Nutrient Agar Medium Research Articles

Isolasi dan Seleksi Bakteri Kandidat Selulolitik dari Proses Pembuatan Pupuk Organik pada Pengolahan Limbah Peternakan

Cattle farming is one of the livestock business commodities in Indonesia. In the production process, cattle farms produce waste in the form of feces and leftover feed which can be processed in such a way through a decomposition process into organic fertilizer. The rate of the decomposition process is influenced by the existing decomposer microbes. One of the microbes needed in the decomposition process is cellulolytic bacteria. The research was conducted to obtain potential cellulolytic bacterial isolates from the compost which can then be used as a starter in the decomposition process. This research was conducted experimentally with the stages of research including isolation of bacteria from decomposers, the isolates obtained were then reviewed on Nutrient Agar media to produce uniform colonies. Furthermore, screening was carried out to obtain cellulolytic bacteria using NA media added with 1% CMC (Carboxymethyl Cellulose). Based on the results of the study, obtained 7 bacterial isolates that have various cellulolytic indices. The best cellulolytic index was produced by isolates NC-12, NC-17, and NC-16.

Analysis of the antibacterial properties of jute leaf

In this experiment, tea liquor has been prepared by 10% dried tea leaves and boiling time was 5, 10 and 15 minutes. For the determination of antibacterial activity, Salmonella typhi were inoculated on nutrient agar media by spread plate method and tea liquor was poured in the middle of the bacterial inoculated plate. Antibacterial activity was observed where boiling time has affected antibacterial activity. Antibacterial activity of different extracts of jute leaves were evaluated by agar well diffusion method against different pathogenic bacteria viz., Escherichia coli, Pseudomonas aeruginosa, Bacillus cereus etc. Antibacterial activity was found increasing with increased by longer time prepared tea liquor and the highest antibacterial activity of the aqueous extract of jute leaf was observed against E. coli (ZOI=17.0±1.0 mm) followed by Salmonella typhi. Therefore, these results clearly support the traditional use of jute leaf as a broad-spectrum antimicrobial agent against a wide range of microbes.

Perbandingan Media Alternatif Kacang Kedelai dan Media Nutrient Agar Terhadap Pertumbuhan Bakteri Staphylococcus aureus

Nutrient Agar media is a medium with a yellowish white powder and after use it will be solid because it contains agar. The most important content contained in this medium is carbohydrates as well as protein contained in meat extract and peptone according to the needs of most bacteria. (Rossita, 2015). Soybeans are one of the natural ingredients that contain high enough protein. The purpose of the study was to compare the number of Staphylococcus aureus bacteria colonies on nutrient agar media and soybean media. The type of research used is experimental. This research was conducted on 21-25 June 2021 at the Palembang Health Laboratory Center with a total of 32 samples. Data were analyzed using Mann Whitney Test. The results showed that the average number of colonies on soybean media had an average of 3.3 colonies, while colonies on nutrient agar media had an average of 50.4 colonies. Statistical test results obtained p = 0.000 means that there is a comparison of the number of colonies of Staphylococcus aureus bacteria on nutrient agar media and soybean media. The conclusion of this study is that soybean media cannot be used as an alternative medium for the growth of Staphylococcus aureus bacteria. Keywords: Nutrient Agar, Soybeans, Staphylococcus aureus

Infestation of <em>Apis mellifera</em> workers and larvae with <em>Varroa destructor</em> affects gut bacterial diversity

The present work aims to investigate the midgut bacteria of honey bee (Apis mellifera lamarckii) workers and larvae infested with Varroa destructor. To achieve this task, uninfested and infested honey bee larvae and workers with the parasitic mites were obtained from natural bees apiaries in Qaliubiya Governorate, Egypt. Aerobic bacteria were isolated from the midgut of uninfested and infested A. mellifera on nutrient agar medium and identified using a culture-dependent isolation along with 16S rRNA sequences. The results revealed that both uninfested and V. destructor infested workers and larvae harbored gut bacteria belonging to Gamma-proteobacteria strains. The uninfested workers contained Enterobacter cloacae and Serratia nematodiphila, while V. destructor infested workers harbored Enterobacter species. Uninfested larvae contained E. hormaechei and Klebsiella variicola. V. destructor infested larvae harbored K. oxytoca as a result of infection. We concluded that the honeybee microbiome composition is likely to be impacted through isolates variation by stage and diversity disruption of isolates by V. destructor infection.

