Coat Protein Nucleotide Sequences Research Articles

Plant virus diversity in bee and pollen samples from apple (Malus domestica) and sweet cherry (Prunus avium) agroecosystems.

Honey bee (Apis mellifera) pollination is widely used in tree fruit production systems to improve fruit set and yield. Many plant viruses can be associated with pollen or transmitted through pollination, and can be detected through bee pollination activities. Honey bees visit multiple plants and flowers in one foraging trip, essentially sampling small amounts of pollen from a wide area. Here we report metagenomics-based area-wide monitoring of plant viruses in cherry (Prunus avium) and apple (Malus domestica) orchards in Creston Valley, British Columbia, Canada, through bee-mediated pollen sampling. Plant viruses were identified in total RNA extracted from bee and pollen samples, and compared with profiles from double stranded RNA extracted from leaf and flower tissues. CVA, PDV, PNRSV, and PVF coat protein nucleotide sequences were aligned and compared for phylogenetic analysis. A wide array of plant viruses were identified in both systems, with cherry virus A (CVA), prune dwarf virus (PDV), prunus necrotic ringspot virus (PNRSV), and prunus virus F (PVF) most commonly detected. Citrus concave gum associated virus and apple stem grooving virus were only identified in samples collected during apple bloom, demonstrating changing viral profiles from the same site over time. Different profiles of viruses were identified in bee and pollen samples compared to leaf and flower samples reflective of pollen transmission affinity of individual viruses. Phylogenetic and pairwise analysis of the coat protein regions of the four most commonly detected viruses showed unique patterns of nucleotide sequence diversity, which could have implications in their evolution and management approaches. Coat protein sequences of CVA and PVF were broadly diverse with multiple distinct phylogroups identified, while PNRSV and PDV were more conserved. The pollen virome in fruit production systems is incredibly diverse, with CVA, PDV, PNRSV, and PVF widely prevalent in this region. Bee-mediated monitoring in agricultural systems is a powerful approach to study viral diversity and can be used to guide more targeted management approaches.

Carlavirus Species Infecting Hop Plants in Italy: Molecular Identification and Phylogenetic Analyses of the Detected Isolates.

Hop (Humulus lupulus L.) is a minor ingredient in the beer production but has a strong influence on the beer quality due to the high chemical complexity of the cones used in brewing. One of the major factors that can severely affect the chemical composition of the hop cones and their marketability is the presence of viral infections in the plant. Amongst the five major hop viruses, three belong to the Carlavirus genus: hop mosaic virus (HpMV), hop latent virus (HpLV), and American hop latent virus (AHLV). The occurrence of carlaviruses on hop germplasm in Italy was firstly recorded in 2017 but, in that context, a generic detection was only performed and no information on the infecting Carlavirus species was provided. To fill this gap, 51 hop samples previously found infected by carlaviruses were analysed by RT-PCR employing primer pairs specific for the coat protein (CP) of HpMV, HpLV and AHLV, respectively. HpLV resulted largely prevalent as it was detected in 96.1% of tested samples whereas for HpMV and AHLV an infection rate of 5.9% and 3.9% was recorded, respectively. CP nucleotide sequences from 13 selected virus isolates were obtained and analysed; moreover, the complete genome sequence of 7 isolates was obtained by using high throughput sequencing (HTS). Phylogenetic analysis showed close relationships among isolates from different geographical origin, including European and non-European countries, according to the worldwide movement of hop germplasm due to global trade. This is the first report of HpMV, HpLV and AHLV on hop germplasm in Italy.

Tomato chlorosis virus infecting Luffa cylindrica and Citrullus lanatus in China.

