Nucleotide Duplication Research Articles

PO-401 Detection of mutational patterns associated to HR deficiency from low counts of mutations

Introduction A common source of tumorigenesis in several cancer types such as breast and ovarian is a defect in the homologous recombination (HR) machinery. HR defect can be detected by identifying single nucleotide variants (SNVs), deletions, duplications, and other errors generated by the alternative double-strand break repair machineries. However, current diagnostic tools for HR defect relies on copy number changes with reduced sensitivity and specificity, or on the existence of BRCA mutations. While, recent efforts to detect HR defect using mutational signature require a large number of SNVs, beyond what is typically obtained from panel sequencing which is widely used in clinics. Material and methods We developed a computational software called SigMA to identify signatures of HR defect even from low SNV counts. SigMA carries out a multivariate analysis to isolate the effect of a single biological process in the presence of multiple mutagenic processes. The multivariate analysis includes likelihood estimations, which we suggest as novel and sensitive measures, together with commonly used measures such as cosine similarity, and signature amplitudes. First, we determine the signature composition of SNVs in 720 whole-genome sequenced (WGS) breast cancer samples, with non-negative matrix factorization (NMF). Then, a subset of mutations from each sample is selected based on whether they fall within the coverage of the sequencing technique of interest. We optimise our algorithm using the simulated data and considering NMF results as a baseline measurement, and we validate its performance on panel data of 890 breast tumours. Results and discussions Whereas previous attempts in detection of mutational signatures from panel data were limited to cases with a high mutation burden, SigMA can be applied to a large fraction of samples with panel data. On a panel consisting of 410 genes, we were able to dramatically improve the detection of mutational signature of HR defect, with 0.75 (0.5) sensitivity and 0.1 (0.01) false positive rate. SigMA detected 213 cases with HR defect in 890 breast cancer panels. For exome and whole-genome data, the performance of the tool is further improved. Conclusion We developed a tool which extends the applicability of mutational signatures analysis to low counts of mutations. Application of our SigMA algorithm to detect HR defect and other mutational signatures in panel sequencing data will increase the number of cases that may benefit therapeutic agents that target specific classes of genomic alterations.

Genetic diversity of human respiratory syncytial virus circulating among children in Ibadan, Nigeria.

Human respiratory syncytial virus (HRSV) is the most common viral cause of acute lower respiratory tract infections (LRTIs) in infants and young children however, without an effective vaccine licensed for human use till date. Information on the circulating genotypes of HRSV from regions with high-burden of infection is vital in the global efforts towards the development of protective vaccine. We report here the genotypes of HRSV circulating among children in Ibadan, the first of such from Nigeria.Nasopharyngeal and oropharyngeal swabs collected from 231 children presenting with respiratory infections in some health facilities for care as well as those attending immunization centers for routine vaccination in Ibadan, Nigeria were used for the study. The 2nd hypervariable (HVR2) region of the glycoprotein (G) gene of HRSV was amplified and sequenced using HRSV group specific primers. HRSV was detected in 41 out of the 231 samples. Thirty-three of the isolates were successfully subtyped(22 subtype A and 11 subtype B). Fourteen of the subtype A and all the subtype B were successfully sequenced and genotyped. Phylogenetic analysis showed that genotype ON1 with 72 nucleotide (nt) duplication was the major subgroup A virus (11 of 14) detected together with genotype NA2. All the HRSV subtype B detected belong to the BA genotype with characteristic 60nt duplication. The ON1 genotypes vary considerably from the prototype strain due to amino acid substitutions including T292I which has not been reported elsewhere. The NA2 genotypes have mutations on four antigenic sites within the HVR2relative to the prototype A2. In conclusion, three genotypes of HRSV were found circulating in Ibadan, Nigeria. Additional study that will include isolates from other parts of the country will be done to determine the extent of genotype diversity of HRSV circulating in Nigeria.

Immunogenetic factors driving formation of ultralong VH CDR3 in Bos taurus antibodies.

