Nuclear Transfer Blastocysts Research Articles

Chromatin accessibility memory of donor cells disrupts bovine somatic cell nuclear transfer blastocysts development.

The post-transfer developmental capacity of bovine somatic cell nuclear transfer (SCNT) blastocysts is reduced, implying that abnormalities in gene expression regulation are present at blastocyst stage. Chromatin accessibility, as an indicator for transcriptional regulatory elements mediating gene transcription activity, has heretofore been largely unexplored in SCNT embryos, especially at blastocyst stage. In the present study, single-cell sequencing assay for transposase-accessible chromatin (scATAC-seq) of in vivo and SCNT blastocysts were conducted to segregate lineages and demonstrate the aberrant chromatin accessibility of transcription factors (TFs) related to inner cell mass (ICM) development in SCNT blastocysts. Pseudotime analysis of lineage segregation further reflected dysregulated chromatin accessibility dynamics of TFs in the ICM of SCNT blastocysts compared to their in vivo counterparts. ATAC- and ChIP-seq results of SCNT donor cells revealed that the aberrant chromatin accessibility in the ICM of SCNT blastocysts was due to the persistence of chromatin accessibility memory at corresponding loci in the donor cells, with strong enrichment of trimethylation of histone H3 at lysine 4 (H3K4me3) at these loci. Correction of the aberrant chromatin accessibility through demethylation of H3K4me3 by KDM5B diminished the expression of related genes (e.g., BCL11B) and significantly improved the ICM proliferation in SCNT blastocysts. This effect was confirmed by knocking down BCL11B in SCNT embryos to down-regulate p21 and alleviate the inhibition of ICM proliferation. These findings expand our understanding of the chromatin accessibility abnormalities in SCNT blastocysts and BCL11B may be a potential target to improve SCNT efficiency.

The combination of rolipram and cilostamide improved the developmental competence of cloned porcine embryos

In vitro maturation of porcine oocytes is characterized by asynchronous cytoplasmic and nuclear maturation, leading to less competent oocytes supporting embryo development. The purpose of this study was to evaluate the combined effect of rolipram and cilostamide as cyclic Adenine monophosphate (cAMP) modulators to find the maximum cAMP levels that temporarily arrest meiosis. We determined the optimal time to maintain functional gap junction communication during pre-in vitro maturation to be four hours. Oocyte competence was evaluated by the level of glutathione, reactive oxygen species, meiotic progression, and gene expression. We evaluated embryonic developmental competence after parthenogenetic activation and somatic cell nuclear transfer. The combined treatment group showed significantly higher glutathione and lower reactive oxygen species levels and a higher maturation rate than the control and single treatment groups. Cleavage and blastocyst formation rates in parthenogenetic activation and somatic cell nuclear transfer embryos were higher in two-phase in vitro maturation than in the other groups. The relative levels of BMP15and GDF9 expression were increased in two-phase in vitro maturation. Somatic cell nuclear transfer blastocysts from two-phase in vitro maturation oocytes showed a lower level of expression of apoptotic genes than the control, indicating better pre-implantation developmental competence. The combination of rolipram and cilostamide resulted in optimal synchrony of cytoplasmic and nuclear maturation in porcine in vitro matured oocytes and there by enhanced the developmental competence of pre-implantation embryos.

Cytokine supplemented maturation medium improved development to term following somatic cell nuclear transfer (SCNT) in cattle.

In vitro maturation is an important process in the production of embryos. It has been shown that three cytokines, fibroblast growth factor 2, leukemia inhibitory factor and insulin-like growth factor 1 (FLI), increased efficiency of in vitro maturation, somatic cell nuclear transfer (SCNT) blastocyst production, and in vivo development of genetically engineered piglets. Assess effects of FLI on oocyte maturation, quality of oocytes, and embryo development in bovine in vitro fertilisation (IVF) and SCNT. Cytokine supplementation resulted in significant increases in maturation rates and decreased levels of reactive oxygen species. Oocytes matured in FLI had increased blastocyst rates when used in IVF (35.6%vs 27.3%, P <0.05) and SCNT (40.6%vs 25.7%, P <0.05). SCNT blastocysts contained significantly more inner cell mass and trophectodermal cells when compared to the control group. Importantly, SCNT embryos derived from oocytes matured in FLI medium resulted in a four-fold increase in full-term development compared to control medium (23.3%vs 5.3%, P <0.05). Relative mRNA expression analysis of 37 genes associated with embryonic and fetal development revealed one gene had differential transcript abundance in metaphase II oocytes, nine genes at the 8-cell stage, 10 genes at the blastocyst stage in IVF embryos and four genes at the blastocyst stage in SCNT embryos. Cytokine supplementation increased efficiency of in vitro production of IVF and SCNT embryos and in vivo development of SCNT embryos to term. Cytokine supplementation is beneficial to embryo culture systems, which may shed light on requirements of early embryo development.