Sponge gourd (Luffa cylindrica) and watermelon (Citrullus lanatus) are important cash crops in China. In September 2015, interveinal yellow spots and chlorosis, suspected to be caused by the tomato chlorosis virus (ToCV; genus Crinivirus), were observed on sponge gourd and watermelon plants in six greenhouses in the cities of Shouguang, Dezhou, and Taian (2 greenhouses in each city) of Shandong Province. The incidences of the disease in sponge gourd and watermelon greenhouses were 10% to 20%. To identify causative pathogens, 20 sponge gourd and 15 watermelon samples were collected from cucurbit plant facilities in Shandong Province, China. Total RNA was extracted from the samples using RNA simple Total RNA kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer's protocol. Reverse transcription-polymerase chain reaction (RT-PCR) of ToCV was performed using To-CP-forward (ATGGAGAACAGTGCTGTTGC)/To-CP-reverse (TTAGCAACCAGTTATCGATGC) primer pair (Hirota et al. 2010). DNA fragments of approximately 780 bp were detected in all sponge gourd and watermelon samples. The fragments were inserted into pMD18-T vector (Takara, Shiga, Japan), which was subsequently transformed into Escherichia coli DH5α. Sponge gourd (n=1; ToCV-sponge gourd) and watermelon (n=1; ToCV-watermelon)-positive samples were selected for Sanger sequencing. BLASTN comparison of the sequencing results confirmed the presence of ToCV. The sequencing results were processed using DNAMAN version 6.0 (Lynnon Biosoft, USA) and submitted to the GenBank database (https://www.ncbi.nlm.nih.gov/). The phylogenetic tree based on ToCV coat protein (CP) was constructed using amplified ToCV-sponge gourd, ToCV-watermelon, and ToCV representative sequences in GenBank database. According to the results, the ToCV sponge gourd and watermelon sequences belonged to an independent branch with the Chinese ToCV isolate (KC812619). Sequence analysis based on nucleotide sequences of ToCV CP demonstrated that ToCV-sponge gourd and ToCV-watermelon isolates shared the highest nucleotide sequence identity of 99.7% with the Chinese isolate (KC812619). To assess the transmissibility of ToCV, virus-free whiteflies (Bemisia tabaci) (n = 30) were placed for one day on ToCV-infected sponge gourd and watermelon plants for virus acquisition. Thereafter, whiteflies were transferred onto the virus-free sponge gourd (cv. 'Changlv', 4-leaf-stage, n = 6 for each of the control, ToCV treatment) and watermelon (cv. 'ZaoJia 8424', 4-leaf-stage, n = 6 for each of the control, ToCV treatment) seedlings for one day. Three weeks later, all plants from tested group showed same symptoms as those observed in the greenhouses, whereas plants in the control group were symptom-free. RT-PCR analysis confirmed the ToCV infection in sponge gourd and watermelon plants, whereas control plants were found uninfected. ToCV infection in sponge gourds and watermelons has not been reported previously. To the best of our knowledge, this is the first report of sponge gourd and watermelon being natural hosts of ToCV worldwide. We believe that spread of ToCV in cucurbits needs attention.

Genetic Variability of Some Tomato Yellow Leaf Curl Virus Isolates and the Effect of the Virus on the Tomato (Solanum lycopersicom L.) Plant Content of Some Mineral Elements

This study was conducted to isolate and identify three isolates of Tomato yellow leaf curl virus (TYLCV), infecting tomato, using polymerase chain reaction technology (PCR) and determining the nucleotide sequences produced by PCR- amplified products to determine the genetic similarity and differences amongst the virus isolates. It also aimed to analyze the plant content of mineral elements: magnesium, calcium, sodium, and potassium to determine the effect of the virus on the plant content of these elements. The laboratory experiments mentioned in this study were carried out in the Plant Virology Laboratory of the Plant Protection Department at the College of Agriculture/ Karbala University. Analysis of the mineral elements was carried out in the Soil Laboratory, College of Agriculture/ University of Kufa. A greenhouse experiment was also carried out to investigate the response of some tomato genotypes against TYLCV during the agricultural season 2018-2019. Results of PCR amplification by the CP-F and CP-R primer pair revealed the possibility of amplifying a 789bp product from each TYLCV isolate isolated from some farms located in some desert areas in Najaf and Karbala governorates. Analysis of the sequences resulting from the PCR-amplified products obtained from the viral isolates (5, 8, and 10) by BLAST Basic Local Alignment Search Tool (BLAST) indicated that all these viral isolates diagnosed in this study belong to TYLCV. TYLCV isolates 5 and 8 obtained from Najaf province had a 100% similarity in the sequences of PCR-amplified products amplified from the TYLCV coat protein. These isolates gave a difference (96%) in the coat protein nucleotide sequence of the virus isolate 10. Furthermore, analysis of some mineral elements in plants infected with TYLCV showed a decrease in the concentrations of magnesium and calcium and an increase in the concentrations of elements sodium and potassium with a significant difference from their normal concentrations in the non-infected plants.