Characterization of Ralstonia solanacearum Using Fourier Transform Infrared (FTIR) Spectroscopy

Ralstonia solanacearum, the causal agent of bacterial wilt disease is worldwide in distribution, and results in serious economic losses, particularly in the tropics. Detection and characterization of microorganisms by Fourier transform infrared spectroscopy (FTIR) technique promises to be of great value because of the method’s inherent sensitivity, small sample size, rapidity, and simplicity. In this study, we used FTIR spectroscopy for the characterization of Ralstonia solanacearum. The bacteria were grown on Nutrient Agar (NA) at 28°C for 48 hours. The colonies of Ralstonia solanacearum on nutrient agar medium were smooth circular, raised, and dirty white. Cultures of bacteria were identified by molecular methods using PCR techniques. The DNA was amplified using a specific primer pair, 759f/760r (forward primer: 5'- GTCGCCGTCAACTCACTTTCC 3’, reverse primer: 5'-GTCGCCGTAGCAATGCGGAATCG-3’). The PCR produced a single band of 280 bp from the isolated DNA of cultured bacteria. Bacterial spectra were obtained in the wavenumber range of 4000–400 cm-1 using FTIR spectroscopy. The identification of cell wall constituents in region 3000–2800 cm-1, the proteinaceous structure of bacteria in region 1665–1200 cm-1, and the fingerprint of bacteria in region 1200-800 cm-1 are all part of the spectra analysis in this study. Absorption bands obtained from bacteria Ralstonia solanacearum samples associated with protein, phospholipids, nucleic acids, and carbohydrates appear in the bacterial IR absorption spectra.

Occurrence of Enterobacteriaceae in medicinal plants sold in local markets of Savar, Dhaka

Medicinal plants can be contaminated with a large diversity of potentially pathogenic bacteria. Ten medicinal plant samples Plantago psyllium, Terminalia bellirica, Terminalia chebula, Phyllanthus emblica, Ocimum basilicum, Glycyrrhiza glabra, Withania somnifera, Andrographis panicula, Bombax ceiba were collected from Amin Bazar and Savar of Savar area to study the presence and abundance of Enterobacteriaceae family bacteria in the herbal plant samples. A total of fifty five (55) bacterial isolates have been isolated from different medicinal plant samples using spread plate method on nutrient Agar media. Culture of bacterial isolate on a number of selective and differential media and biochemical tests (Catalase activity, hemolytic property, fermentation test, Starch hydrolysis, VP test, MR test, MIU test, Indole and casein test etc.) revealed the presence of different Enterobacteriaceae family bacteria in the plant samples. Out of 55 isolates 6 isolates were Salmonella sp. (11%), 2 isolates were Klebsiella sp. (3.63%) and 2 isolates were Enterobacter sp. (3.63%). Antibiotic sensitivity test of bacterial isolates showed that all the identified Enterobacteriaceae family bacteria were sensitive to Kanamycin but resistant to Amoxycilin, Aztreonam and Penicillin-G. Therefore, this study highlighted the necessity for constant quality assessment of herbal medicines to facilitate and ensure safe production and supply of medicinal products suitable for human consumption.
 Jahangirnagar University J. Biol. Sci. 10(1 & 2): 1-8, 2021 (June & December)

Determination of Total Microbial Bioload and Pathogen Testing from Bakery Products

Bakery products are the most widely consumed food on the planet. Microbiological spoilage is one of the most common reasons for bakery products having a short shelf life. This study reports on isolation of microorganisms from bakery products. The study aimed to prospect the isolation of bacteria, total colony count and pathogen testing were carried out nutrient agar media and specific media. Isolation of bacteria was done using nutrient agar medium, total colony count was prosecuted by colony counting method and pathogen testing was performed using specific media like mannitol salt agar, EMB agar, cetrimide agar and bismuth sulphite agar. Biochemical characterization was executed for the obtained pathogen. It was preceded by test like indol test, MRVP test, simmon’s citrate test, catalase test, gelatinase test and TSI test. After completion of these tests it was concluded the obtained microorganism was Salmonella species.