Interspecific Nuclear Transfer Blastocysts Reconstructed from Arabian Oryx Somatic Cells and Domestic Cow Ooplasm.

Cloning, commonly referred to as somatic cell nuclear transfer (SCNT), is the technique of enucleating an oocyte and injecting a somatic cell into it. This study was carried out with interspecific SCNT technology to clone the Arabian Oryx utilizing the oryx's fibroblast cells and transfer it to the enucleated oocytes of a domestic cow. The recipient oocytes were extracted from the cows that had been butchered. Oryx somatic nuclei were introduced into cow oocytes to produce embryonic cells. The study was conducted on three groups, Oryx interspecific somatic cell nuclear transfer into enucleated oocytes of domestic cows, cow SCNT "the same bovine family species", used as a control group, and in vitro fertilized (IVF) cows to verify all media used in this work. The rates of different embryo developmental stages varied slightly (from 1- cell to morula stage). Additionally, the oryx interspecies Somatic cell nuclear transfer blastocyst developmental rate (9.23%) was comparable to that of cow SCNT (8.33%). While the blastula stage rate of the (IVF) cow embryos exhibited a higher cleavage rate (42%) in the embryo development stage. The results of this study enhanced domestic cow oocytes' ability to support interspecific SCNT cloned oryx, and generate a viable embryo that can advance to the blastula stage.

Differential Transcriptomes and Methylomes of Trophoblast Stem Cells From Naturally-Fertilized and Somatic Cell Nuclear-Transferred Embryos.

Trophoblast stem cells (TSCs) are critical to mammalian embryogenesis by providing the cell source of the placenta. TSCs can be derived from trophoblast cells. However, the efficiency of TSC derivation from somatic cell nuclear transfer (NT) blastocysts is low. The regulatory mechanisms underlying transcription dynamics and epigenetic landscape remodeling during TSC derivation remain elusive. Here, we derived TSCs from the blastocysts by natural fertilization (NF), NT, and a histone deacetylase inhibitor Scriptaid-treated NT (SNT). Profiling of the transcriptomes across the stages of TSC derivation revealed that fibroblast growth factor 4 (FGF4) treatment resulted in many differentially expressed genes (DEGs) at outgrowth and initiated transcription program for TSC formation. We identified 75 transcription factors (TFs) that are continuously upregulated during NF TSC derivation, whose transcription profiles can infer the time course of NF not NT TSC derivation. Most DEGs in NT outgrowth are rescued in SNT outgrowth. The correct time course of SNT TSC derivation is inferred accordingly. Moreover, these TFs comprise an interaction network important to TSC stemness. Profiling of DNA methylation dynamics showed an extremely low level before FGF4 treatment and gradual increases afterward. FGF4 treatment results in a distinct DNA methylation remodeling process committed to TSC formation. We further identified 1,293 CpG islands (CGIs) whose DNA methylation difference is more than 0.25 during NF TSC derivation. The majority of these CGIs become highly methylated upon FGF4 treatment and remain in high levels. This may create a barrier for lineage commitment to restrict embryonic development, and ensure TSC formation. There exist hundreds of aberrantly methylated CGIs during NT TSC derivation, most of which are corrected during SNT TSC derivation. More than half of the aberrantly methylated CGIs before NT TSC formation are inherited from the donor genome. In contrast, the aberrantly methylated CGIs upon TSC formation are mainly from the highly methylated CGIs induced by FGF4 treatment. Functional annotation indicates that the aberrantly highly methylated CGIs play a role in repressing placenta development genes, etc., related to post-implantation development and maintaining TSC pluripotency. Collectively, our findings provide novel insights into the transcription dynamics, DNA methylation remodeling, and the role of FGF4 during TSC derivation.

Effects of in vitro Culture Period of Reconstructed Embryos and Genetic Background of Feeder Cells on Establishment of Embryonic Stem Cells Derived from Somatic Cell Nuclear Transfer Blastocysts in Pigs

Effects of <i>in</i> vitro Culture Period of Reconstructed Embryos and Genetic Background of Feeder Cells on Establishment of Embryonic Stem Cells Derived from Somatic Cell Nuclear Transfer Blastocysts in Pigs

Establishment of In-Vitro Culture System for Enhancing Production of Somatic Cell Nuclear Transfer (SCNT) Blastocysts with High Performance in the Colony Formation and Formation of Colonies Derived from SCNT Blastocysts in Pigs

Establishment of <i>In-Vitro</i> Culture System for Enhancing Production of Somatic Cell Nuclear Transfer (SCNT) Blastocysts with High Performance in the Colony Formation and Formation of Colonies Derived from SCNT Blastocysts in Pigs

Bovine somatic cell nuclear transfer using mitomycin C-mediated chemical oocyte enucleation.