Genetic diversity and population structure of Iranian Beet yellows virus based on the nucleotide sequences of coat protein

Genetic diversity and population structure of Iranian Beet yellows virus based on the nucleotide sequences of coat protein

Rapid detection of Broad bean wilt virus 2 and Turnip mosaic virus in Pseudostellaria heterophylla by reverse transcription loop‐mediated isothermal amplification assay

AbstractPseudostellaria heterophylla (P. heterophylla) is a widespread Chinese herb that is widely used as medicine, especially for the treatment of lung disease and nourishing the spleen. Broad bean wilt virus 2 (BBWV2) and Turnip mosaic virus (TuMV) threaten the quality and yield of P. heterophylla. To improve the detection efficiency of P. heterophylla viral disease pathogens, a rapid, simple, intuitive, accurate, sensitive and economical reverse transcription loop‐mediated isothermal amplification (RT‐LAMP) method was established. Primers were designed based on the conserved sequences of BBWV2 and TuMV coat protein nucleotide sequences. The specificity of the primers and sensitivity of the LAMP method to the cDNA template were analysed by real‐time fluorescence‐based quantitative PCR, SYBR Green I staining, and agarose gel electrophoresis. No cross‐reactions occurred with other viruses tested in P. heterophylla. The detection limit of RT‐LAMP was 10 pg/μl and was found to be 10 times more sensitive on comparing with RT‐LAMP and reverse transcription‐PCR (RT‐PCR). Furthermore, the tube‐closed dye method facilitated the inspection of the LAMP reaction while avoiding cross‐contamination. This detection assay could serve as an important tool for field samples diagnoses and forecasting P. heterophylla viral disease intensities.

Seed Transmission of Three Viruses in Two Pear Rootstock Species Pyrus betulifolia and P. calleryana.

Viral seed transmission causes the spread of many plant viral diseases. Pyrus betulifolia and P. calleryana are important rootstock germplasms for pear production in China. This study revealed the widespread infection of apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and apple stem pitting virus (ASPV) in maternal trees of P. betulifolia and P. calleryana by nested multiplex reverse transcription-polymerase chain reaction (nmRT-PCR) assays. Seeds from eight P. betulifolia and two P. calleryana trees had positive rates of 15.9–73.9%, 0–21.2%, and 40.4% for ASGV, ASPV, and ACLSV, respectively. At the cotyledon and 6–8 true leaf stages, seedlings grown from seeds of infected trees gave positive rates of 5.4% and 9.3% for ASGV, 6.7% and 15.6% for ACLSV, and 0% and 2.7% for ASPV, respectively. Incidence in nursery P. betulifolia seedlings of 10.1%, 5.3%, and 3.5% were determined for ASGV, ACLSV, and ASPV, respectively. The nucleotide sequences of coat protein (CP) and movement protein coding genes of both ASGV and ASPV, and CP gene of ACLSV from maternal trees, seeds, and seedlings were analyzed. Sequence identities and phylogenetic comparison with corresponding sequences from GenBank demonstrated that molecular variation occurred within ASGV, ACLSV, and ASPV isolates, with most sequences determined here had close relationships with reported isolates infecting pear or formed independent clades. This is the first report on the seed transmission and the molecular characteristics of these viruses infecting two rootstock species. These findings provided important evidence in management effort for pear viral diseases.

Population genetic analysis of lettuce big-vein disease viruses and their vector fungi Olpidium virulentus in Ankara province, Turkey

Lettuce big-vein disease (LBVD) is caused by either Mirafiori lettuce big-vein virus (MiLBVV) alone, or co-infected with Lettuce big-vein associated virus (LBVaV). Both viruses are transmitted by the fungal vector Olpidium spp. In the present study, population genetics of these two viruses and their fungal vector, O. virulentus, were analyzed, using the nucleotide sequences of the virus coat protein (CP) partial genes and the internal transcribed spacer (ITS) region of ribosomal DNA (rDNA) of the vector fungi. The analysis was conducted along with all previously reported LBVD viruses and Olpidium spp. populations. We used conventional PCR techniques to identify the viruses in lettuce samples and their fungal vector in soil samples collected from the root zone of field-grown lettuce plants in the Ankara province of Turkey. Phylogenetic analyses showed that LBVD viruses had at least two evolutionary lineages, and Ankara LBVD isolates were more closely related to the European populations. Also, we found that there is a strong negative selection pressure in the partial CP genes of LBVD viruses isolated from Ankara, due to the effective terrestrial climate. The negative selection pressure indicates balancing selection within Turkish isolates and other populations. The population of O. virulentus isolates from Ankara and other geographic regions were branched into five sub-clades, and there was no geographical separation in these isolates. Our analysis also showed Olpidium spp. to be monophyletic, and showed speciation among the isolates.

