Nuclear Lysates Research Articles

Analysis of PTEN Complex Assembly and Identification of Heterogeneous Nuclear Ribonucleoprotein C as a Component of the PTEN-associated Complex

PTEN (phosphatase and tensin homolog deleted on chromosome 10) is well characterized for its role in antagonizing the phosphoinositide 3-kinase pathway. Previous studies using size-exclusion chromatography demonstrated PTEN recruitment into high molecular mass complexes and hypothesized that PTEN phosphorylation status and PDZ binding domain may be required for such complex formation. In this study, we set out to test the structural requirements for PTEN complex assembly and identify the component(s) of the PTEN complex(es). Our results demonstrated that the PTEN catalytic function and PDZ binding domain are not absolutely required for its complex formation. On the other hand, PTEN phosphorylation status has a significant impact on its complex assembly. Our results further demonstrate enrichment of the PTEN complex in nuclear lysates, suggesting a mechanism through which PTEN phosphorylation may regulate its complex assembly. These results prompted further characterization of other protein components within the PTEN complex(es). Using size-exclusion chromatography and two-dimensional difference gel electrophoresis followed by mass spectrometry analysis, we identified heterogeneous nuclear ribonucleoprotein C (hnRNP C) as a novel protein recruited to higher molecular mass fractions in the presence of PTEN. Further analysis indicates that endogenous hnRNP C and PTEN interact and co-localize within the nucleus, suggesting a potential role for PTEN, alongside hnRNP C, in RNA regulation.

Barrier-to-Autointegration Factor Proteome Reveals Chromatin-Regulatory Partners

Nuclear lamin filaments and associated proteins form a nucleoskeletal (“lamina”) network required for transcription, replication, chromatin organization and epigenetic regulation in metazoans. Lamina defects cause human disease (“laminopathies”) and are linked to aging. Barrier-to-autointegration factor (BAF) is a mobile and essential component of the nuclear lamina that binds directly to histones, lamins and LEM-domain proteins, including the inner nuclear membrane protein emerin, and has roles in chromatin structure, mitosis and gene regulation. To understand BAF's mechanisms of action, BAF associated proteins were affinity-purified from HeLa cell nuclear lysates using BAF-conjugated beads, and identified by tandem mass spectrometry or independently identified and quantified using the iTRAQ method. We recovered A- and B-type lamins and core histones, all known to bind BAF directly, plus four human transcription factors (Requiem, NonO, p15, LEDGF), disease-linked proteins (e.g., Huntingtin, Treacle) and several proteins and enzymes that regulate chromatin. Association with endogenous BAF was independently validated by co-immunoprecipitation from HeLa cells for seven candidates including Requiem, poly(ADP-ribose) polymerase 1 (PARP1), retinoblastoma binding protein 4 (RBBP4), damage-specific DNA binding protein 1 (DDB1) and DDB2. Interestingly, endogenous BAF and emerin each associated with DDB2 and CUL4A in a UV- and time-dependent manner, suggesting BAF and emerin have dynamic roles in genome integrity and might help couple DNA damage responses to the nuclear lamina network. We conclude this proteome is a rich source of candidate partners for BAF and potentially also A- and B-type lamins, which may reveal how chromatin regulation and genome integrity are linked to nuclear structure.

Attenuation of Renoinflammatory Cascade in Experimental Model of Diabetic Nephropathy by Sesamol