SummaryChemical oocyte enucleation holds the potential to ease somatic cell nuclear transfer (SCNT), although high enucleation rates remain limited to micromanipulation-based approaches. Therefore, this study aimed to test mitomycin C (MMC) for use in bovine functional chemical oocyte enucleation. Incubation of denuded eggs in 10 µg ml-1 MMC for different periods did not affect most maturation rates (0.5 h: 85.78%A, 1.0 h: 72.77%B, 1.5 h: 83.87%A, and 2.0 h: 82.05%A) in comparison with non-treated controls (CTL; 85.77%A). Parthenogenetic development arrest by MMC was efficient at cleavage (CTL: 72.93%A, 0.5 h: 64.92%A,B, 1.0 h: 60.39%B,C, 1.5 h: 66.35%A,B, and 2.0 h: 53.84%C) and blastocyst stages (CTL: 33.94%A, 0.5 h: 7.58%B, 1.0 h: 2.47%C, 1.5 h: 0.46%C, and 2.0 h: 0.51%C). Blastocysts were obtained after nuclear transfer (NT) using MMC enucleation [NT(MMC): 4.54%B] but at lower rates than for the SCNT control [NT(CTL): 26.31%A]. The removal of the meiotic spindle after MMC incubation fully restored SCNT blastocyst development [NT(MMC+SR): 24.74%A]. Early pregnancies were obtained by the transfer of NT(MMC) and NT(MMC+SR) blastocysts to synchronized recipients. In conclusion, MMC leads to functional chemical oocyte enucleation during SCNT and further suggests its potential for application towards technical improvements.

5 Gene expression analysis and DNA methylation patterns of porcine somatic cell nuclear transfer blastocysts with high and low incidence of apoptosis

Somatic cell NT (SCNT) efficiency remains poor, preventing the technology from being regularly used in the agricultural industry. It is believed that faulty epigenetic reprogramming of SCNT embryos leads to the low overall success. A clear apoptotic signature is associated with inappropriate gene expression and epigenomic aberrancies in many experimental cell culture systems, and we hypothesised that an apoptosis biomarker could be used to effectively separate properly reprogrammed porcine SCNT embryos from those that are destined to fail due to incomplete reprogramming. Therefore, our objective was to evaluate global gene expression and DNA methylation patterns in high- and low-apoptosis individual embryos in an effort to characterise the extent of genomic reprogramming that had taken place. Porcine SCNT blastocysts on Day 6 of development were stained with a nontoxic, noninvasive caspase activity reporter, and the top and bottom 20% of detected caspase activity were classified as high and low apoptosis, respectively (3 replicate cloning sessions; n=13 embryos per group). Genomic DNA and total RNA were isolated from each individual blastocyst. The RNA sequencing libraries were prepared using the Ovation SoLo RNA-Seq system (NuGen, San Carlos, CA, USA). Reduced representation bisulfite sequencing libraries were prepared for DNA methylation analysis using a modification of the single-cell reduced representation bisulfite sequencing global DNA methylation analysis approach detailed by Guo et al. (2015 Nat. Protoc. 10, 645-59). The RNA sequencing analysis using EdgeR (https://bioconductor.org/packages/release/bioc/html/edgeR.html) revealed 175 total differentially expressed genes (fold change ≥1.5; false discovery rate ≤0.05) between the high- and low-apoptosis SCNT embryos. This list of differentially expressed genes was used to perform enrichment analysis to identify overrepresented Gene Ontology (GO) terms or Kyoto Encyclopedia of Genes and Genomes pathways (DAVID Ease version 6.8 (https://david.ncifcrf.gov/) against the Sus scrofa background genome). However, no significantly enriched GO terms or pathways were identified (false discovery rate P&amp;gt;0.05). Analysis of global DNA methylation patterns between high- and low-apoptosis SCNT embryos using MethylKit (Akalin et al. 2012Genome Biol. 13, R87) revealed 335 differentially methylated 100-bp regions with at least 25% difference in methylation (adjusted P ≤ 0.01). Gene transcription start sites associated with these regions were used for enrichment analysis; again, no significant enrichment of GO terms or Kyoto Encyclopedia of Genes and Genomes pathways was identified. Principal component analysis of CpG methylation showed the low-apoptosis embryos clustering more tightly than the high-apoptosis embryos, which were highly scattered. Ongoing comparisons of high- and low-apoptosis cloned embryos with naturally fertilized embryos produced invivo may provide more information about which embryos were properly reprogrammed. Although we are still pursuing a link between reprogramming and gene expression in high- and low-apoptosis embryos, we conclude that these data support a model of stochastic epigenetic reprogramming following SCNT and reinforce the necessity of identifying embryos most likely to be successful due to proper epigenetic reprogramming in order to increase SCNT efficiency.