Genetic diversity analysis of papaya leaf distortion mosaic virus isolates infecting transgenic papaya "Huanong No. 1" in South China.

The commercialized genetically modified papaya “Huanong No. 1” has been utilized to successfully control the destructive virus‐papaya ringspot virus (PRSV) in South China since 2006. However, another new emerging virus, papaya leaf distortion mosaic virus (PLDMV), was found in some PRSV‐resistant transgenic plants in Guangdong and Hainan provinces of South China through a field investigation from 2012 to 2019. The survey results showed that “Huanong No. 1” papaya plants are susceptible to PLDMV, and the disease prevalence in Hainan Province is generally higher than that in Guangdong Province. Twenty representative isolates were selected to inoculate “Huanong No. 1,” and all of the inoculated plants showed obvious disease symptoms similar to those in the field, indicating that PLDMV is a new threat to widely cultivated transgenic papaya in South China. Phylogenetic analysis of 111 PLDMV isolates in Guangdong and Hainan based on the coat protein nucleotide sequences showed that PLDMV isolates can be divided into two groups. The Japan and Taiwan China isolates belong to group I, whereas the Guangdong and Hainan isolates belong to group II and can be further divided into two subgroups. The Guangdong and Hainan isolates are far different from the Japan and Taiwan China isolates and belong to a new lineage. Further analysis showed that the Guangdong and Hainan isolates had a high degree of genetic differentiation, and no recombination was found. These isolates deviated from neutral evolution and experienced population expansion events in the past, which might still be unstable. The results of this study provide a theoretical basis for clarifying the evolutionary mechanism and population genetics of the virus and for preventing and controlling the viral disease.

Occurrence and genetic diversity of groundnut rosette assistor virus in western Kenya

Groundnut (Arachis hypogaea) is an important legume in western Kenya, but yields are low and declining. Pests and diseases are ranked high among the yield reducing factors. Groundnut rosette disease (GRD) is the main disease and can cause up to 100% yield loss. Groundnut rosette disease is transmitted by the groundnut aphid, Aphis craccivora Koch and caused by two synergistic viruses; groundnut rosette assistor virus (GRAV) and groundnut rosette virus (GRV) associated with a satellite-ribonucleic acid (sat-RNA). Inadequate information was available on the occurrence and molecular diversity of GRAV in western Kenya, which is a limiting factor on proper diagnosis and management. This study determined the occurrence and molecular diversity of GRAV on groundnuts in western Kenya. A survey of GRD was conducted in 144 farms in Bungoma and Kakamega counties during the short and long rains of 2016–2017. A total of 301 symptomatic leaf samples were collected and preserved until use. Incidence and severity data was collected and subjected to pairwise comparison of means using the standardized disease diagnostic score sheet at P ≤ 0.05. Screening for resistance/tolerance to GRD was done on five popular legume varieties (Arachis hypogaea, Phaseolus vulgaris, Vigna unquiculata, Glycine max and Vigna radiata) and one solanaceous Physalis peruviana. The plants were monitored for GRD symptoms development in the screenhouse for 8 weeks. Total RNA was extracted from the leaf samples using RNeasy Mini Kit (Qiagen) according to the manufacturers’ protocol. DNA libraries were prepared and sequenced on the MiSeq platform (Illumina). Phylogenetic analyses and comparisons were performed using the MEGA X software. From the sequences obtained, primers were designed for use in RT-PCR. Groundnut rosette disease was prevalent in all the surveyed areas with chlorotic rosette symptoms being dominant followed by green rosette and mosaic rosette. Groundnut rosette disease incidence ranged between 31 and 67%, but was higher in Bungoma (67%) than Kakamega (61%) county, while the short rains had higher incidence than the long rains season. All screened indicator plants developed typical GRD viral symptoms and tested positive for GRAV. Nucleotide sequences of GRAV coat protein (CP) gene revealed 97–99% identity among the western Kenya isolates and those from Ghana, Malawi and Nigeria respectively. The fact that GRD occurs wherever groundnuts are grown in western Kenya, is of great concern and may be the reason for the observed low yields. Incorporation of GRD resistance genes in the local cultivars/varieties may be the only practical solution.