Diabetes has become the most common single cause of end-stage renal disease (ESRD) in the United States and Europe. Approximately 30-40% of patients with type I and 15% with type II diabetes mellitus develop end ESRD. The study was designed to evaluate the impact of sesamol on renal function and renoinflammatory cascade in streptozotocin (STZ)-induced diabetes. STZ-induced diabetic rats were treated with sesamol (2, 4, and 8 mg/kg/day; po) or with vehicle from the fifth to eighth weeks. After 8 weeks, urine albumin excretion, urine output, serum creatinine, blood urea nitrogen, creatinine, and urea clearance were measured. Cytoplasmic and nuclear fractions of kidney were prepared for the quantification of oxidative-nitrosative stress (lipid peroxidation, superoxide dismutase, catalase, nonprotein thiols, total nitric oxide), tumor necrosis factor-alpha (TNF-alpha), tissue growth factor-1 beta (TGF-beta1), p65 subunit of NFkappabeta, and caspase-3. After 8 weeks of STZ injection, the rats produced significant alteration in renal function, increased oxidative-nitrosative stress, TNF-alpha, TGF-beta1, caspase-3 activity in cytoplasmic lysate, and active p65 subunit of NFkappabeta in nuclear lysate of kidney of diabetic rats. Interestingly, co-administration of sesamol significantly and dose-dependently prevented biochemical and molecular changes associated with diabetes. Moreover, diabetic rats treated with insulin-sesamol combination produced more pronounced effect on molecular parameters as compared to their respective groups. The data reveal that sesamol modulates the release of profibrotic cytokines, oxidative stress, ongoing chronic inflammation, and apoptosis and thus exerts a marked renoprotective effect.

The Non-coding RNA gadd7 Is a Regulator of Lipid-induced Oxidative and Endoplasmic Reticulum Stress

In obesity and diabetes, an imbalance in fatty acid uptake and fatty acid utilization leads to excess accumulation of lipid in non-adipose tissues. This lipid overload is associated with cellular dysfunction and cell death, which contribute to organ failure, a phenomenon termed lipotoxicity. To elucidate the molecular mechanism of lipid-mediated cell death, we generated and characterized a mutant Chinese hamster ovary cell line that is resistant to palmitate-induced cell death. In this mutant, random insertion of a retroviral promoter trap has disrupted the gene for the non-coding RNA, growth arrested DNA-damage inducible gene 7 (gadd7). Here we report that gadd7 is induced by lipotoxic stress in a reactive oxygen species (ROS)-dependent fashion and is necessary for both lipid- and general oxidative stress-mediated cell death. Depletion of gadd7 by mutagenesis or short hairpin RNA knockdown significantly reduces lipid and non-lipid induced ROS. Furthermore, depletion of gadd7 delays and diminishes ROS-induced endoplasmic reticulum stress. Together these data are the first to implicate a non-coding RNA in a feed-forward loop with oxidative stress and its induction of the endoplasmic reticulum stress response.

Proteomic Study of Hepatic Nuclear Extracts in an Adaptive Acetaminophen Tolerance Model

Abstract Introduction Variability in response to acetaminophen (APAP)-induced aseptic inflammation and tolerance to the impending hepatic damage has been described. To understand the mechanism of adaptive tolerance, we investigated the proteomic profiles of crude nuclear lysates in a mouse model. We hypothesized that pretreatment with low doses of APAP prior to a toxic dose results in differential protein expression. Materials and Methods Mice (BALB/C) were separated into three groups: the pretreated (PT) group received incremental doses of APAP while the last dose only (LD) and naïve groups were given saline vehicle. A toxic dose of APAP was administered on the seventh day to the PT and LD animals only and all groups were euthanized 3 h postdose. Total protein from crude hepatic nuclear lysates were applied to protein arrays and analyzed by immunoaffinity mass spectrometry. Results and Discussion Comparative data analyses of protein peaks revealed a protein that was significantly increased at m/z of 60,030 (p60) in the LD animals vs the other two groups. The closest match for the preliminary identification of the p60 protein based on a Swiss-Prot/TagIdent database search using the approximate isoelectric point and molecular weight information was Ccr4–Not complex subunit-2. This protein is a subunit of a multiprotein complex and serves as a transcriptional suppressor involved in controlling mRNA synthesis and degradation. Preliminary identification was also supported by Western blot analysis using anti-CNOT2 antibody. Conclusion Considering the APAP tolerance model, we conclude that toxicogenomic approaches such as nuclear profiling are useful tools in assessing differential expression of transcriptional factors involved in inflammatory response and adaptive tolerance to toxins.