36 Transgenic Somatic Cell Nuclear Transfer Blastocyst Selection with Embryo Biopsying

Somatic cell nuclear transfer (SCNT) is, to date, the most used technology producing transgenic (TG) cattle. Depending on the gene construct and transfection method, transfection efficiency may differ greatly. Applying a more intense selection regime after transfection may obliterate the cells. An extended selection affects the passage number and leads to genotypic and phenotypic drift of the cells. We used the pBC1 Milk Expression Vector Kit (cat. no. K270-01, Invitrogen Corp., Carlsbad, CA, USA) to make the expression vector of human FSH (hFSH). For TG fibroblast cell line, the AmaxaTM NucleofectorTM Kit for Primary Fibroblasts (cat. no. VPI-1002, Lonza Grouop, Basel, Switzerland) was used. For TG fibroblast selection, G418 (neomycin) was used for 21 days with a final concentration of 400 µg mL−1. The final passage number of the cell line was 6. The primers included in the pBC1 Milk Expression Vector Kit-BCF (GATTGACAAGTAATACGCTGTTTCCTC) and BCR (CATCAGAAGTTAAACAGCACAGTTAG)-were used to control the insert. The transgenesis of the cell line was confirmed by sequencing the PCR product and analysing it with the BlastN and Bioedit software to make sure the fibroblast cell line was hFSH-positive. These cells were thereafter randomly used for SCNT as donor cells. All the SCNT embryos were cultured for 4 days in IVF Bioscience (Falmouth, United Kingdom) culture media and then biopsied. After aspirating 1 blastomere from the 6- to 8-cell-stage embryo, the biopsied embryos were further individually cultured until Day 7 and blastocyst formation was recorded. Genomic DNA from the biopsies was isolated and amplified with REPLI-g Single Cell Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. The primers BCF and BCR were used to control the hFSH positivity of the embryos, and the PCR product was visualised on a 1% agarose gel. From 62 biopsied SCNT cloned embryos, 22 (35.48%) tested TG positive. The total blastocyst yield from biopsied embryos was 26 (41.93%), of which 12 (54.54%) were TG positive blastocysts and selected for transfer. Our hFSH TG fibroblast cell line demonstrated a low concentration of TG cells in its culture, despite the selection and verification methods applied. Based on the analysis of SCNT embryos, only 54.54% of the embryos developed were TG positive. The embryo biopsying technique enables us to use only TG-positive SCNT cloned embryos for transfer, therefore avoiding non-TG pregnancies. This study was supported by Enterprise Estonia grant EU30020, Institutional research funding IUT 8-1 and Horizon 2020 Project SEARMET 692299.

RNAi-mediated knockdown of Parp1 does not improve the development of female cloned mouse embryos.

Somatic cell nuclear transfer is an important technique for life science research, but its efficiency is still extremely low, and most genes that are important during early development, such as X chromosome-linked genes, are not appropriately expressed during this process. Poly (ADP-ribose) polymerase (PARP) is an enzyme that transfers ADP ribose clusters to target proteins. PARP family members such as PARP1 participate in cellular signalling pathways through poly (ADP-ribosylation) (PARylation), which ultimately promotes changes in chromatin structure, gene expression, and the localization and activity of proteins that mediate signalling responses. PARP1 is associated with X chromosome inactivation (Xi). Here, we showed that abnormal Xi occurs in somatic cell nuclear transfer (NT) blastocysts, whereas in female blastocysts derived from cumulus cell nuclear transfer, both X chromosomes were inactive. Parp1 expression was higher in female NT blastocysts than that in intracytoplasmic sperm injection (ICSI) embryos but not in male NT blastocysts. After knocking down Parp1 expression, both the pre-rRNA 47S and X-inactivation-specific transcript (Xist) levels increased. Moreover, the expression of genes on the inactivated X chromosome, such as Magea6 and Msn, were also increased in the NT embryos. However, the development of Parp1si NT embryos was impaired, although total RNA sequencing showed that overall gene expression between the Parp1si NT blastocysts and the control was similar. Our findings demonstrate that increases in the expression of several genes on the X chromosome and of rRNA primary products in NT blastocysts with disrupted Parp1 expression are insufficient to rescue the impaired development of female cloned mouse embryos and could even exacerbate the associated developmental deficiencies.