First report of cucurbit aphid-borne yellows virus on cucumber in Java, Indonesia

Chlorosis and yellowing with green-vein banding on older leaves were observed in surveys of cultivated cucumber fields in 2016 in Java, Indonesia. Initial dot immuno-binding assays detected seven different viruses varying in frequency among over 500 samples from 27 locations. Cucurbit aphid-borne yellows virus (CABYV) was detected at a frequency approaching 100% in four provinces in Java. The coat protein nucleotide and amino acid sequences of four isolates had highest identity with that of CABYV isolate Aileu in East Timor. This is the first report of CABYV infection of cucumber in Indonesia.

Distribution and phylogenetic analysis of the 3′UTR and coat protein gene of Iranian Beet black scorch virus

Beet black scorch virus (BBSV) was surveyed in major sugar beet cultivation areas in Iran in 2008–2013 growing seasons. A total of 148 out of 308 samples (48%) collected in seven Iranian provinces were BBSV-infected, as shown by RT-PCR. To investigate the genetic diversity of Iranian BBSV isolates, sequences of the coat protein (CP) gene and of the 3′ untranslated region (3′UTR) were compared to corresponding sequences in GenBank. The CP nucleotide sequence identity among Iranian isolates was 87.9–99.9%. They shared nucleotide sequence identities of 88–89.8% with those of other BBSV isolates available at GenBank. Phylogenetic analyses of CP sequences demonstrated that Iranian isolates were distant from Chinese and US isolates at both nucleotide and amino acid levels. Three isolates from western provinces of the country showed independent divergent lineage compared with other Iranian isolates. Comparison of 3′UTR region of BBSV indicated that all Iranian isolates, except four isolates from the west of the country, were distinct from European, Chinese, and US isolates. Population genetic analyses revealed that BBSV populations from west of Iran had distinct evolutionary divergence and differentiated from eastern BBSV isolates. Our results indicated that purifying selection might have contributed to evolution of the isolates belonging to the four identified BBSV subgroups with infrequent genetic exchanges occurring between them. Phylogenetic analyses and estimation of genetic distance indicated that Iranian isolates in both CP and 3′UTR genomic regions had wider genetic diversity than isolates from other parts of the world. Based on the result of phylogenetic and population analyses, we suggest discriminating two different groups, namely BBSV western and BBSV eastern strains.

Bağlarda Yeni Saptanan Virüslerin Hatay ve Tekirdağ İli Bağ Alanlarında PCR Yöntemiyle Belirlenmesi ve Moleküler Karakterizasyonu

Son yıllarda yeni nesil sekans analiz tekniklerinin yaygın olarak kullanılması bağlarda ve diğer bitki türlerinde etiyolojisi bilinmeyen birçok virüs hastalığının etmeninin belirlenmesini sağlamıştır.. Bağlarda bu teknoloji ile saptanan yeni virüslerden en önemlileri Grapevine Pinot Gris Virus (GPGV), Grapevine Syrah Virus-1 (GSyV-1), Grapevine Red-blotch associated Virus (GRBaV) ve Grapevine Roditis Leaf Discoloration Virus (GRLDaV)‘dür. Bu çalışmanın amacı Tekirdağ ve Hatay ili bağ alanlarında GPGV, GSyV-1, GRBaV ve GRLDaV varlığının PCR ve DNA dizileme yöntemleriyle saptanması ve karakterizasyonlarının yapılmasıdır. Bu çalışma kapsamında virüs benzeri simptom gösteren omcaların yanı sıra simptomsuz omcalardan da örnekler alınmış ve toplam olarak Tekirdağ ilinden 191, Hatay ilinden ise 111 örnek toplanmıştır. Tekirdağ ilinden toplanan bağ örneklerinde %43,62 oranında GPGV, %1,04 oranında GSyV1 saptanmıştır. Hatay ilinden toplanan örneklerde ise sadece %0,9 oranında GSyV1 saptanmış ve testlenen örnekler GPGV, GRBaV, GRLDaV açısından temiz bulunmuştur. Tekirdağ örneklerinin GPGV için yapılan RT-PCR analizlerinde kısmi kılıf protein, hareketlilik, ve replikaz genlerini çoğaltan primerler kullanıldığında sırasıyla 411 bp, 302 bp ve 618 bp büyüklüğünde PCR ürünleri elde edilmiştir Bu ürünlerin doğrudan iki yönlü sekans analizi sonucunda ve her üç gen bölgesinin de nükleotid dizilimlerinin gen bankasında kayıtlı farklı GPGV izolatları ile yüksek oranda homoloji gösterdiği saptanmıştır.