The antibody repertoire of Bos taurus is characterized by a subset of variable heavy (VH) chain regions with ultralong third complementarity determining regions (CDR3) which, compared to other species, can provide a potent response to challenging antigens like HIV env. These unusual CDR3 can range to over seventy highly diverse amino acids in length and form unique β-ribbon 'stalk' and disulfide bonded 'knob' structures, far from the typical antigen binding site. The genetic components and processes for forming these unusual cattle antibody VH CDR3 are not well understood. Here we analyze sequences of Bos taurus antibody VH domains and find that the subset with ultralong CDR3 exclusively uses a single variable gene, IGHV1-7 (VHBUL) rearranged to the longest diversity gene, IGHD8-2. An eight nucleotide duplication at the 3' end of IGHV1-7 encodes a longer V-region producing an extended F β-strand that contributes to the stalk in a rearranged CDR3. A low amino acid variability was observed in CDR1 and CDR2, suggesting that antigen binding for this subset most likely only depends on the CDR3. Importantly a novel, potentially AID mediated, deletional diversification mechanism of the B. taurus VH ultralong CDR3 knob was discovered, in which interior codons of the IGHD8-2 region are removed while maintaining integral structural components of the knob and descending strand of the stalk in place. These deletions serve to further diversify cysteine positions, and thus disulfide bonded loops. Hence, both germline and somatic genetic factors and processes appear to be involved in diversification of this structurally unusual cattle VH ultralong CDR3 repertoire.

Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy.

Objectives:To identify the underlying gene mutation in a large consanguineous Pakistani family.Methods:This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool.Results:Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM) like elevated serum creatine kinase (CK) levels, distal muscle weakness, myopathic changes in electromyography (EMG) and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT) in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X), which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein.Conclusion:A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X) in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

A fatal case of mitochondrial DNA depletion syndrome with novel compound heterozygous variants in the deoxyguanosine kinase gene.

The deoxyguanosine kinase (DGUOK) gene controls mitochondrial DNA (mtDNA) maintenance, and variation in the gene can alter or abolish the anabolism of mitochondrial deoxyribonucleotides. A Chinese female infant, whose symptoms included weight stagnation, jaundice, hypoglycemia, coagulation disorders, abnormal liver function, and multiple abnormal signals in the brain, died at about 10 months old. Genetic testing revealed a compound heterozygote of alleles c.128T>C (p.I43T) and c.313C>T (p.R105*) of the DGUOK gene. c.128T>C (p.I43T) is a novel variant located in exon 1 (NM_080916) in the first beta sheet of DGUOK. Her mother was an allele c.313C>T (p.R105*) heterozygote, which is located in DGUOK exon 2 (NM_080916) between the third and fourth alpha helixes. c.313C>T (p.R105*) is predicted to result in a 173 amino acid residue truncation at the C terminus of DGUOK. There are as many as 112 infantile mtDNA depletion syndrome (MDS) cases in the literature related to DGUOK gene variants. These variants include missense mutations, nucleotide deletion, nucleotide insertion, and nucleotide duplication. Integrated data showed that mutations affected both conserved and non-conserved DGUOK amino acids and are associated with patient deaths.

Genetic characterization respiratory syncytial virus in Kerala, the southern part of India.