33 BUFFALO (BUBALUS BUBALIS) EMBRYOS PRODUCED BY HAND-MADE CLONING AND IN VITRO FERTILIZATION DIFFER IN THEIR GLOBAL TRANSCRIPTOME PROFILE

Although the blastocyst rate obtained with nuclear transferred (NT) embryos is higher than that obtained following in vitro fertilization (IVF) in buffalo, the live birth rate of NT embryos is &lt;2% across different farm animal species compared with a birth rate &gt;40% obtained with IVF embryos. This is believed to be due primarily to incomplete or incorrect nuclear reprogramming of the donor somatic cell by the oocyte, which results in aberrant embryonic gene expression. We compared the global transcriptome profile of buffalo blastocysts produced by hand-made cloning (HMC) and IVF using next-generation sequencing (NGS) for discovering transcripts that are differentially expressed between the 2 types of embryos. NT blastocysts were produced using fibroblast donor cells obtained from ear skin of a buffalo bull. The semen of the same bull was used for producing genetically half-identical IVF blastocysts. Total RNA was isolated from 3 pools of Day 8 NT and IVF blastocysts, with each pool containing 40 blastocysts. Complementary DNA library was prepared and subjected to NGS on Illumina HiSEqn 2000 (Illumina Inc., San Diego, CA, USA). The reads generated were aligned to Bos taurus reference genome, UMD 3.1. Differential expression analysis between the 2 blastocysts types at a minimum of 2-fold change revealed that 5557 transcripts were differentially expressed, of which 584 were unique to NT blastocysts, 709 were unique to IVF blastocysts, and 4264 were expressed in both types of blastocysts. Among these transcripts, at a significance level of P &lt; 0.05, 331 transcripts were differentially expressed between the 2 blastocyst types, of which 19 were unique, 188 were down-regulated, and 143 were up-regulated in NT blastocysts. One-way ANOVA with Benjamini and Hochberg false discovery rate (FDR) correction was applied to determine the statistically significant differentially expressed transcripts. Nine of the differentially expressed transcripts (at minimal 2-fold change, P &lt; 0.05), from different functional classes (RELN, NDRG1, SULT1A1, MAP1LC3A, MTHFD1L, PCBD1, PPA2, MGST1 and PRPH) were subjected to quantitative real-time PCR analysis for validation of NGS data. Gene expression level of RELN, NDRG1, SULT1A1, MAP1LC3A, PPA2, MGST1, and PRPH was found to be up-regulated while that of MTHFD1L and PCBD1 was down-regulated (P &lt; 0.05) in NT embryos compared with IVF embryos. This pattern and the magnitude of relative gene expression level were found to be similar to that observed in NGS. These results indicate that the gene expression profile of NT embryos is very different from that of their IVF counterparts. Further analysis of these differentially expressed transcripts can help in identification of gene functional classes and pathways that are affected by the inefficient reprogramming of donor nuclei in NT embryos. Normalizing the expression of some of the differentially expressed genes may help in improving the cloning efficiency.

32 NEXT-GENERATION SEQUENCING DISCLOSES DIFFERENCES IN microRNA EXPRESSION PROFILES OF BUFFALO (BUBALUS BUBALIS) EMBRYOS PRODUCED BY HAND-MADE CLONING AND IN VITRO FERTILIZATION