AN ASSESSMENT OF THE MICROBIOLOGICAL QUALITY OF ANTI-VIRAL CHURNA SOLD IN INDIA BY AYURVEDIC MEDICAL PRACTITIONERS

Objectives: The objectives behind of this study are to analyze the unregistered herbal products dispensed by Ayurvedic practitioners, as per the WHO guidelines for determination of potentially hazardous contaminants. To aware the registered medical practitioners regarding contamination of herbal product, the patients are using unregistered herbal products from registered medical practitioners. Methods: The method employed in this study was a pour plate method. The specific media plates were incubated for 24 h at 37°C. On a colony counter, the plate was placed and observed for the presence of micro-organisms. The media used were nutrient agar medium and cetrimide nutrients, agar, saline agar, and MacConkey agar. Result: The present study found microbial contamination in herbal products that are widely available across the country. The formulations coded AV5, AV6, and AV7 were found to be contaminated by Pseudomonas aeruginosa and AV5 and AV6 were found to be contaminated by Escherichia coli, whereas the formulations coded AV1 and AV2 were found to be contaminated by Staphylococcus aureus in above permissible limit, posing a risk of infection if consumed. Conclusion: According to the findings of this study, it shows that few herbal formulations were showing the presence of micro-organism above the permissible of given by the WHO.

Mung beans (Phaseolus radiates L.): Utilization as components of the growth medium Bacillus subtilis

Bacillus subtilis is a bacterial contaminant widely discovered in laboratories and used in educational needs. Synthetic media are relatively expensive, which makes it difficult for microbiology laboratories to meet large-scale bacterial growth media demands. This has encouraged researchers to find alternative media with cheaper and easily available prices, namely Mung Beans, which are known to contain protein nutrients that are good for bacterial growth, which is as much as 24%. The purpose of this study was to determine the potential of mung beans’ alternative media as a medium for bacterial growth. This research is a descriptive study and the sample used is 1 tube of a pure isolate of Bacillus subtilis. The variable of this research is mung beans as an alternative medium for the growth of Bacillus subtilis. The results were obtained by observed macroscopically and microscopically, followed by a carbohydrate fermentation test and an IMViC test. Then showed that the colonies growing on the alternative medium of mung beans were in accordance with the characteristics of the colonies growing on Nutrient Agar medium (control), which indicated that these characteristics were Bacillus subtilis. Based on the research that has been done, it can be concluded that there is a qualitative growth of Bacillus subtilis in mung beans alternative media, which means that mung beans alternative media has the potential as a growth medium for Bacillus subtilis.

Screening of Poly-β-hydroxybutyrate (PHB) Producing Bacteria and yeasts from locally vendored ‘Whey’ biowaste samples

Whey- a byproduct of the manufacture of cheese has several commercial uses. The present study was undertaken to explore the microbial load of the whey and the possible existence of biopolymer (PHB) producing microorganisms in this byproduct. Whey samples collected from different vendors in the locality of Mirpur, Dhaka were brought into laboratory and the microbial load was determined by serial dilution technique using nutrient agar and YEPD medium. From 30 colonies, 32 strains were preliminarily isolated. Out of 32 isolates, fifteen exhibited pink fluorescence on mineral medium, indicating the presence of PHB production inside cells. Among these, seven strains were identified as members of the genera Candida tropicalis; based on molecular characterization. The remaining 8 isolates were bacteria. It is interesting to note that, yeast isolates were obtained from locally vendored samples whereas bacterial strains were predominant in commercial samples. This work can be considered as the first step in the development of an ecofriendly bio-refinery pathway for cheese industry.

