Nuclear Large Subunit rDNA Research Articles

Morpho-phylogenetic evidence reveals novel species and new records of Nigrograna (Nigrogranaceae) associated with medicinal plants in Southwestern China.

During a survey of saprobic fungal niches in Southwestern China, eighteen ascomycetous collections of Nigrograna (Nigrogranaceae, Pleosporales, Dothideomycetes) were found on dead branches of medicinal plants. These taxa were characterized and identified based on morphological and culture characteristics, and phylogenetic analyses of a combined the internal transcribed spacer region of rDNA (ITS), nuclear large subunit rDNA (28S, LSU), RNA polymerase second-largest subunit (rpb2), nuclear small subunit rDNA (18S, SSU), and translation elongation factor 1-alpha (tef1-α) sequence dataset also confirmed their placement. As a result, four novel species, namely Nigrogranacamelliae, N.guttulata, N.longiorostiolata and N.neriicola were described. Additionally, four new host records of N.acericola, N.magnoliae, N.oleae and N.thymi were introduced. Furthermore, this study addresses the taxonomic status of N.trachycarpi, proposing its synonymy under N.oleae. Detailed illustrations, descriptions and informative notes for each newly identified taxon and novel host record are provided in this study.

Two novel members of Onygenales, Keratinophyton kautmanovae and K. keniense spp. nov. from soil

Two new Keratinophyton species, K. kautmanovae sp. nov. and K. keniense sp. nov., isolated from soil samples originating from two different geographical and environmental locations (Africa and Europe) are described and illustrated. Phylogenetically informative sequences obtained from the internal transcribed spacer (ITS) region and the nuclear large subunit (LSU) rDNA, as well as their unique phenotype, fully support novelty of these two fungi for this genus. Based on ITS and LSU combined phylogeny, both taxa are resolved in a cluster with eight accepted species, including K. alvearium, K. chongqingense, K. hubeiense, K. durum, K. lemmensii, K. siglerae, K. submersum, and K. sichuanense. The new taxon, K. kautmanovae, is characterized by clavate, smooth to coarsely verrucose conidia, absence of arthroconidia, slow growth at 25 °C, and no growth at 30 °C, while K. keniense is morphologically unique with a high diversity of conidial shapes (clavate, filiform, globose, cymbiform and rhomboid). Both species are described based on their asexual, a chrysosporium-like morph. While the majority of hitherto described Keratinophyton taxa came from Europe, India and China, the new species K. keniense represents the first reported taxonomic novelty for this genus from Africa.

Three New Periconia Species Isolated from Wurfbainia villosa in Guangdong, China: A Discussion on the Doubtful Taxa Clustering in this Genus

During a survey of fungi on Wurfbainia villosa in Guangdong Province, China, three novel species, Periconia endophytica, P. yangjiangensis, and P. wurfbainiae, belonging to Periconiaceae in Pleosporales, Dothideomycetes are proposed based on morphological and phylogenetic evidence. Periconia endophytica was isolated from the healthy leaves of W. villosa, while P. yangjiangensis and P. wurfbainiae were obtained from the dead stems of the same host. Notably, holomorphs were observed in P. wurfbainiae. The morphological characteristics of the novel taxa are compared with closely related species within Periconia. Illustrations, morphological descriptions, and phylogenetic analyses are provided for the novel taxa. Multilocus phylogeny of the combined internal transcribed spacer (ITS), large subunit nuclear rDNA (LSU), small subunit nuclear ribosomal rDNA (SSU), and partial translation elongation factor 1–α (tef1-α) regions supported the establishment of three new species. Furthermore, the taxa clustering in Periconia, Flavomyces fulophazii, and Sporidesmium tengii, are discussed for further investigation of their taxonomic placements.

Tetraploa wurfbainiae sp. nov. (Tetraplosphaeriaceae, Pleosporales) isolated from Wurfbainia villosa in Guangdong, China

ABSTRACT During a survey for microfungi associated with traditional medicinal plants in Guangdong Province, China, an interesting species in the Tetraplosphaeriaceae was isolated from the dead stem of Wurfbainia villosa (Zingiberaceae). The new collection is characterised by brown to dark brown, cylindrical to ovate, four-columned conidia, mostly with four straight or slightly flexuous, smooth, and long apical appendages. The phylogenetic analysis of the combined dataset of internal transcribed spacer (ITS), large subunit nuclear rDNA (LSU), the partial translation elongation factor 1-α (tef1-α), and β-tubulin (tub2) further indicated that the new collection forms a distinct branch in Tetraploa and clusters as a sister taxon with T. dwibahubeeja. Thus, we introduce a new species, Tetraploa wurfbainiae, based on distinct morphology and multi-locus phylogeny, accompanied by a description, illustration, and morphological comparison with related taxa. This is the first report of Tetraploa species on the medicinal plant W. villosa. This study enhances our understanding of the fungal species associated with the medicinal plant W. villosa.