Respiratory syncytial virus (RSV) is an important cause of acute lower respiratory tract infection (ALRI) in infants and young children globally. RSV presents two antigenic groups RSV-A and -B. Genetic variability is also very high within each group. RSV circulation varies year to year and even varies among different regions. Data on circulatory pattern of RSV are available from other parts of India except Kerala. The aim of the study was to generate data about groups and genotypes of circulating RSV in Kerala. In this study, RSV positive samples received during January, 2012 to December, 2014 were used for genetic characterization. The samples were tested by using nucleocapsid (N) gene-based conventional multiplex reverse transcriptase polymerase chain reaction (RT-PCR) to identify the RSV group. Genotyping was done by nucleotide sequencing of the C-terminal region of the glycoprotein (G) gene. Out of the 130 patient samples tested, 49 samples were positive for RSV. Among the positive samples, 32 belong to the RSV-A and 17 belong to RSV-B virus. Phylogenetic analysis revealed that all RSV-A sequences (n = 22) belonged to NA1 genotype and five of the sequences showed the novel 72 nucleotide duplication and clustered into the newly designated ON1 genotype. All RSV-B sequences (n = 17) were clustered into the BA (BA9 and 10) genotype. From this study, we concluded both RSV-A and -B were co-circulated in Kerala and RSV-A was observed predominantly in 2012 and RSV-B in 2014. As per our best of knowledge, BA10 genotype is first observed in India.

Mutational spectrum of the SERPING1 gene in Swiss patients with hereditary angioedema.

Hereditary angioedema with C1 inhibitor deficiency (C1-INH-HAE) is a rare autosomal dominant disease caused by mutations in the C1 inhibitor gene SERPING1. Phenotype and clinical features of the disease are extremely heterogeneous, varying even within the same family. Compared to HAE cohorts in other countries, the genetic background of the Swiss HAE patients has not yet been elucidated. In the present study we investigated the mutational spectrum of the SERPING1 gene in 19 patients of nine unrelated Swiss families. The families comprise a total of 111 HAE-affected subjects which corresponds to approximately 70% of all HAE-affected patients living in Switzerland. Three of the identified mutations are newly described. Members of family A with a nucleotide duplication as genetic background seem to have a more intense disease manifestation with a higher attack frequency compared to the other families. Newly designed genetic screening tests allow a fast and cost-efficient testing for HAE in other family members.

Molecular Epidemiology of Respiratory Syncytial Virus A G-Protein for 9 Years and Emergence of ON1 Genotype Having 72 Nucleotide Duplication in Korea

BackgroundRespiratory syncytial virus (RSV) is a major pathogen causing seasonal epidemics of lower respiratory tract infection in young children. The attachment (G) glycoprotein is a major virulence factor and a target of human neutralizing antibodies. The G protein shows the evidence of changes of amino acid over time, making its study important in vaccine development strategies. We aimed to explore the molecular epidemiology of G protein of RSV A in Korea.MethodsOne hundred and thirty-six RSV strains were obtained from children who were hospitalized at Seoul National University Children’s Hospital, from October 2005 to September 2014. The frozen stock viruses were propagated in HEp-2 cells and the infected cell lysates were collected when cytopathic effects were apparent. The polymerase chain reaction and sequencing were performed using cDNA constructed from viral RNA and primers from previous studies. Phylogenetic analysis and putative antigenicity plotting were performed using CLC Main Workbench ver. 6.6.5 software (CLC bio, Aarhus, Denmark).ResultsThe entire G-genes were sequenced from all 136 RSV A strains: most (n = 99, 72.8%) strains had 895 nucleotide-span, but the others (n = 45, 27.2%) had 72 nucleotide (nt) duplication, which are well-known ON1 genotype. On phylogenetic grouping, three different genotypes 1–3 except ON1 were additionally defined. During the 2005–2006 season, the prevalence of genotypes 1, 2, and 3 were comparable (36.4%, 27.3%, and 36.4%, respectively), but genotype 1 became predominate (69.2%) in the 2006–2007 season. The genotype 3 increased since 2007–2008 (80.0%) and was identified exclusively during three consecutive seasons thereafter (2009–2011). In the 2011–2012 season, the first ON1 strain was identified in Korea, and the prevalence increased to 91.7% in the 2012–2013 season, then to 100% thereafter (2013–2015). In spite of 72-nt duplication, the putative antigenicity patterns of G protein were comparable between ON1 genotype and the others.ConclusionOur findings highlight the genotype change of circulating RSV A in 3–4 years interval, which might explain the reason for annual local epidemics of RSV A. Also in Korea, RSV A ON1 genotype increased since 2011 and was circulating exclusively since 2013.Disclosures All authors: No reported disclosures.