Role for Med12 in Regulation of Nanog and Nanog Target Genes

Nanog, Oct4, and Sox2 form the core of a transcription factor network that maintains embryonic stem cells in the pluripotent state in both humans and mice. These critical factors have been implicated as both positive and negative regulators of transcription, varying by promoter and differentiation state of the cell. The Mediator complex, a ubiquitous conserved complex of approximately 30 subunits, facilitates transcription by coordinating RNA polymerase II binding to target promoters via gene-specific activators and can be divided into several functional subcomplexes. Med12 is part of a subcomplex of four proteins associated with the core Mediator complex and has been found to function both in repressing and activating transcription when recruited to target promoters. We identified an interaction between Med12 and Nanog and present evidence of involvement of Med12 in regulation of Nanog function. Gene expression analysis of embryonic stem cells knocked down for Med12 showed a similarity to Nanog knockdown, with increased expression of Nanog-repressed targets and decreased expression of Nanog-activated targets. Using chromatin immunoprecipitation, we found that Med12 and Nanog co-occupied Nanog target promoters in embryonic stem cells and that Med12 dissociated from target promoters upon differentiation with kinetics similar to Nanog. Our results indicate that Nanog and Med12 function in concert to regulate Nanog target genes and identify a novel role for Med12 in embryonic stem cell regulation.

Linker Histone Phosphorylation Regulates Global Timing of Replication Origin Firing

Despite the presence of linker histone in all eukaryotes, the primary function(s) of this histone have been difficult to clarify. Knock-out experiments indicate that H1s play a role in regulation of only a small subset of genes but are an essential component in mouse development. Here, we show that linker histone (H1) is involved in the global regulation of DNA replication in Physarum polycephalum. We find that genomic DNA of H1 knock-down cells is more rapidly replicated, an effect due at least in part to disruption of the native timing of replication fork firing. Immunoprecipitation experiments demonstrate that H1 is transiently lost from replicating chromatin via a process facilitated by phosphorylation. Our results suggest that linker histones generate a chromatin environment refractory to replication and that their transient removal via protein phosphorylation during S phase is a critical step in the epigenetic regulation of replication timing.

Attenuation of diabetic nephropathy by tocotrienol: Involvement of NFkB signaling pathway

Aim Diabetic nephropathy is a serious complication for patients with diabetes mellitus. Approximately 30–40% of patients with type I and 15% with type II diabetes mellitus develop end stage renal disease. The study was designed to evaluate the impact of tocotrienol on renal function and reno-inflammatory cascade in streptozotocin-induced diabetes. Main methods Streptozotocin (STZ)-induced diabetic rats were treated with tocotrienol (25, 50 and 100 mg/kg), α-tocopherol (100 mg/kg) or with vehicle form 5th to 8th weeks. After 8 weeks, urine albumin excretion, urine output, serum creatinine, blood urea nitrogen, creatinine and urea clearance were measured. Cytoplasmic and nuclear fractions of kidney was prepared for the quantification of oxidative–nitrosative stress (lipid peroxidation, superoxide dismutase, catalase, non protein thiols, total nitric oxide), tumor necrosis factor-alpha (TNF-α), tissue growth factor-1beta (TGF-β1), p65 subunit of NFκβ and caspase-3. Key findings After 8 weeks of STZ injection, the rats produced significant alteration in renal function, increased oxidative–nitrosative stress, TNF-α, TGF-β1, caspase-3 activity in cytoplasmic lysate and active p65 subunit of NFκβ in nuclear lysate of kidney of diabetic rats. Interestingly, co-administration of tocotrienol significantly and dose-dependently prevented biochemical and molecular changes associated with diabetes. Tocotrienol (100 mg/kg) was demonstrated to be more effective than α-tocopherol (100 mg/kg). Moreover, diabetic rats treated with insulin-tocotrienol combination produced more pronounced effect on molecular parameters as compared to their respective groups. Significance Taken together, the data reveal that tocotrienol modulates the release of profibrotic cytokines, oxidative stress, ongoing chronic inflammation and apoptosis and thus exerts a marked renoprotective effect.