Three New Species of Apiospora (Amphisphaeriales, Apiosporaceae) on Indocalamus longiauritus, Adinandra glischroloma and Machilus nanmu from Hainan and Fujian, China.

Apiospora is widely distributed throughout the world, and most of its hosts are Poaceae. In this study, Arthrinium-like strains were isolated from non-Poaceae in the Hainan and Fujian provinces of China. Based on the combined DNA sequence data of the internal transcriptional spacer (ITS), partial large subunit nuclear rDNA (LSU), translation extension factor 1-α gene (TEF1-α) and β-tubulin (TUB2), the collected Apiospora specimens were compared with known species, and three new species were identified. Based on morphological and molecular phylogenetic analyses, Apiospora adinandrae sp. nov., A. bawanglingensis sp. nov. and A. machili sp. nov. are described and illustrated.

Notes of Five Wood-Decaying Fungi from Juwangsan National Park in Korea

Wood-decaying fungi are essential decomposers in forest ecosystems. They decompose wood substrates by producing various lignocellulolytic enzymes, which have significant industrial and medical applications. A survey was conducted at the Juwangsan National Park from 2018 to 2019 to determine the diversity of macrofungi in Korea. Five previously unrecorded wood-decaying polyporoid and corticioid fungi were identified among the collected specimens: Eichleriella sinensis, Hymenochaete anomala, Hyphoderma subsetigerum, Lyomyces orientalis, and Pseudowrightoporia crassihypha. These species were identified based on morphological, molecular, and phylogenetic analyses of the internal transcribed spacer (ITS) and nuclear large subunit rDNA (nLSU) region. In this study, we provide detailed macro- and micro-morphological figures with phylogenetic trees to support the discovery of five new species in Korea.

A phylogenetic assessment of a fungicolous lineage in Coniocybomycetes: Chaenotricha, a new genus of Trichaptum-inhabiting species.

The globally distributed genus Trichaptum is one of the most species-rich among polypores in terms of hosting other fungi. Among Trichaptum-associates, there is a group of mazaediate lichenized fungi (Coniocybomycetes, Ascomycota) that previously had an uncertain phylogenetic position. DNA sequences - mitochondrial small subunit (mtSSU), nuclear large subunit rDNA (nuLSU), and internal transcribed spacer (ITS) - were obtained from 29 specimens collected from Europe and North America. Maximum likelihood and Bayesian inference analyses of these three gene loci were used to infer phylogenetic position and relationships among lineages. Statistical tests were used to find which phenotypical characteristics distinguish species. The molecular sequence data provide evidence that the fungicolous specimens form a distinct lineage within Coniocybomycetes sister to the combined clade of Chaenotheca s. lat. and Sclerophora. Considering its phylogenetic placement and strict specialization, we describe a new genus - Chaenotricha. This fungicolous lineage contains three species based on molecular characteristics. Morphological characters mostly overlap except for spore size and stalk length of apothecia. We provide a new combination, Chaenotricha obscura, for the only previously described species for which we designate an epitype, and introduce a new species - Chaenotricha cilians. The third lineage remains undescribed because of a small sample size, which did not allow us to clearly delineate species boundaries. Citation: Suija A, McMullin RT, Lõhmus P (2023). A phylogenetic assessment of a fungicolous lineage in Coniocybomycetes: Chaenotricha, a new genus of Trichaptum-inhabiting species. Fungal Systematics and Evolution 12: 255-269. doi: 10.3114/fuse.2023.12.13.

Taxonomic and Phylogenetic Updates on Apiospora: Introducing Four New Species from Wurfbainia villosa and Grasses in China.

Apiospora, an ascomycetous genus in Apiosporaceae, comprises saprobes, endophytes, and pathogens of humans and plants. They have a cosmopolitan distribution with a wide range of hosts reported from Asia. In the present study, we collected and isolated Apiospora species from Wurfbainia villosa and grasses in Guangdong and Yunnan provinces in China. Multi-locus phylogeny based on the internal transcribed spacer, the large subunit nuclear rDNA, the partial translation elongation factor 1-α, and β-tubulin was performed to clarify the phylogenetic affinities of the Apiospora species. Based on the distinctive morphological characteristics and molecular evidence, Ap. endophytica, Ap. guangdongensis, Ap. wurfbainiae, and Ap. yunnanensis are proposed. Descriptions, illustrations, and notes for the newly discovered species are provided and compared with closely related Apiospora species. An updated phylogeny of Apiospora is presented, along with a discussion on the phylogenetic affinities of ambiguous taxa.