Variation in Copy Number of MTUS1 Gene among Healthy Individuals and Cancer Patients from Gujarat

Genome variations in the form of single nucleotide polymorphism, INDELs (insertions or deletions) and, duplications, inversions and copy number variations are more widely prevalent than initially predicted. Mitochondrial tumor suppressor gene maps on chromosome 8p, in which exon 4-specific deletion is associated with susceptibility towards breast and various other forms of cancer. In this study, 41 head and neck cancer, 15 breast cancer patients and 280 healthy control individuals were analyzed for mitochondrial tumor suppressor gene copy number variation. The frequencies of wt/wt (homozygous wild-type), wt/Del (heterozygous variant) and Del/Del (homozygous deletion variant) mitochondrial tumor suppressor gene genotypes were found to be 73.3%, 26.7%, and 0% in breast cancer patients, 41.5%, 58.5%, and 0% in head and neck cancer patients and 43%, 57%, and 0% in healthy individuals, respectively. A significant association of the deletion variant with breast cancer (odds ratio = 0.27, 95% confidence interval = 0.08–0.87, P = 0.0207) was found in our population. In addition, the allele and genotype frequency varied significantly (P<0.0001) among Indian and German populations, reflecting ethnic diversity. This pilot case-control study highlighted the indicative role of mitochondrial tumor suppressor gene deletion in protection from breast cancer in Indian population. However, the findings need to be investigated in larger patient sample size before any conclusive role of mitochondrial tumor suppressor gene copy number variation on cancer risk.

Cell Wall Recycling-Linked Coregulation of AmpC and PenB β-Lactamases through ampD Mutations in Burkholderia cenocepacia.

In many Gram-negative pathogens, mutations in the key cell wall-recycling enzyme AmpD (N-acetyl-anhydromuramyl-L-alanine amidase) affect the activity of the regulator AmpR, which leads to the expression of AmpC β-lactamase, conferring resistance to expanded-spectrum cephalosporin antibiotics. Burkholderia cepacia complex (Bcc) species also have these Amp homologs; however, the regulatory circuitry and the nature of causal ampD mutations remain to be explored. A total of 92 ampD mutants were obtained, representing four types of mutations: single nucleotide substitution (causing an amino acid substitution or antitermination of the enzyme), duplication, deletion, and IS element insertion. Duplication, which can go through reversion, was the most frequent type. Intriguingly, mutations in ampD led to the induction of two β-lactamases, AmpC and PenB. Coregulation of AmpC and PenB in B. cenocepacia, and likely also in many Bcc species with the same gene organization, poses a serious threat to human health. This resistance mechanism is of evolutionary optimization in that ampD is highly prone to mutations allowing rapid response to antibiotic challenge, and many of the mutations are reversible in order to resume cell wall recycling when the antibiotic challenge is relieved.

A 21 Nucleotide Duplication on the α1- and α2-Globin Genes Involves a Variety of Hypochromic Microcytic Anemias, From Mild to Hb H Disease

α-Thalassemia (α-thal) is a common genetic disorder in Iran and many parts of the world. Genetic defects in the α-globin gene cluster can result in α-thal that may develop into a clinical phenotype varying from almost asymptomatic to a lethal hemolytic anemia. Loss of one functional α gene, indicated as heterozygous α+-thal, shows minor hematological abnormalities. Homozygosity for α+- or heterozygosity for α0-thal have more severe hematological abnormalities due to a markedly reduced α chain output. At the molecular level, the absence of three α-globin genes resulting from the compound heterozygous state for α0- and α+-thal, lead to Hb H disease. Here we present a 21 nucleotide (nt) duplication consisting of six amino acids and 3 bp of intronic sequence at the exon-intron boundary, in both the α-globin genes, detected by direct DNA sequencing. This duplication was identified in three patients originating from two different Iranian ethnic groups and one Arab during more than 12 years. The clinical presentation of these individuals varies widely from a mild asymptomatic anemia (heterozygote in α1-globin gene) to a severely anemic state, diagnosed as an Hb H individual requiring blood transfusion (duplication on the α2-globin gene in combination with the – –MED double α-globin gene deletion). The third individual, who was homozygous for this nt duplication on the α1-globin gene, showed severe hypochromic microcytic anemia and splenomegaly. In the last decade, numerous α-globin mutations have demonstrated the necessity of prenatal diagnosis (PND) for α-thal, and this study has contributed another mutation as important enough that needs to be considered.