Distribution and molecular characterization of Citrus leaf blotch virus from Actinidia in Shaanxi province, China

Kiwi fruit (Actinidia spp.) is one of the most important fruit crops in the world. Shaanxi is the largest kiwi fruit growing area in China. In this study, field investigation and virus detection showed that Citrus leaf blotch virus (CLBV) commonly occurred in Shaanxi Province and the average incidence rate was 28.53%. In total, some 60 complete nucleotide sequences of movement protein (MP) and coat protein (CP) genes of CLBV were obtained from different regions of Shaanxi. Phylogenetic analysis showed that CLBV had obvious host specialization. The study of CLBV isolates in kiwi fruit preliminarily revealed that CLBV was not significantly associated with the host’s geographic location. The results provide important information for further clarifying the distribution and genetic diversity of CLBV in regions of kiwi fruit production in Shaanxi and lay the foundation for in-depth study of the molecular characteristics and epidemiology of the virus.

First report of Cassava brown streak viruses on wild plant species in Mozambique

Cassava brown streak disease (CBSD) caused by Cassava brown streak virus (CBSV) and Ugandan cassava brown streak virus (UCBSV) is the main constraint to cassava (Manihot esculenta Crantz) production in Mozambique. Using RT-PCR to amplify partial coat protein nucleotide sequences, we detected for the first time the occurrence of CBSV in two non-cassava perennial wild plant species: Zanha africana (Radlk.) Exell. and Trichodesma zeylanicum (Burm.f.) R.Br., that occur widely within and near cassava fields in Nampula, Zambezia, Niassa and Cabo Delgado provinces. In addition, we also detected CBSV and UCBSV in Manihot carthaginensis subsp. glaziovii (Müell-Arg.) Allem., a wild cassava relative. These findings were verified in biological assays through mechanical inoculation of CBSV to T. zeylanicum, albeit at low rates of infection. Phylogenetic analysis clustered the CBSV isolates from the non-cassava plant species with those from cultivated cassava, with high sequence homology among CBSV (91.0–99.6%) and with UCBSV (84–92%) isolates. These results provide definitive evidence of a wider host range for CBSV and UCBSV in Mozambique, indicating that these viruses are not restricted to cultivated cassava. Our findings are key to understanding the epidemiology of CBSD and will aid in the development of sustainable management strategies for the disease.

Characterization of alfalfa virus F, a new member of the genus Marafivirus.

Viral infections of alfalfa are widespread in major cultivation areas and their impact on alfalfa production may be underestimated. A new viral species, provisionally named alfalfa virus F (AVF), was identified using a virion-associated nucleic acid (VANA) metagenomics-based approach in alfalfa (Medicago sativa L.) samples collected in Southern France. The nucleotide sequence of the viral genome was determined by de-novo assembly of VANA reads and by 5’/3’ RACE with viral RNA extracted from enriched viral particles or with total RNA, respectively. The virus shares the greatest degree of overall sequence identity (~78%) with Medicago sativa marafivirus 1 (MsMV1) recently deduced from alfalfa transcriptomic data. The tentative nucleotide sequence of the AVF coat protein shares ~83% identity with the corresponding region of MsMV1. A sequence search of the predicted single large ORF encoding a polyprotein of 235kDa in the Pfam database resulted in identification of five domains, characteristic of the genus Marafivirus, family Tymoviridae. The AVF genome also contains a conserved “marafibox”, a 16-nt consensus sequence present in all known marafiviruses. Phylogenetic analysis of the complete nucleotide sequences of AVF and other viruses of the family Tymoviridae grouped AVF in the same cluster with MsMV1. In addition to 5’ and 3’ terminal extensions, the identity of the virus was confirmed by RT-PCRs with primers derived from VANA-contigs, transmission electron microscopy with virus-infected tissues and transient expression of the viral coat protein gene using a heterologous virus-based vector. Based on the criteria demarcating species in the genus Marafivirus that include overall sequence identity less than 80% and coat protein identity less than 90%, we propose that AVF represents a distinct viral species in the genus Marafivirus, family Tymoviridae.