Mammalian embryo development is a complex process with a series of critical events taking place at every stage of development. It is an established fact that the birth rate of animals produced by nuclear transfer (NT) is far less (&lt;2%) than that of IVF embryos (40%) after successful embryo transfers in different farm animal species. Micro(mi)RNAs are small non-coding RNAs of 17 to 25 nucleotides that alter the function of their target genes by either degrading them or inhibiting their expression. MiRNAs play a vital role during mammalian embryo development and may be adding to the extremely low birth rate and abnormalities in cloned animals. The present study was done with an objective of comparing the miRNA expression profiles of pre-implantation buffalo blastocysts produced by handmade cloning (HMC) and IVF. We hypothesised that there may be differences in the profiles of miRNAs expressed between the 2 groups that contribute to higher success rate in IVF group compared with HMC. Next-generation sequencing (NGS) was done to generate and compare the miRNA profiles and further discern the differentially expressed miRNAs between the 2 groups of blastocysts. For this study, NT blastocysts were produced using fibroblast donor cells isolated from ear skin of a buffalo bull. To produce genetically half-identical IVF blastocysts, the semen of the same bull was used. The oocytes used for generation of both HMC and IVF blastocysts were aspirated from buffalo ovaries obtained from abattoir. Total RNA was isolated from HMC and IVF blastocysts in 4 pools of each group. Each pool consisted of 40 blastocysts. A MiRNA cDNA library was prepared which was then subjected to NGS on Illumina HiSEqn 2000 (Illumina Inc., San Diego, CA, USA). Bos taurus genome was taken as reference to align the reads generated. The data from NGS was validated by RT-qPCR, taking 10 miRNAs (mir-15a, mir-23a, mir-128, mir-130a, mir-133a, mir-194, mir-196b, mir-200b, mir-431 and mir-451). The results positively validated the NGS data. Differential expression analysis of miRNAs between the 2 types of blastocysts revealed that the number of differentially expressed miRNAs with fold change of ≥ 2.0 were 74, with 52 miRNAs up-regulated in HMC and 22 miRNAs up-regulated in IVF. At significance level of P &lt; 0.2, there were 2 miRNAs (mir-202 and mir-133a) that were uniquely expressed in IVF blastocysts and 8 miRNAs (mir-219, mir-451, mir-497, mir-33a, mir-2448, mir-592, mir-187, and mir-502a) that were uniquely expressed in HMC blastocysts. According to the gene ontology analysis, mir-202 is involved in negative regulation of apoptosis and positive regulator of cell growth, whereas mir-133a is involved in generating immunity. Absence of mir-202 and mir-133a expression from HMC blastocysts may be contributing to high apoptosis and other abnormalities in them compared with IVF counterparts. The NGS results indicate that the miRNA profiles of HMC and IVF blastocysts show huge differences. Further analysis of these differentially expressed miRNAs may open the door to miRNA therapies for treating the HMC blastocysts by regulating the expression of critical miRNAs in HMC blastocysts, thereby improving the success rate of cloning.

Trichostatin A-mediated epigenetic transformation of adult bone marrow-derived mesenchymal stem cells biases the in vitro developmental capability, quality, and pluripotency extent of porcine cloned embryos.

The current research was conducted to explore the in vitro developmental outcome and cytological/molecular quality of porcine nuclear-transferred (NT) embryos reconstituted with adult bone marrow-derived mesenchymal stem cells (ABM-MSCs) that were epigenetically transformed by treatment with nonspecific inhibitor of histone deacetylases, known as trichostatin A (TSA). The cytological quality of cloned blastocysts was assessed by estimation of the total cells number (TCN) and apoptotic index. Their molecular quality was evaluated by real-time PCR-mediated quantification of gene transcripts for pluripotency- and multipotent stemness-related markers (Oct4, Nanog, and Nestin). The morula and blastocyst formation rates of NT embryos derived from ABM-MSCs undergoing TSA treatment were significantly higher than in the TSA-unexposed group. Moreover, the NT blastocysts generated using TSA-treated ABM-MSCs exhibited significantly higher TCN and increased pluripotency extent measured with relative abundance of Oct4 and Nanog mRNAs as compared to the TSA-untreated group. Altogether, the improvements in morula/blastocyst yields and quality of cloned pig embryos seem to arise from enhanced abilities for promotion of correct epigenetic reprogramming of TSA-exposed ABM-MSC nuclei in a cytoplasm of reconstructed oocytes. To our knowledge, we are the first to report the successful production of mammalian high-quality NT blastocysts using TSA-dependent epigenomic modulation of ABM-MSCs.

Development and gene expression of porcine cloned embryos derived from bone marrow stem cells with overexpressing Oct4 and Sox2.

The present study compared the potential of porcine bone marrow mesenchymal stem cells (pBMSCs) at different passages as nuclear transfer (NT) donors and the developmental efficiency of NT embryos from donor cells transfected with/without Oct4 and Sox2. Early-passage pBMSCs showed higher proliferation and expression of Oct4 and Sox2 and differentiation potential into mesenchymal lineages than middle- and late-passage pBMSCs. Cleavage rate did not differ among pBMSCs at different passages, but NT embryos with early-passage pBMSCs and middle-passage pBMSCs transfected with Oct4 (Oct4-pBMSCs) had significantly (p<0.05) higher blastocyst development than those with middle-passage pBMSCs. The incidence of apoptotic bodies in NT blastocysts from late-passage pBMSCs and Sox2-transfected middle-passage pBMSCs (Sox2-pBMSCs) was significantly (p<0.05) higher than others. The transcriptional levels of Oct4, Sox2, Nanog, Cdx2, Dnmt3a, and Igf2r genes were significantly (p<0.05) higher in Oct4- and Sox2-pBMSCs NT embryos. Middle-passage pBMSCs NT embryos revealed lower transcriptional levels of Bcl2 than others, except Sox2-pBMSCs NT embryos. The transcriptional level of Bax increased gradually in NT embryos derived from pBMSCs following extended passages and was significantly (p<0.05) higher in Sox2-pBMSCs NT embryos. Our results demonstrated that early-passage pBMSCs are more potent in expressing transcription factors and displayed higher differentiation ability, and middle-passage pBMSCs transfected with Oct4 improved the developmental efficiency of NT embryos, suggesting that high Oct4 expression cells are more efficient as NT donors.