Rapid replacement of prevailing genotype of human respiratory syncytial virus by genotype ON1 in Beijing, 2012–2014

Human respiratory syncytial virus (HRSV) is the most common viral pathogen causing lower respiratory infections in infants and young children worldwide. HRSV ON1 genotype in subgroup A with a characteristic of a 72 nucleotide duplication in the second highly variable region of attachment glycoprotein gene, has been reported in some countries since it was first detected in clinical samples collected in Canada in 2010. In this study, 557 HRSV antigen-positive nasopharyngeal aspirates were randomly selected during 2012/2013 to 2013/2014 HRSV seasons in Beijing for subgroup typing and for ON1 genotype screening by using a PCR based method developed for easily identifying genotype ON1 out of strains of subtype A. It was found that subgroup B was dominant in the 2012/2013 season and sudden shift of subgroup dominance from B to A and rapid replacement of previously prevailing NA1 genotype by ON1 genotype occurred in the 2013/2014 season. Reversible amino acid replacement in the G protein gene was found in a new branch of ON1 genotype. The evolutionary rate of the 351 global ON1 sequences was estimated to 7.34×10−3 nucleotide substitutions per site per year (95% highest probability density intervals, HPD, 5.71×10−3 to 9.04×10−3), with the time of most recent common ancestor dating back to June 2009.

Genome update of the dimorphic human pathogenic fungi causing paracoccidioidomycosis.

Paracoccidiodomycosis (PCM) is a clinically important fungal disease that can acquire serious systemic forms and is caused by the thermodimorphic fungal Paracoccidioides spp. PCM is a tropical disease that is endemic in Latin America, where up to ten million people are infected; 80% of reported cases occur in Brazil, followed by Colombia and Venezuela. To enable genomic studies and to better characterize the pathogenesis of this dimorphic fungus, two reference strains of P. brasiliensis (Pb03, Pb18) and one strain of P. lutzii (Pb01) were sequenced [1]. While the initial draft assemblies were accurate in large scale structure and had high overall base quality, the sequences had frequent small scale defects such as poor quality stretches, unknown bases (N's), and artifactual deletions or nucleotide duplications, all of which caused larger scale errors in predicted gene structures. Since assembly consensus errors can now be addressed using next generation sequencing (NGS) in combination with recent methods allowing systematic assembly improvement, we re-sequenced the three reference strains of Paracoccidioides spp. using Illumina technology. We utilized the high sequencing depth to re-evaluate and improve the original assemblies generated from Sanger sequence reads, and obtained more complete and accurate reference assemblies. The new assemblies led to improved transcript predictions for the vast majority of genes of these reference strains, and often substantially corrected gene structures. These include several genes that are central to virulence or expressed during the pathogenic yeast stage in Paracoccidioides and other fungi, such as HSP90, RYP1-3, BAD1, catalase B, alpha-1,3-glucan synthase and the beta glucan synthase target gene FKS1. The improvement and validation of these reference sequences will now allow more accurate genome-based analyses. To our knowledge, this is one of the first reports of a fully automated and quality-assessed upgrade of a genome assembly and annotation for a non-model fungus.