Yin Yang 1 Is a Critical Repressor of Matrix Metalloproteinase-9 Expression in Brain Neurons

Membrane depolarization controls long lasting adaptive neuronal changes in brain physiology and pathology. Such responses are believed to be gene expression-dependent. Notably, however, only a couple of gene repressors active in nondepolarized neurons have been described. In this study, we show that in the unstimulated rat hippocampus in vivo, as well as in the nondepolarized brain neurons in primary culture, the transcriptional regulator Yin Yang 1 (YY1) is bound to the proximal Mmp-9 promoter and strongly represses Mmp-9 transcription. Furthermore, we demonstrate that monoubiquitinated and CtBP1 (C-terminal binding protein 1)-bound YY1 regulates Mmp-9 mRNA synthesis in rat brain neurons controlling its transcription apparently via HDAC3-dependent histone deacetylation. In conclusion, our data suggest that YY1 exerts, via epigenetic mechanisms, a control over neuronal expression of MMP-9. Because MMP-9 has recently been shown to play a pivotal role in physiological and pathological neuronal plasticity, YY1 may be implicated in these phenomena as well.

551: The role of hypoxia in regulation of trophoblast proliferation and gene expression

In early placental development, cytotrophoblasts (CTB) require a low oxygen environment for proliferation. p63, a p53 homolog, has been implicated in maintenance of proliferation/stem cell state in stratified epithelia. We previously showed that p63 is present in CTB and its expression correlates with markers of proliferation. Our objective was to look at the relationship between proliferation, oxygen tension, and p63 expression in CTB. HTR8 cells, derived from first trimester CTB, were grown under normoxia (20% O2) or hypoxia (2% O2). Immunocytochemistry (ICC) was performed with antibodies to p63 and Ki67, a cell proliferation marker. Nuclear and cytoplasmic lysates were analyzed by Western blot. Total RNA (n=2 for normoxia, n=3 for hypoxia) was analyzed using a whole genome mRNA expression microarray consisting of 48,000 probes. All mitotically active cells, indicated with bright staining for Ki-67, were also positive for p63, irrespective of oxygen tension. ICC showed no difference in the number of Ki67-positive cells, suggesting the proliferation rate was the same in both conditions. By Western blot, p63 was present in similar amounts in nuclear extracts of normoxic and hypoxic cells. The microarray data showed high correlation coefficients (r2=0.987-0.992) within replicate samples, indicating excellent reproducibility. There were 22 genes downregulated and 24 genes upregulated in hypoxia; of the latter, 12 have previously been shown to be induced with hypoxia. p63 expression correlates with proliferation, and specifically with mitosis, independent of oxygen tension. The gene expression analysis in this pilot study has identified several genes differentially expressed in normoxic vs. hypoxic conditions, and suggests a number of molecular pathways that may be involved in hypoxic response in CTB. Future studies will include expanding the number of samples to identify additional differentially expressed genes with higher statistical confidence, and studying their role in primary CTB, which better represent the in vivo state

CdTe Nanoparticles Display Tropism to Core Histones and Histone‐Rich Cell Organelles

The disclosure of the mechanisms of nanoparticle interaction with specific intracellular targets represents one of the key tasks in nanobiology. Unmodified luminescent semiconductor nanoparticles, or quantum dots (QDs), are capable of a strikingly rapid accumulation in the nuclei and nucleoli of living human cells, driven by processes of yet unknown nature. Here, it is hypothesized that such a strong tropism of QDs could be mediated by charge-related properties of the macromolecules presented in the nuclear compartments. As the complex microenvironment encountered by the QDs in the nuclei and nucleoli of live cells is primarily presented by proteins and other biopolymers, such as DNA and RNA, the model of human phagocytic cell line THP1, nuclear lysates, purified protein, and nucleic acid solutions is utilized to investigate the interactions of the QDs with these most abundant classes of intranuclear macromolecules. Using a combination of advanced technological approaches, including live cell confocal microscopy, fluorescent lifetime imaging (FLIM), spectroscopic methods, and zeta potential measurements, it is demonstrated that unmodified CdTe QDs preferentially bind to the positively charged core histone proteins as opposed to the DNA or RNA, resulting in a dramatic shift off the absorption band, and a red shift and decrease in the pholuminescence (PL) intensity of the QDs. FLIM imaging of the QDs demonstrates an increased formation of QD/protein aggregates in the presence of core histones, with a resulting significant reduction in the PL lifetime. FLIM technology for the first time reveals that the localization of negatively charged QDs to their ultimate nuclear and nucleolar destinations dramatically affects the QDs' photoluminescence lifetimes, and offers thereby a sensitive readout for physical interactions between QDs and their intracellular macromolecular targets. These findings strongly suggest that charge-mediated QD/histone interactions could provide the basis for QD nuclear localization downstream of intracellular transport mechanisms.