First Report of Epicoccum latusicollum Causing Leaf Blight on Curcuma kwangsiensis in China.

Curcuma kwangsiensis S. G. Lee et C. F. Liang is a traditional Chinese medicinal plant distributed in Guangxi and Yunnan Province, China. In May 2021, a leaf blight disease on C. kwangsiensi was observed in a plantation (~ 2 ha) in Lingshan county (21°51'00″N, 108°44'00″E), Guangxi Province. Disease incidence was up to 30% (n = 200). Initially, yellow to brown, irregular, water-soaked spots appeared at the tips or margins of leaves. As the disease progressed, the lesions gradually enlarged, merged. Finally, the entire leaf wilted, leading to defoliation. To isolate the pathogen, eighteen small pieces ( ~ 5 mm2) were cut from the margin of the necrotic lesions, surface disinfected with 1% NaOCl solution for 2 min, and rinsed three times in sterile water. Then the tissues were plated onto potato dextrose agar (PDA) and incubated for 3 days at 28°C. Hyphal tips from recently germinated spores were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which ten isolates with similar morphological characterization. Two single-spore isolates (CK45.1 and CK45.2) were subjected to further morphological and molecular characterization. Colonies on PDA were villose, had a dense growth of aerial mycelia, and appeared white to grayish eventually. Pycnidia were brown, predominantly spheroidal, and 45.0 to 205.4 μm in diameter (n = 60). Conidia were ellipsoidal, aseptate, and 3.8 to 6.1 × 1.8 to 3.6 μm (n = 90). Morphological characteristics are similar to those of Epicoccum latusicollum (Chen et al. 2017).For molecular identification, primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), RPB2-Ep-F (GGTCTTGTGTGCCCCGCTGAGAC)/RPB2-Ep-R TCGGGTGACATGACAATCATGGC), and TUB2-Ep-F (GTTCACCTTCAAACCGGTCAATG)/TUB2-Ep-R (AAGTTGTCGGGACGGAAGAGCTG) were used to amplify the internal transcribed spacer (ITS), partial nuclear large subunit rDNA (LSU), RNA polymerase II second largest subunit (rpb2), and β-tubulin (tub2) genes, respectively. The obtained ITS (OP788080-81), LSU (OP811325-26), rpb2 (OP811267-68) and tub2 (OP811269-70) sequences showed 99.8% (478/479, and 478/479 bp), 99.9% (881/882, and 870/871 bp), 99.8 to 100% (429/431, and 429/430 bp), and 99.7% (332/333, and 332/333 bp) identity with those of ex-type strain E. latusicollum CGMCC 3.18346 (KY742101, KY742255, KY742174, KY742343). In addition, a phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular characteristics, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on nine plants (1 leaf per plant) were inoculated with mycelial discs from 5-day-old water-agar medium (WA) cultures of the strain CK45.1. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free WA discs served as control. Plants were covered with transparent plastic bags and maintained in a greenhouse at 25°C with a 12 h photoperiod. Six days post-inoculation, the inoculated sites of leaves showed brown lesions, while the control remained healthy. The experiments repeated three times showed similar results. Koch's postulates were fulfilled by re-isolation of E. latusicollum from the lesions. To our knowledge, this is the first report of E. latusicollum causing leaf blight of C. kwangsiensi in China. This report might provide important information for growers to manage this disease.

Morphological and phylogenetic evidence reveal three new Pseudohydnum (Auriculariales, Basidiomycota) species from North China.

Pseudohydnum is characterized by gelatinous basidiomata with hydnoid hymenophores and longitudinally septate basidia. In this study, samples of the genus from North China were examined morphologically and phylogenetically using a dataset of the internal transcribed spacer of the ribosomal RNA gene and the nuclear large subunit rDNA. This study describes three new species, namely Pseudohydnum abietinum, Pseudohydnum candidissimum, and Pseudohydnum sinobisporum. Pseudohydnum abietinum is characterized by pileate and pale clay pink basidiomata when fresh, with a rudimentary stipe base, four-celled basidia, and broadly ellipsoid to ovoid or subglobose basidiospores (6-7.5 × 5-6.3 μm). P. candidissimum is characterized by very white basidiomata when fresh, frequently four-celled basidia, and broadly ellipsoid to subglobose basidiospores (7.2-8.5 × 6-7 μm). P. sinobisporum is characterized by ivory basidiomata when fresh, two-celled basidia, ovoid to broadly ellipsoid, or subglobose basidiospores (7.5-9.5 × 5.8-7.2 μm). The main characteristics, type localities, and hosts of Pseudohydnum species are listed.