Development and validation of PCR assays for detection of alfalfa dwarf disease-associated viruses in Australian lucerne pastures

In 2010, a severe disease of lucerne (Medicago sativa L.) named alfalfa dwarf disease (ADD) was reported in Argentina. High throughput sequencing of diseased plants indicated the presence of five viruses, the (−) ssRNA virus, alfalfa dwarf virus (ADV), the (+) RNA viruses, alfalfa mosaic virus (AMV), bean leafroll virus (BLRV) and alfalfa enamovirus 1 (AEV-1) and the ssDNA virus, alfalfa leaf curl virus (ALCV). In this study, we determined which ADD-associated viruses are present in Australian lucerne that showed diverse virus-like symptoms. A duplex RT-PCR was developed for simultaneous detection of ADV and AMV using a cloned non-infectious ADV RNA fragment as positive control. Similarly, the presence of BLRV and AEV-1 was determined by duplex RT-PCR, and ALCV by PCR. Only AMV and BLRV that are endemic to Australia were detected. None of the novel exotic viruses ADV, AEV-1 and ALCV were detected in lucerne samples collected between 2015 and 2017. However, AMV and BLRV were detected in 78% and 70% of tested samples, respectively. Based on analysis of coat protein (CP) nucleotide sequences, Australian BLRV isolates are closely related to each other and to the Argentine Manfredi isolate. Phylogenetic analyses based on CP gene nucleotide sequences confirmed separation of AMV isolates into two subgroups. The majority of AMV isolates, including all those from Argentina and Australia, clustered in subgroup I with isolates from various hosts and geographic origins. All Australian AMV isolates were closely related to AMV isolated from ADD-affected lucerne in Argentina.

RT-PCR-based detection and partial genome sequencing indicate high genetic diversity between CBSV and UCBSV in Kenya

Cassava is grown by small-scale farmers and consumed by over 200 million people in sub-Saharan Africa mainly as staple food. An emerging viral disease Cassava brown streak disease (CBSD) caused by Cassava brown streak virus (CBSV) and Ugandan cassava brown streak virus (UCBSV), has severely affected cassava production and resulted in poor quality tubers. The disease severely affecting root quality both for domestic use and marketing and has become a real threat to the livelihoods of the millions of poor in both eastern and southern African countries. There is also increase in the number of CBSV and UCBSV sequences available now, and a need to have primers that would detect all isolates of CBSV and UCBSV is required, particularly for field surveys. Two sets of virus-specific primers, CBSVF2 & CBSVR7 and CBSVF2 & CBSVR8, were developed to specifically detect CBSV and UCBSV respectively on six glass house maintained isolates and field collected samples from coastal Kenya. Positive samples produced expected PCR products of 345 bp and 441 bp using CBSVF2 & CBSVR7 and CBSVF2 & CBSVR8, respectively. In addition, our study further confirmed the genetic diversity of these viruses by sequencing over 41 new samples from Kenya as well as Tanzania and Zanzibar. The coat protein, partial HAM1 and 3' UTR regions of CBSV and UCBSV were amplified using CBSVF2 & CBSVR1 and CBSVF2 & CBSVR2, respectively. The PCR products of ~1.6 Kb obtained were extracted from gel, cloned and sequenced. The sequences of the UCBSV and CBSV isolates varied in length; 1678 nucleotide for UCBSV isolates and 1615 nucleotide for CBSV isolates. CBSV and UCBSV sequences were used to the construct phylogenetic trees by comparing with other sequences from GenBank. The phylogenetic tree clustered the CBSD isolates in two groups reflecting the two virus species causing CBSD. Based on the available sequences (~1600 bases), the CBSV group shared 93.7% nucleotide identities, UCBSV 93.1%, and there was ~70% identity between the two groups. However, the percentage nucleotide identities for coat protein nucleotide sequences were slightly greater than those observed for the sequences involving partial HAM1 and 3'UTR region. CBSV group shared 94.4% nucleotide identity, UCBSV 93.5% and ~74% identity between the two groups. In conclusion, this study has shown the genetic diversity between CBSV and UCBSV isolates collected from Kenya with those from Tanzania and Zanzibar.Keywords: Brown streak virus, cassava, Kenya