Gıda Tuzlarında Halotolerant Bakterilerin İncelenmesi

Twenty-five food salts, collected from seven-country, were examined for moisture contents and ash contents, pH values, total numbers of bacteria, and total numbers of bacteria halotolerant bacteria. The growth and biochemical reactions of halotolerant bacteria at different NaCl concentrations, pH, and temperature values were investigated. The efficacy of dry-heat sterilization and high-pressure steam sterilization for the inactivation of bacteria was examined using six food salts. Moisture contents, ash contents, and pH values of salts were respectively found as 2.3-3.7%, 95-97%, and 6.37-9.94. Total numbers of bacteria and halotolerant bacteria were detected as between 1-58 CFU/g and 1-40 CFU/g on Modified Nutrient Agar media, respectively. While bacteria were found in twenty salt samples, halotolerant bacteria were detected in seventeen samples. One hundred thirty- eight rod-shaped halotolerant bacteria were isolated from seventeen samples. One hundred eighteen and twenty isolates were found Gram-positive and Gram-negative, respectively. While 131 isolates were motile, seven isolates were observed as non-motile. All isolates grew in both absence of NaCl and presence of 10% NaCl, pH 5, 7, and 9, 24°C, and 37°C. Eighty-six isolates showed different pigmentations. Ammonia production was detected at sixty isolates. Catalase, oxidase, protease, lipase, amylase, caseinase were produced by 138, 83, 84, 48, 92, 100 isolates, respectively. Fifty-seven percent of halotolerant bacteria formed endospores. All bacteria in six salts were killed using both dry-heat sterilization (175oC for 2 hours) and high-pressure steam sterilization (121oC for 30 minutes). In conclusion, we suggest using dry-heat sterilization or high-pressure steam sterilization to kill Gram-negative halotolerant bacteria containing endotoxin and Gram-positive halotolerant bacteria with endospores in food salts to prevent food spoilage and foodborne diseases in humans.

Medicinal plants available in local markets contaminated with human pathogenic bacteria - Bacillus cereus and Pseudomonas gessardii

Medicinal plants are known to be a potential source of therapeutic aids. Different uses of medicinal plants have attained a powerful role in health system throughout the world. To study the microbial risk factor associated with medicinal plants, medicinal plant and part of plant samples (10 from each location) were collected from three different local markets (Nabinagar, Amin Bazar, and Savar) of Savar area, Dhaka, Bangladesh. A total number of fifty five (55) bacterial isolates have been isolated through their growth on Nutrient Agar media. Out of 55 isolates 31 isolates (56%) were identified as Bacillus cereus and 7 isolates (13%) were identified as Pseudomonas sp. through different morphological and biochemical tests. The CFU value of different samples revealed that all the values were higher than the accepted value (recommended by WHO, 2007) of 105 CFU/g except Phyllanthus emblica. The PCR and 16S rRNA sequencing confirmed the identification similarity values among two isolates of B. cereus and Pseudomonas gessardii. Both B. cereus and Pseudomonas gessardii showed sensitivity to the antibiotics Kanamycin, Gentamycin, Tigecycline, Ciprofloxacin and Amikacin where resistance to the antibiotics Amoxycilin, Aztreonam, Penicillin-G, Cefixime, Cefotaxime, Cefepime, Ceftriaxone, Meropenem, Cotrimoxazole and Ceftazidime. Therefore, quality assessment of herbal medicines should be ensured to make them safer for human consumption. Asian J. Med. Biol. Res. 2022, 8 (2), 69-78

BAKTERI PENGHASIL AMILASE YANG DIISOLASI DARI EKOENZIM LIMBAH BUAH-BUAHAN

Many of potential enzymes can be found in the ecoenzyme, one of them is amylase. Amylase is an enzyme that is able to hydrolize the glycoside bonds of starch or starch into dextrin, glucose and maltose which is widely used in various industries such as beverages. This study aims to isolate the ecoenzyme bacteria and test their ability to produce amylase. Isolation of ecoenzyme bacteria was carried out using serial dilution methods 10-1, 10-3, 10-5. A total of 0.1 ml of each dilution series was pipetted and spread on the Nutrient agar (NA) medium. The bacterial isolates that grew were then purified and identified by morphological observation, Gram staining and their enzymatic activity was tested using Starch Agar (SA) media qualitatively. The results of this study showed there were 39 bacterial isolates from ecoenzyme with different morphological characteristics. The amylase activity test were found that 34 isolates had a positive activity to hydrolize the starch in the SA media which was indicated by the formation of a clear zone around the bacterial colonies. Each bacterial isolate had a different hydrolysis index value, which ranged from 9.45 to 23.65. The highest clear zone diameter index value from starch hydrolysis was EJM 15 isolate.

First Report of Dickeya fangzhongdai Causing Peduncle Soft Rot of Banana in China.