Molecular Spectrum of α-Globin Gene Defects in the Omani Population

We describe the molecular characterization of α-globin gene defects in a cohort of 634 Omani patients. A total of 21 different α gene mutations were found in 484 subjects. Overall, we identified three different large deletions, three small deletions, 11 point mutations [two on the α2 polyadenylation signal (polyA) (HBA2: c.*94A>G), and nine α chain variants], three αααanti 3.7 triplication, a 21 nucleotide (nt) duplication on the α1 gene and two novel (presumed) polymorphisms on the α 3.7 kb hybrid gene, namely −5 (C>T) and +46 (C>A). Of these defects, 15 have not been previously reported in the Omani population. This large heterogeneity of α-thalassemia (α-thal) observed in the Omani population could be expected in neighboring Arab countries. The high frequency of α-thal, solely or in association with β-globin gene defects, emphasize the necessity of adding α-thal testing to pre marital programs for accurate genetic counseling.

Sequence variations of full-length hepatitis B virus genomes in Chinese patients with HBsAg-negative hepatitis B infection.

BackgroundThe underlying mechanism of HBsAg-negative hepatitis B virus (HBV) infection is notoriously difficult to elucidate because of the extremely low DNA levels which define the condition. We used a highly efficient amplification method to overcome this obstacle and achieved our aim which was to identify specific mutations or sequence variations associated with this entity.MethodsA total of 185 sera and 60 liver biopsies from HBsAg-negative, HBV DNA-positive subjects or known chronic hepatitis B (CHB) subjects with HBsAg seroclearance were amplified by rolling circle amplification followed by full-length HBV genome sequencing. Eleven HBsAg-positive CHB subjects were included as controls. The effects of pivotal mutations identified on regulatory regions on promoter activities were analyzed.Results22 and 11 full-length HBV genomes were amplified from HBsAg-negative and control subjects respectively. HBV genotype C was the dominant strain. A higher mutation frequency was observed in HBsAg-negative subjects than controls, irrespective of genotype. The nucleotide diversity over the entire HBV genome was significantly higher in HBsAg-negative subjects compared with controls (p = 0.008) and compared with 49 reference sequences from CHB patients (p = 0.025). In addition, HBsAg-negative subjects had significantly higher amino acid substitutions in the four viral genes than controls (all p<0.001). Many mutations were uniquely found in HBsAg-negative subjects, including deletions in promoter regions (13.6%), abolishment of pre-S2/S start codon (18.2%), disruption of pre-S2/S mRNA splicing site (4.5%), nucleotide duplications (9.1%), and missense mutations in “α” determinant region, contributing to defects in HBsAg production.ConclusionsThese data suggest an accumulation of multiple mutations constraining viral transcriptional activities contribute to HBsAg-negativity in HBV infection.

2.3 Exome sequencing improves genetic diagnosis of structural fetal abnormalities revealed by ultrasound

BackgroundThe genetic aetiology of non-aneuploid fetal structural abnormalities is typically investigated by karyotyping and array-based detection of microscopically detectable rearrangements, and submicroscopic copy number variants (CNVs), which collectively yield a...

Rapid replacement of human respiratory syncytial virus A with the ON1 genotype having 72 nucleotide duplication in G gene

Human respiratory syncytial virus (HRSV) is the main cause of severe respiratory illness in young children and elderly people. We investigated the genetic characteristics of the circulating HRSV subgroup A (HRSV-A) to determine the distribution of genotype ON1, which has a 72-nucleotide duplication in attachment G gene. We obtained 456 HRSV-A positive samples between October 2008 and February 2013, which were subjected to sequence analysis. The first ON1 genotype was discovered in August 2011 and 273 samples were identified as ON1 up to February 2013. The prevalence of the ON1 genotype increased rapidly from 17.4% in 2011–2012 to 94.6% in 2012–2013. The mean evolutionary rate of G protein was calculated as 3.275×10−3 nucleotide substitution/site/year and several positively selected sites for amino acid substitutions were located in the predicted epitope region. This basic and important information may facilitate a better understanding of HRSV epidemiology and evolution.

