and genes previously associated with drug resistance were located.

Therapeutic efficacy of lysophosphatidylcholine in severe infections caused by Acinetobacter baumannii.

Due to the significant increase in antimicrobial resistance of Acinetobacter baumannii, immune system stimulation to block infection progression may be a therapeutic adjuvant to antimicrobial treatment. Lysophosphatidylcholine (LPC), a major component of phospholipids in eukaryotic cells, is involved in immune cell recruitment and modulation. The aim of this study was to show if LPC could be useful for treating infections caused by A. baumannii. A. baumannii ATCC 17978 was used in this study. Levels of serum LPC and levels of the inflammatory cytokines tumor necrosis factor alpha (TNF-α), interleukin-6 (IL-6), IL-1β, and IL-10 were determined by spectrophotometric assay and enzyme-linked immunosorbent assay (ELISA), respectively, using a murine peritoneal sepsis model in which mice were inoculated with 5.3 log CFU/ml of A. baumannii. The therapeutic efficacy of LPC against A. baumannii in murine peritoneal sepsis and pneumonia models was assessed for 48 h after bacterial infection. At early time points in the murine model of peritoneal sepsis caused by A. baumannii, LPC was depleted and was associated with an increase of inflammatory cytokine release. Preemptive therapy with LPC in murine peritoneal sepsis and pneumonia models markedly enhanced spleen and lung bacterial clearance and reduced the numbers of positive blood cultures and the mouse mortality rates. Moreover, treatment with LPC reduced proinflammatory cytokine production. These data demonstrate that LPC is efficacious as a preemptive treatment in experimental models of peritoneal sepsis and pneumonia caused by A. baumannii.

Potentiation effects of amikacin and fosfomycin against selected amikacin-nonsusceptible Gram-negative respiratory tract pathogens.

The amikacin-fosfomycin inhalation system (AFIS) is a combination of 2 antibiotics and an in-line nebulizer delivery system that is being developed for adjunctive treatment of pneumonia caused by Gram-negative organisms in patients on mechanical ventilation. AFIS consists of a combination of amikacin and fosfomycin solutions at a 5:2 ratio (amikacin, 3 ml at 100 mg/ml; fosfomycin, 3 ml at 40 mg/ml) and the PARI Investigational eFlow Inline System. In this antibiotic potentiation study, the antimicrobial activities of amikacin and fosfomycin, alone and in a 5:2 combination, were assessed against 62 Gram-negative pathogens from a worldwide antimicrobial surveillance collection (SENTRY). The amikacin MICs for 62 isolates of Acinetobacter baumannii, Pseudomonas aeruginosa, and Klebsiella pneumoniae were ≥32 μg/ml (intermediate or resistant according to the Clinical and Laboratory Standards Institute [CLSI]; resistant according to the European Committee on Antimicrobial Susceptibility Testing [EUCAST]). Each isolate was tested against amikacin (0.25 to 1,024 μg/ml), fosfomycin (0.1 to 409.6 μg/ml), and amikacin-fosfomycin (at a 5:2 ratio) using CLSI reference agar dilution methods. The median MIC values for amikacin and fosfomycin against the 62 isolates each decreased 2-fold with the amikacin-fosfomycin (5:2) combination from that with either antibiotic alone. Interactions between amikacin and fosfomycin differed by isolate and ranged from no detectable interaction to high potentiation. The amikacin-fosfomycin (5:2) combination reduced the amikacin concentration required to inhibit all 62 isolates from >1,024 to ≤ 256 μg/ml and reduced the required fosfomycin concentration from 204.8 to 102.4 μg/ml. These results support continued development of the amikacin-fosfomycin combination for aerosolized administration, where high drug levels can be achieved.

Occurrence of an Environmental Acinetobacter baumannii Strain Similar to a Clinical Isolate in Paleosol from Croatia

Over the past decade, bacteria of the genus Acinetobacter have emerged as a leading cause of hospital-acquired infections. Outbreaks of Acinetobacter infections are considered to be caused exclusively by contamination and transmission in hospital environments. The natural habitats of clinically important multiresistant Acinetobacter spp. remain to be defined. In this paper, we report an incidental finding of a viable multidrug-resistant strain of Acinetobacter baumannii, related to clinical isolates, in acid paleosol from Croatia. The environmental isolate of A. baumannii showed 87% similarity to a clinical isolate originating from a hospital in this geographic area and was resistant to gentamicin, trimethoprim-sulfamethoxazole, ciprofloxacin, and levofloxacin. In paleosol, the isolate was able to survive a low pH (3.37), desiccation, and a high temperature (50°C). The probable source of A. baumannii in paleosol is illegally disposed waste of external origin situated in the abandoned quarry near the sampling site. The bacteria could have been leached from waste by storm water and thus infiltrated the paleosol.

Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii.

Impaired Virulence and Fitness of a Colistin-Resistant Clinical Isolate of Acinetobacter baumannii in a Rat Model of Pneumonia

We compared the fitness and lung pathogenicity of two isogenic clinical isolates of Acinetobacter baumannii, one resistant (ABCR) and the other susceptible (ABCS) to colistin. In vitro, ABCR exhibited slower growth kinetics than ABCS. In a rat model of pneumonia, ABCR was associated with less pronounced signs of infection (lung bacterial count, systemic dissemination, and lung damage) and a better outcome (ABCR and ABCS mortality rates, 20 and 50%, respectively [P = 0.03]).