SREBP Activity Is Regulated by mTORC1 and Contributes to Akt-Dependent Cell Growth

SummaryCell growth (accumulation of mass) needs to be coordinated with metabolic processes that are required for the synthesis of macromolecules. The PI3-kinase/Akt signaling pathway induces cell growth via activation of complex 1 of the target of rapamycin (TORC1). Here we show that Akt-dependent lipogenesis requires mTORC1 activity. Furthermore, nuclear accumulation of the mature form of the sterol responsive element binding protein (SREBP1) and expression of SREBP target genes was blocked by the mTORC1 inhibitor rapamycin. We also show that silencing of SREBP blocks Akt-dependent lipogenesis and attenuates the increase in cell size in response to Akt activation in vitro. Silencing of dSREBP in flies caused a reduction in cell and organ size and blocked the induction of cell growth by dPI3K. Our results suggest that the PI3K/Akt/TOR pathway regulates protein and lipid biosynthesis in an orchestrated manner and that both processes are required for cell growth.

Biliverdin reductase is a transporter of haem into the nucleus and is essential for regulation of HO-1 gene expression by haematin

hBVR (human biliverdin reductase) is an enzyme that reduces biliverdin (the product of haem oxygenases HO-1 and HO-2 activity) to the antioxidant bilirubin. It also functions as a kinase and as a transcription factor in the MAPK (mitogen-activated protein kinase) signalling cascade. Fluorescence correlation spectroscopy was used to investigate the mobility of hBVR in living cells and its function in the nuclear transport of haematin for induction of HO-1. In transiently transfected HeLa cells only kinase-competent hBVR translocates to the nucleus. A reduced mobility in the nucleus of haematin-treated cells suggests formation of an hBVR-haematin complex and its further association with large nuclear components. The binding of haematin is specific, with the formation of a 1:1 molar complex, and the C-terminal 7-residue fragment KYCCSRK(296) of hBVR contributes to the binding. The following data suggest formation of dynamic complexes of hBVR-haematin with chromatin: (i) the reduction of hBVR mobility in the presence of haematin is greater in heterochromatic regions than in euchromatic domains and (ii) hBVR mobility is not retarded by haematin in nuclear lysates that contain only soluble factors. Moreover, hBVR kinase activity is stimulated in the presence of double-stranded DNA fragments corresponding to HO-1 antioxidant and HREs (hypoxia response elements), as well as by haematin. Experiments with nuclear localization, export signal mutants and si-hBVR [siRNA (small interfering RNA) specific to hBVR] indicate that nuclear localization of hBVR is required for induction of HO-1 by haematin. Because gene regulation is energy-dependent and haematin regulates gene expression, our data suggest that hBVR functions as an essential component of the regulatory mechanisms for haem-responsive transcriptional activation.

Activation of striatal inflammatory mediators and caspase-3 is central to haloperidol-induced orofacial dyskinesia

The undesired extrapyramidal movement disorders observed with long term treatment with haloperidol have been associated with striatal neurodegeneration. The present study was designed to investigate the effect of prolonged haloperidol treatment on striatal levels of inflammatory mediators and caspase-3 and to correlate it with orofacial dyskinesia, a movement disorder observed with long term haloperidol treatment. Prolonged administration of haloperidol (1, 2, 5 mg/kg) to rats produced dose-dependent increase in the orofacial dyskinetic movements and induced a marked oxidative stress in the striatum. Lower dose of haloperidol (1 mg/kg) decreased NO levels but did not induce TNF-α or NF-κB expression. At higher doses (2 and 5 mg/kg), increased levels of total nitric oxide and TNF-α in cytoplasmic lysate and active p65 subunit of NF-κB in nuclear lysates of rat brain were observed. These doses (2 and 5 mg/kg) also induced an increased expression of caspase-3 protein in striatal cytoplasmic fraction as shown by western blot analysis. Collectively, we conclude that oxidative stress mediated increase in inflammatory mediators may initiate the apoptotic pathway (caspase-3) after chronic haloperidol treatment. All this is well correlated with behavioural development of orofacial dyskinesia.