Ethical issues in the use of genetic testing of patients with schizophrenia and their families

This review outlines the positive and negative aspects of DNA testing and provides an account of the issues particularly relevant to schizophrenia. Modern technology has changed the field of medicine so rapidly that patients and their families have become much more independent in their healthcare decisions than in the previous decade. Simply by finding information on the Internet, they gain knowledge about disease diagnosis, treatment options and their side-effects. No medical field likely has been more affected and more controversial than that of genetics. It is now possible to sequence the individual human genome and detect single nucleotide variations, microdeletions and duplications within it. Commercial companies have sprung up in a similar manner to the software or electronic industries and have begun to market direct-to-consumer DNA testing. Much of this may be performed to satisfy curiosity about one's ancestry; but commercially available results that appear incidentally can also be distributed to the consumer. Ethicists, genetics researchers, clinicians and government agencies are currently in discussion about concerns raised about commercially available DNA testing, while at the same time recognizing its value in some instances to be able to predict very serious disabilities.

Functional modelling of a novel mutation in BBS5

BackgroundBardet-Biedl syndrome (BBS) is an autosomal recessive ciliopathy disorder with 18 known causative genes (BBS1-18). The primary clinical features are renal abnormalities, rod-cone dystrophy, post-axial polydactyly, learning difficulties, obesity and male hypogonadism.ResultsWe describe the clinical phenotype in three Saudi siblings in whom we have identified a novel mutation in exon 12 of BBS5 (c.966dupT; p.Ala323CysfsX57). This single nucleotide duplication creates a frame shift results in a predicted elongated peptide. Translation blocking Morpholino oligonucleotides were used to create zebrafish bbs5 morphants. Morphants displayed retinal layering defects, abnormal cardiac looping and dilated, cystic pronephric ducts with reduced cilia expression. Morphants also displayed significantly reduced dextran clearance via the pronephros compared to wildtype embryos, suggesting reduced renal function in morphants. The eye, kidney and heart defects reported in morphant zebrafish resemble the human phenotype of BBS5 mutations. The pathogenicity of the novel BBS5 mutation was determined. Mutant mRNA was unable to rescue pleiotropic phenotypes of bbs5 morphant zebrafish and in cell culture we demonstrate a mislocalisation of mutant BBS5 protein which fails to localise discretely with the basal body.ConclusionsWe conclude that this novel BBS5 mutation has a deleterious function that accounts for the multisystem ciliopathy phenotype seen in affected human patients.

Genetic variability of human respiratory syncytial virus in Pune, Western India

Human respiratory syncytial virus (RSV) is one of the most important respiratory viruses causing acute respiratory tract infections amongst children. Based on genotyping of the attachment glycoprotein (G) gene, it is divided into two groups, RSV-A and RSV-B. Infection with one group does not confer immunity against the other and children infected with one antigenic group are more likely to be reinfected with the heterologous group. We tested 854 samples of patients with influenza like illness (ILI)/severe respiratory illness (SARI) during the period 2009–2012 for RSV using a conventional multiplex RT-PCR and found 159 (18.61%) samples to be positive for RSV of which 130 (15.22%) were positive for RSV-B and 29 (3.39%) for RSV-A suggesting that RSV-B was the predominant group circulating in Western India during the study period. Seasonal RSV outbreaks were observed in the monsoon and winter months. RSV was more prevalent amongst children in the 0–24month age group (21.53%) in comparison to children in the 24–60month age group (13.01%). Phylogenetic analysis using the G gene of 27 representative RSV-A positive samples revealed that all sequences belonged to the NA1 genotype. Of these, 5 sequences exhibited the novel 72 nucleotide duplication in the C-terminal of the G gene first reported from Ontario, Canada and clustered in the newly designated ON1 genotype. Also, 32 of the 33 RSV-B sequences exhibited the 60 nucleotide duplication associated with genotype BA and phylogenetic analysis showed that these sequences belonged to the genotype BA9 and BA12. We also found one RSV-B sequence belonging to genotype GB2, which has not been previously reported in India.