Potential functional roles of follistatin on bovine somatic cell nuclear transfer embryos

To demonstrate that follistatin treatment enhances the efficiency of nuclear transfer (SCNT), cell allocation and preimplantational development were determined in bovine SCNT embryos in the present study. Treatment of activated SCNT embryos with 10 ng/ml follistatin significantly increased the proportion of blastocyst development compared to untreated SCNT embryos. In addition, an increase in trophectoderm (TE) cell numbers and relatively higher proportion of TE cells to total cells were observed, but the number of inner cell mass (ICM) cell and total cell numbers were not changed (P < 0.05). No significant effect of other doses of follistatin was observed for the above endpoints. However, treatment with 1 and 10 ng/ml follistatin reduced the proportion of nuclear transfer blastocysts with an ICM ratio of > 60% relative to untreated nuclear transfer blastocysts at Day 7. No significant effect of follistatin treatment on proportions of nuclear transfer blastocysts with ICM ratio of 20-40% or 40-60% was observed. Taken together, these results suggested that follistatin can be used to increase developmental competence of SCNT embryos in terms of cell allocation, particularly TE cells, during preimplantation stages, subsequently enhancing placentation and birth of live offspring.

Identification and directed differentiation of nuclear transfer embryonic stem cells

Objective To explore the effects of metanephric cell microenvironment inducing differentiation of embryonic stem cells (ESCs) into renal cells.Methods We constructed mouse reconstructed embryos.The nuclear transfer embryonic stem cells (ntESCs) like colonies were identified by characterized morphology,alkaline phosphatase activity assay,and cell karyotypes examination.The differentiation was examined both in vivo and in vitro.The ntESCs were induced to form embryoid bodies by suspension culture.The cells from nuclear transfer embryoid bodies (ntEBs) were co-cultured with metanephric mesenchymal cells.Differences in mRNA expression (WT-1,Wnt-4,pax-2,c-Ret,podocalyxin and Nephrin) between the induced ntEBs and the controls were detected by reverse transcription-polymerase chain reaction (RT-PCR).The proteins of Pax-2 and WT-1 in the induced ntEBs and the controls were analyzed by immunofluorescence.Results Most of ntESCs had typical characteristics of mouse embryonic stem cells.The genes related to kidney development were expressed in the ntEBs cells,and the mRNA expression of WT-1,Wnt-4,pax-2,c-Ret,podocalyxin and Nephrin in the induced ntEBs was positive.Those in control groups were negative.The fluorescence intensity of Pax-2 in the induced ntEBs was high ( ++ ) ; The fluorescence intensity of WT-1 in the induced ntEBs was higher ( + ) than that in the control group ( ± ).Conclusion Metanephric cell microenvironment promotes differentiation of ntESCs which cultured from nuclear transfer blastocysts into renal cells. Key words: Nuclear transfer; Embryonic stem cells; Renal cells

Oocytes Selected Using BCB Staining Enhance Nuclear Reprogramming and the In Vivo Development of SCNT Embryos in Cattle

The selection of good quality oocytes is crucial for in vitro fertilization and somatic cloning. Brilliant cresyl blue (BCB) staining has been used for selection of oocytes from several mammalian species. However, the effects of differential oocyte selection by BCB staining on nuclear reprogramming and in vivo development of SCNT embryos are not well understood. Immature compact cumulus–oocyte complexes (COCs) were divided into control (not exposed to BCB), BCB+ (blue cytoplasm) and BCB− (colorless cytoplasm) groups. We found that BCB+ oocytes yielded a significantly higher somatic cell nuclear transfer (SCNT) blastocyst rate and full term development rate of bovine SCNT embryos than the BCB− and control oocytes. BCB+ embryos (embryos developed from BCB+ oocytes) showed increased acetylation levels of histone H3 at K9 and K18 (AcH3K9, AcH3K18), and methylation levels of histone H3 at K4 (H3K4me2) than BCB− embryos (embryos developed from BCB− oocytes) at the two-cell stage. Furthermore, BCB+ embryos generated more total cells, trophectoderm (TE) cells, and inner cell mass (ICM) cells, and fewer apoptotic cells than BCB− embryos. The expression of SOX2, CDX2, and anti-apoptotic microRNA-21 were up-regulated in the BCB+ blastocysts compared with BCB− blastocysts, whereas the expression of pro-apoptotic gene Bax was down-regulated in BCB+ blastocysts. These results strongly suggest that BCB+ oocytes have a higher nuclear reprogramming capacity, and that BCB staining can be used to select developmentally competent oocytes for nuclear transfer.