Banana (Musa spp.) is a popular fruit all over the world, and it's also an important cash crop with a planting area of 358,924 ha in southern China. In July 2020, a peduncle soft rot disease occurred on dwarf banana (Musa sp. cv. Guangfen) in Guigang city (N22°50'29″, E109° 43'34″), Guangxi province, China. More than 20% plants were infected in the banana plantation. The first external sign of the disease appeared on the incisional wound after the flower bud was cut off from the peduncle. The symptom initially appeared as a black lesion on the wound, then extended into the internal tissue of the whole peduncle. In the later stages, the internal tissue became soft and rot, occasionally formed a necrotic cavity, and eventually led to the black rot of the whole peduncle with a foul smell. To isolate the pathogen, the internal lesion tissues of 5 mm × 5 mm were collected between the border of symptomatic and healthy tissue, treated with 75% ethanol for 10 s, and 0.1% HgCl2 for 3 min, then rinsed with sterile water for three times. Sterilized tissue fragments were cut to pieces with sterilized surgical shears and soaked in 5 mL sterile water, then shaken for 10 min in a vortex oscillator. The suspension was diluted 1000 times with sterilized water，then plated on nutrient-agar medium and incubated at 28℃ in darkness for 24 h. Among the 32 isolates, 23 pure bacterial cultures with similar morphology were predominantly obtained from the samples. These bacteria were gram-negative, and their colonies were initially yellowish white with irregular edges and smooth surfaces, then turned to grayish blue after 72 h incubated at 28℃. The representative isolates GZF2-2 and GZF1-8 were selected for further identification. Genomic DNA was isolated from the bacteria and the 16S rDNA was amplified with primers 27F/1492R (Weisburg et al. 1991) and sequenced. The obtained sequences (GenBank Accession No. MZ768922 and OK668082) showed >99% identities to several records of Dickeya fangzhongdai deposited in NCBI GenBank (1400/1404 bps for GZF2-2 to KT992690, 1409/1417 bps for GZF1-8 to MT613398) based on BLAST analysis. In addition, the recA, fusA, gapA, purA, rplB, dnaX genes and the 16S-23S intergenic spacer (IGS) regions of the two isolates were also amplified and sequenced (GenBank Accession Nos. OK634381-OK634382, OK634369- OK634370, OK634373-OK634374, OK634377-OK634378, OK634385-OK634386, OK634365- OK634366 and OK631722-OK631723) as described by Tian et al. (2016). All the DNA sequences matched that of D. fangzhongdai strains JS5T (percent identities>99.06%), PA1 and ECM-1 in GenBank. Neighbor-joining phylogenetic analysis by software MegaX (Kumar et al. 2018) based on the 16S rDNA sequences revealed that the two isolates were in the same clade with reported D. fangzhongdai strains. Multilocus sequence analysis of the other seven regions also showed the two representative isolates were belong to D. fangzhongdai. Therefore, the isolates were identified as D. fangzhongdai. Pathogenicity of isolate GZF2-2 was investigated to demonstrate Koch's postulate. The end of the banana peduncles of 6 healthy plants were cut off, and 10 mL bacterial suspension (108 CFU/mL) was inoculated to the fresh wound on the plants using sterile brushes. Six control plants were inoculated with sterilized water. All the inoculated peduncles were covered with plastic bags to maintain high humidity. After 28 days, all the peduncles inoculated with strain GZF2-2 showed soft rot symptoms similar to those observed in the field, while the controls remained symptomless. The same bacteria were re-isolated from the symptomatic peduncles and confirmed by sequencing the 16S rDNA. D. fangzhongdai has been reported to cause soft rot on onion (Ma et al. 2020) and bleeding cankers on pear trees (Chen et al. 2020). To the best of our knowledge, this is the first report of D. fangzhongdai causing peduncle soft rot on banana in China.