Tumor Suppressor Protein p53 Regulates Megakaryocytic Polyploidization and Apoptosis

The molecular mechanisms underlying differentiation of hematopoietic stem cells into megakaryocytes are poorly understood. Tumor suppressor protein p53 can act as a transcription factor affecting both cell cycle control and apoptosis, and we have previously shown that p53 is activated during terminal megakaryocytic (Mk) differentiation of the CHRF-288-11 (CHRF) cell line. Here, we use RNA interference to reduce p53 expression in CHRF cells and show that reduced p53 activity leads to a greater fraction of polyploid cells, higher mean and maximum ploidy, accelerated DNA synthesis, and delayed apoptosis and cell death upon phorbol 12-myristate 13-acetate-induced Mk differentiation. In contrast, reduced p53 expression did not affect the ploidy or DNA synthesis of CHRF cells in the absence of phorbol 12-myristate 13-acetate stimulation. Furthermore, primary Mk cells from cultures initiated with p53-null mouse bone marrow mononuclear cells displayed higher ploidy compared with wild-type controls. Quantitative reverse transcription-PCR analysis of p53-knockdown CHRF cells, compared with the "scrambled" control CHRF cells, revealed that six known transcriptional targets of p53 (BBC3, BAX, TP53I3, TP53INP1, MDM2, and P21) were down-regulated, whereas BCL2 expression, which is known to be negatively affected by p53, was up-regulated. These studies show that the functional role of the intrinsic activation of p53 during Mk differentiation is to control polyploidization and the transition to endomitosis by impeding cell cycling and promoting apoptosis.

Lysophosphatidic Acid Protects Cancer Cells from Histone Deacetylase (HDAC) Inhibitor-induced Apoptosis through Activation of HDAC

Histone deacetylases (HDACs) catalyze the removal of acetyl groups from histones and contribute to transcriptional repression. In addition, the HDAC inhibitors induce apoptosis in cancer cells through alterations in histone acetylation and activation of the tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) apoptotic pathway. Lysophosphatidic acid (LPA) is a growth factor that promotes survival of cancer cells through activation of G protein-coupled receptors. Here we show that HDAC inhibitors can induce apoptosis through activation of the TRAIL apoptotic pathway, and LPA prevented HDAC inhibitor-induced apoptosis and increased TRAIL receptor DR4 (death receptor 4) protein expression. This was associated with increased HDAC1 recruitment to the DR4 promoter following LPA treatment and a reduction in HDAC inhibitor-induced histone acetylation in the DR4 promoter. In addition, LPA induces HDAC enzyme activity in a dose- and time-dependent manner, and this is associated with HDAC1 activation and increased binding of HDAC1 to HDAC2. Reducing the expression of HDAC1 significantly lowered LPA-induced HDAC activity and increased histone acetylation. LPA induction of HDAC activity was blocked by the LPA receptor antagonist, Ki16425, or by inhibiting receptor activation with pertussis toxin. Reducing the expression of the LPA receptor LPA(1) also blocked LPA-induced HDAC activation. In addition, LPA reduced histone acetyltransferase enzymatic activity. Finally, LPA attenuated the ability of the HDAC inhibitor to reduce HDAC activity. Thus, LPA enhances survival of cancer cells by increasing HDAC activity and reducing histone acetylation.