RT-PCR-based detection and partial genome sequencing indicate high genetic diversity between CBSV and UCBSV in Kenya

Cassava is grown by small-scale farmers and consumed by over 200 million people in sub-Saharan Africa mainly as staple food. An emerging viral disease Cassava brown streak disease (CBSD) caused by Cassava brown streak virus (CBSV) and Ugandan cassava brown streak virus (UCBSV), has severely affected cassava production and resulted in poor quality tubers. The disease severely affecting root quality both for domestic use and marketing and has become a real threat to the livelihoods of the millions of poor in both eastern and southern African countries. There is also increase in the number of CBSV and UCBSV sequences available now, and a need to have primers that would detect all isolates of CBSV and UCBSV is required, particularly for field surveys. Two sets of virus-specific primers, CBSVF2 & CBSVR7 and CBSVF2 & CBSVR8, were developed to specifically detect CBSV and UCBSV respectively on six glass house maintained isolates and field collected samples from coastal Kenya. Positive samples produced expected PCR products of 345 bp and 441 bp using CBSVF2 & CBSVR7 and CBSVF2 & CBSVR8, respectively. In addition, our study further confirmed the genetic diversity of these viruses by sequencing over 41 new samples from Kenya as well as Tanzania and Zanzibar. The coat protein, partial HAM1 and 3' UTR regions of CBSV and UCBSV were amplified using CBSVF2 & CBSVR1 and CBSVF2 & CBSVR2, respectively. The PCR products of ~1.6 Kb obtained were extracted from gel, cloned and sequenced. The sequences of the UCBSV and CBSV isolates varied in length; 1678 nucleotide for UCBSV isolates and 1615 nucleotide for CBSV isolates. CBSV and UCBSV sequences were used to the construct phylogenetic trees by comparing with other sequences from GenBank. The phylogenetic tree clustered the CBSD isolates in two groups reflecting the two virus species causing CBSD. Based on the available sequences (~1600 bases), the CBSV group shared 93.7% nucleotide identities, UCBSV 93.1%, and there was ~70% identity between the two groups. However, the percentage nucleotide identities for coat protein nucleotide sequences were slightly greater than those observed for the sequences involving partial HAM1 and 3'UTR region. CBSV group shared 94.4% nucleotide identity, UCBSV 93.5% and ~74% identity between the two groups. In conclusion, this study has shown the genetic diversity between CBSV and UCBSV isolates collected from Kenya with those from Tanzania and Zanzibar.Keywords: Brown streak virus, cassava, Kenya

Detection of Southern tomato virus by molecular hybridisation

AbstractSouthern tomato virus (STV) is a double‐stranded RNA (dsRNA) virus belonging to the genus Amalgavirus from the family Amalgamaviridae. STV has been detected in tomato plants showing symptoms of stunting, fruit discoloration and size reduction, although its role on symptom development is unclear. Also, little is known about the incidence and epidemiology of this virus and how it spreads in tomato crops. In this work, we developed a molecular hybridisation method by using a digoxigenin‐labelled RNA probe based on the nucleotide sequence of the STV putative coat protein which was tested with different procedures for preparation of plant material. This technique was sensitive enough to detect STV from sap extracts (obtained just by grinding in buffer) from different plant tissues such as leaves, fruits, roots and seeds. This procedure is suitable for field surveys since it allows a cheap and quick processing of a high number of samples. Surveys performed in three important tomato production areas (Peninsular Spain, the Canary Islands and Sicily) showed that STV is widely spread, with incidences ranging from 18% to 74% in different local and commercial tomato varieties.