In-vitro antimicrobial potential of aqueous and metanolic extracts of Piper guineense and Gongonema latifolium on Staphylococcu aureus and Escherichia coli

Plants are rich in different secondary metabolites, such as tannins, terpenoids and alkaloids which have been found in- vitro to have antimicrobial properties. The aim of this study was to determine the in-vitro antimicrobial potential of the methanolic and aqueous extracts of dried leaves of Gongronema latifolium and Piper guineense plants on Staphylococcus aureus and Escherichia coli. Soxhlet extractor was used for the methanolic solvent while cold maceration was used for the aqueous extraction. The phytochemical constituents of these extracts were screened thereafter the extracts were tested for their antimicrobial activity. The technique of agar well diffusion was employed. Wells was made on nutrient agar media and the extracts were placed in the well. Concentration of 1.25mg/ml, 2.5mg/ml, 5mg/ml and 10mg/ml were used. Surface of agar is inoculated (using sterile swab dipped into standardized broth culture of the test organism). Thereafter, the wells were bored into the inoculated agar and the extracts delivered into the well. After allowing for diffusion, the plates were incubated, after which the zones of inhibition around the well measured with the aid of vernier caliper. Activity of the extract against the test organism was expressed in terms of size (mm) of inhibition zone diameter around the well. The presence of alkaloids, flavonoids, tannins, saponins, and phenol in both plant extracts was observed. The aqueous extract of P. guineense and G latifolium showed more presence of phytochemical constituents than the methanolic extract and this is evidenced by higher zones of inhibition. Methanolic extracts of Piper guineense showed visible clearance suggestive of antibacterial activities by the extract only at 10mg/ml on S. aureus, but no form of inhibition on E. coli. Both extracts have concentration dependent antimicrobial effect on Staphylococcus aureus and Escherichia coli, and this may be due to phytochemicals found in them

Implications of Leather Tanning Wastewater Exposure for Soil Bacteria Viability and Phosphate Solubilizing Activity

Leather tannery wastewater pollutes the environment because it contains BOD, COD, and chromium at levels above safe thresholds. The main objective of this study was to determine the effect of exposure to tannery wastewater on the viability of the soil PSB community and selected PSB isolates, and to examine the ability of selected bacterial isolates to dissolve phosphate in Picovskaya’s broth medium supplemented with tannery wastewater. The viability of the bacterial community was determined based on their growth in soil exposed to the waste at concentrations of 30, 60 and 100%, under field capacity moisture conditions, while the ability of the isolates to dissolve phosphate was observed using liquid Pikovskaya’s medium which was added to the waste so that the concentration reached 30, 60, and 100%. The bacterial isolates RP-1 and RP-2 were used, which were obtained from the soil surrounding the tannery which was contaminated with leather tanning waste. The parameters that were analyzed were the number of cells and the amount of soluble phosphate. The number of cells was determined through the pourplate method using an agar nutrient medium, and the amount of soluble phoshate was examined using the P chlorostannous reduced molybdophosphoric acid blue method. According to the findings of this study, exposure to effluents reduced PSB viability in the soil. Exposure to waste also negatively affected cell viability and the ability of isolates to solubilize phosphate.
 Keywords: Wastewater, tannery, viability, ability, phosphate, solubilization

Screening of Plant Growth-Promoting Halotolerant Bacteria Isolated from Weeds Rhizosphere Grown in Saline Soil

This study aimed to screen and characterize halotolerant bacterial isolates, which could enhance plant growth performance in saline soil. Halotolerant bacteria was isolated from weeds rhizosphere grown in saline soil of coastal agricultural land located at Brondong District, Lamongan Regency, East Java Province, Indonesia. This research was conducted from June to September 2018. Seven bacterial isolates can grow in a Nutrient Agar medium containing 10% of NaCl, suggesting that these bacteria were halotolerant. Furthermore, all bacterial isolates were shown to produce indol acetic acid (IAA) and do not induce a hypersensitive response when infiltrated into tobacco leaves. These results explain that these bacteria had potency as plant growth-promoting rhizobacteria (PGPR) and were not tend to be the plant pathogen. The growth of seedlings when inoculated in cucumber seed grown in saline media were higher than those in control. This result suggests that the halotolerant bacteria can enhance the development of cucumber seedlings in saline stress conditions. Three potential halotolerant bacteria i.e., SN22, SN23, SN26 were selected and molecularly identified as Bacillus megaterium, Bacillus sp., and B. megaterium, respectively.