Enrichment of Distinct Microfilament-Associated and GTP-Binding-Proteins in Membrane/Microvilli Fractions from Lymphoid Cells

Lymphocyte microvilli mediate initial adhesion to endothelium during lymphocyte transition from blood into tissue but their molecular organization is incompletely understood. We modified a shear-based procedure to prepare biochemical fractions enriched for membrane/microvilli (MMV) from both human peripheral blood T-lymphocytes (PBT) and a mouse pre-B lymphocyte line (300.19). Enrichment of proteins in MMV relative to post nuclear lysate was determined by LC/MS/MS analysis and label-free quantitation. Subsequent analysis emphasized the 291 proteins shared by PBT and 300.19 and estimated by MS peak area to be highest abundance. Validity of the label-free quantitation was confirmed by many internal consistencies and by comparison with Western blot analyses. The MMV fraction was enriched primarily for subsets of cytoskeletal proteins, transmembrane proteins and G-proteins, with similar patterns in both lymphoid cell types. The most enriched cytoskeletal proteins were microfilament-related proteins NHERF1, Ezrin/Radixin/Moesin (ERMs), ADF/cofilin and Myosin1G. Other microfilament proteins such as talin, gelsolin, myosin II and profilin were markedly reduced in MMV, as were intermediate filament- and microtubule-related proteins. Heterotrimeric G-proteins and some small G-proteins (especially Ras and Rap1) were enriched in the MMV preparation. Two notable general observations also emerged. There was less overlap between the two cells in their transmembrane proteins than in other classes of proteins, consistent with a special role of plasma membrane proteins in differentiation. Second, unstimulated primary T-lymphocytes have an unusually high concentration of actin and other microfilament related proteins, consistent with the singular role of actin-mediated motility in the immunological surveillance performed by these primary cells.

Telomere dysfunction and cell survival: roles for distinct TIN2-containing complexes

Telomeres are maintained by three DNA-binding proteins (telomeric repeat binding factor 1 [TRF1], TRF2, and protector of telomeres 1 [POT1]) and several associated factors. One factor, TRF1-interacting protein 2 (TIN2), binds TRF1 and TRF2 directly and POT1 indirectly. Along with two other proteins, TPP1 and hRap1, these form a soluble complex that may be the core telomere maintenance complex. It is not clear whether subcomplexes also exist in vivo. We provide evidence for two TIN2 subcomplexes with distinct functions in human cells. We isolated these two TIN2 subcomplexes from nuclear lysates of unperturbed cells and cells expressing TIN2 mutants TIN2-13 and TIN2-15C, which cannot bind TRF2 or TRF1, respectively. In cells with wild-type p53 function, TIN2-15C was more potent than TIN2-13 in causing telomere uncapping and eventual growth arrest. In cells lacking p53 function, TIN2-15C was more potent than TIN2-13 in causing telomere dysfunction and cell death. Our findings suggest that distinct TIN2 complexes exist and that TIN2-15C–sensitive subcomplexes are particularly important for cell survival in the absence of functional p53.

Identification of a p53-response element in the promoter of the proline oxidase gene

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5′ flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at −1161 to −1188 bp upstream of the POX transcriptional start site.

Ca2+/Calmodulin-Dependent Kinase Kinase α Is Expressed by Monocytic Cells and Regulates the Activation Profile

Macrophages are capable of assuming numerous phenotypes in order to adapt to endogenous and exogenous challenges but many of the factors that regulate this process are still unknown. We report that Ca2+/calmodulin-dependent kinase kinase α (CaMKKα) is expressed in human monocytic cells and demonstrate that its inhibition blocks type-II monocytic cell activation and promotes classical activation. Affinity chromatography with paramagnetic beads isolated an approximately 50 kDa protein from nuclear lysates of U937 human monocytic cells activated with phorbol-12-myristate-13-acetate (PMA). This protein was identified as CaMKKα by mass spectrometry and Western analysis. The function of CaMKKα in monocyte activation was examined using the CaMKKα inhibitors (STO-609 and forskolin) and siRNA knockdown. Inhibition of CaMKKα, enhanced PMA-dependent CD86 expression and reduced CD11b expression. In addition, inhibition was associated with decreased translocation of CaMKKα to the nucleus. Finally, to further examine monocyte activation profiles, TNFα and IL-10 secretion were studied. CaMKKα inhibition attenuated PMA-dependent IL-10 production and enhanced TNFα production indicating a shift from type-II to classical monocyte activation. Taken together, these findings indicate an important new role for CaMKKα in the differentiation of monocytic cells.