Identification of a suitable endogenous control gene in porcine blastocysts for use in quantitative PCR analysis of microRNAs

To obtain reliable results in quantitative PCR (qPCR) reactions, an endogenous control (EC) gene is needed to correct for systematic variations. In this study, a TaqMan low density array was used to quantify the expression levels of microRNA (miRNA) genes in in vivo fertilized, in vitro fertilized, parthenogenetic and somatic cell nuclear transfer blastocysts. The aim was to identify suitable EC genes for the qPCR analysis of miRNAs in porcine blastocysts. The results showed that thirty-six miRNAs were commonly expressed in the four kinds of embryos and the expression levels of eleven miRNAs were similar in the different embryo types (P-value>0.05). These 11 miRNAs were selected as candidate EC genes for further analysis and, of these, miR-16 was identified as the most stable EC gene by the GeNorm (a tool based on a pair-wise comparison model that calculates the internal control genes stability measure and determines the most reliable pair of EC genes) and NormFinder (an excel plug-in that uses an ANOVA-based model to estimate intra- and inter-group variation to indicate the single most stable EC gene) programs. In addition, a cell number normalization method validated miR-16 as a suitable EC gene for use in future qPCR analysis of miRNAs in porcine blastocysts.

20 ALTERED GENE EXPRESSION IN BOVINE SOMATIC CELL NUCLEAR-TRANSFERRED EMBRYOS AFTER TRICHOSTATIN A TREATMENT

Trichostatin A is a histone deacetylase inhibitor that improves histone acetylation and chromatin remodeling of somatic cell nuclear-transferred embryos (Iager et al. 2008 Cloning Stem Cells 10, 371–379; Maalouf et al. 2009 BMC Dev. Biol. 9, 11). We have previously observed that it also improves quality of bovine cloned embryos, which may increase pregnancy rates. This study aimed to evaluate the effect of trichostatin A treatment of zygotes on relative abundance of 9 transcripts in bovine nuclear-transferred blastocysts. In vitro matured oocytes were enucleated, fused to somatic cells and activated with ionomycin (Camargo et al. 2011 Reprod. Fertil. Dev. 23, 122). After activation, putative zygotes were randomly separated into 2 groups: NT-TRICHO, zygotes were cultured for 4 h in 6-DMAP followed by 7 h in CR2 aa medium plus with 2.5% fetal calf serum (FCS; Nutricell, Campinas, Brazil), both supplemented with 50 nM trichostatin A (Sigma); NT-CONT, zygotes were cultured in the same described conditions without thichostatin A supplementation. In vitro-fertilized embryos (IVF group) were used as a calibrator for relative transcript quantification. Embryos from the 3 groups were cultured in CR2 aa supplemented with 2.5% FCS under 5% CO2, 5% O2 and 90% N2 at 38.5°C. At 168 h postactivation, the embryos were rapidly frozen in liquid nitrogen. Pools of 10 blastocysts for each group were subject to RNA extraction and reverse transcription, in which cDNA was amplified by real-time PCR using the β-actin and GAPDH genes as endogenous references. The transcripts analysed encode high mobility group N1 (HMGN1), peroxiredoxin 1 (PRDX1), octamer-binding protein 4 (OCT4), insulin-like growth factor 1 and 2 receptors (IGF1r and IGF2r), glucose transporter 1 and 5 (GLUT1 and GLUT5), histone acetyltransferase (HAT) and heat shock protein 70.1 (HSP70) genes. Results were analysed by a pair-wise fixed reallocation randomization test using the REST software v.2. Data from NT-TRICHO and NT-CONT were compared with the IVF group and between themselves. The relative abundance of HSP70, PRDX1, IGF2r and HMGN1 transcripts was higher (P &lt; 0.05) in NT-TRICHO compared with the IVF group and no difference was detected for the other transcripts. In the NT-CONT group, the relative abundance of IGF2r and HAT was higher (P &lt; 0.05), whereas IGF1r and OCT4 were lower (P &lt; 0.05) compared with IVF embryos. When data from NT-TRICHO and NT-CONT were compared, a higher amount (P &lt; 0.05) of stress-associated transcripts (HSP70 and PRDX1) were found in NT-TRICO blastocysts. These results suggest that although trichostatin A may improve chromatin remodeling, alterations on gene expression still persist in bovine somatic cell nuclear-transferred blastocysts in comparison with IVF embryos. Financial support: Embrapa Project 01.07.01.002, CNPq 403019/2008–7 and Fapemig.