Гігієнічно-епідеміологічна оцінка мікологічної контамінації повітря житлових та громадських приміщень

Objective: analysis of microbiological contamination of air in residential and public premises and determination of the content of mold fungi. Materials and methods: Saml'air Lite, manufactured by AES CHEMUNEX, France, was used to examine the indoor air (60) and public (63) for microbiological indicators (number of fungi and bacteria). Nutrient media were used: dense nutrient medium nutrient agar and dense nutrient medium Saburo agar with glucose and chloramphenicol. The obtained arithmetic mean number of colonies in each room was counted per 1 m3 of air. Statistical processing of the results was performed using the program STATISTICA 8, Microsoft Exel. Results: Microbiological, including mycological, indoor air contamination was studied. An average of 205 CFU/m3 of microscopic fungi and 1,073 CFU/m3 of mesophilic aerobic and facultative anaerobic microorganisms (QMAFAnM) were isolated in residential premises without visible signs of biodamage, which was 8,9 times and 2,5 times less respectively than in rooms with bio-damage, where the number of microscopic fungi was 1824 CFU/ m3, and QMAFAnM - 2730 CFU/m3. It was found that the air in the premises of the surveyed children's institutions in 45,7% of cases was classified as "conditionally clean" (from 200 to 500 CFU / m3 of molds), the air "heavily polluted" was attributed to 40,0%. In office premises, 61,5% was classified as "conditionally clean" in terms of the level of mold contamination. In the air environment of "infected apartments" the presence of the number of fungi: Aspergillus srp. 7.3 times (from 11 ± 1 to 80 ± 3 CFU / m3), Cladosporium spp. – 18,9 times (from 28 ± 3 to 530 ± 24 CFU / m3), Penicillium spp. - 5.2 times (from 212 ± 14 to 1100 ± 80 CFU / m3), Mucor spr. – 5,4 times (from 13 ± 2 to 70 ± 4 CFU / m3), Acremonium spp. – 4,8 times (from 25 ± 3 to 120 ± 10 CFU / m3) and Fusarium cpp. – 4,3 times (from 21 ± 1 to 90 ± 5 CFU / m3) compared to premises without visible signs of microscopic contamination. Conclusion. According to the results of research, it was found that in the air of residential and public premises exceeded the safe level of mold in 40% of cases.

Effect of sodium chloride on basidiospore germination and vegetative mycelial growth of the ectomycorrhizal fungus Rhizopogon roseolus.

Rhizopogon roseolus is a basidiomycetous ectomycorrhizal fungus that inhabits mainly coastal areas. Understanding the response of this fungus to salinity at each stage of its life cycle will lead to elucidation of the strategies for its propagation. This study examined the effect of sodium chloride (NaCl) on basidiospore germination and mycelial growth of both homokaryotic and heterokaryotic strains of R. roseolus, on nutrient agar media with varying concentrations of NaCl (0, 50, 150, and 300 mM). Regardless of the presence of NaCl, R. roseolus basidiospores germinated and the germlings grew, forming compatible fusions. In addition, all multispore strains, including homokaryons and heterokaryons, grew under these NaCl conditions. Most of these strains had an effective concentration inhibiting mycelial growth by 50% value greater than 300 mM of NaCl. These results indicate that R. roseolus can germinate, grow, and mate in the presence of NaCl, allowing it to propagate in saline habitats.

Screening of plant growth-promoting bacteria isolated from sugarcane

Plant growth-promoting bacteria (PGPB) are known to establish positive relationships with plants. They act in favoring plant nutrition, production of phytohormones, control of pathogens and enhancement of stress tolerance. Thus, this study aimed to isolate bacteria from soil, rhizosphere, and root endosphere from sugarcane cultivated in the Southeastern of Brazil, to prospect strains with potential for plant growth promotion. The samples were plated in Nutrient Agar medium, and the morphologically distinct colonies were isolated and analyzed about indoleacetic acid production, phosphate solubilization and the growth control of the phytopathogenic fungus Fusarium verticillioides. A total of 219 isolates were obtained, of which 86 from soil, 67 from rhizosphere and 66 from sugarcane root endosphere. The strains that presented more than one mechanism of plant growth promotion were identified by the sequencing of 16S gene. Most species belonged to the genus Bacillus, which has strains already used in various biological products for the control of diseases in agriculture. Some Bacillus species isolated in our study have never been isolated from sugarcane, and others have been studied for the first time as plant growth promoters. The isolated strains constitute an important microbial bank to be explored to compose innovative products for agriculture.