Out of the Qinghai-Tibetan plateau: Origin, evolution and historical biogeography of Morchella (both Elata and Esculenta clades).

Morchella has become a research hotspot because of its wide distribution, delicious taste, and phenotypic plasticity. The Qinghai-Tibet Plateau subkingdoms (QTPs) are known as the cradle of Ice age biodiversity. However, the diversity of Morchella in the QTPs has been poorly investigated, especially in phylogenetic diversity, origin, and biogeography. The genealogical concordance phylogenetic species recognition (GCPSR, based on Bayesian evolutionary analysis using sequences from the internal transcribed spacer (ITS), nuclear large subunit rDNA (nrLSU), translation elongation factor 1-α (EF1-α), and the largest and second largest subunits of RNA polymerase II (RPB1 and RPB2)), differentiation time estimation, and ancestral region reconstruction were used to infer Morchella's phylogenetic relationships and historical biogeography in the QTPs. Firstly, a total of 18 Morchella phylogenetic species are recognized in the QTPs, including 10 Elata clades and 8 Esculenta clades of 216 individuals Secondly, the divergences of the 18 phylogenetic species were 50.24-4.20 Mya (Eocene-Pliocene), which was closely related to the geological activities in the QTPs. Furthermore, the ancestor of Morchella probably originated in the Northern regions (Qilian Shan, Elata cade) and southwestern regions (Shangri-La, Esculenta clade) of QTPs and might have migrated from North America (Rufobrunnea clade) via Beringian Land Bridge (BLB) and Long-Distance Dispersal (LDD) expansions during the Late Cretaceous. Moreover, as the cradle of species origin and diversity, the fungi species in the QTPs have spread out and diffused to Eurasia and South Africa starting in the Paleogene Period. This is the first report that Esculenta and Elata clade of Morchella originated from the QTPs because of orogenic, and rapid differentiation of fungi is strongly linked to geological uplift movement and refuge in marginal areas of the QTPs. Our findings contribute to increasing the diversity of Morchella and offer more evidence for the origin theory of the QTPs.

A new freshwater species Conticribra sinica (Thalassiosirales, Bacillariophyta) from the lower reaches of the Yangtze River, China

A new freshwater diatom species Conticribra sinica sp. nov. Yu, You et Wang from three lakes in the lower reaches of the Yangtze River, China, is described here using a combination of morphological and molecular data from ribosomal DNA genes. The primary distinguishing characteristic of C. sinica was the presence of a non-plicate or slightly-plicate valve face and a single ring marginal fultoportulae that was located at the junction between the valve face and the mantle. There were 4-11 valve face fultoportulae that were located at the subcenter of the valve face. In addition, a single rimoportula replaced a marginal fultoportulae. Areolae loculate were open to the outside by irregularly circular foramina or slit foramina that are radially arranged. Internally, cribra were continuously arranged long a radial arrangement of areolae. Characteristics of the new species with other similar species of Conticribra. Phylogenetic analysis of the nuclear small subunit (SSU) rDNA sequences and nuclear large subunit (LSU) rDNA gene sequences revealed that C. sinica in a single clade at a considerable sequence distance from the other Conticribra species.

First Report of Maize Stalk Rot Caused by Epicoccum latusicollum on Maize (Zea mays L.) in China.

Maize (Zea mays L.) is the most important crop in Heilongjiang province. In July 2021, maize stalk rot was observed on approximately 10% of maize in a 2.4 ha field of Xiangfang District, Harbin City (N45°44'23″, E126°43'19″). Infected plants showed softening of the stalks at the lower internodes, and the pith tissue was disintegrated and brown to reddish. Fifteen symptomatic plants were collected from the field. The discolored stalk pith tissues were cut into small pieces (4 × 2 mm), superficially disinfected with 1% NaClO for 3 min, 70% ethanol for 10 s, and then washed three times with sterile distilled water. The disinfected tissues were placed on potato dextrose agar (PDA) amended with streptomycin sulfate (50 mg/L) and incubated at 25°C for 1 week. Twenty-one cultures were obtained using hyphal tip technology and cultured on PDA for 7 days at 25°C for morphological and molecular analyses. The mycelia of the cultures were initially white but became grayish with time, and reddish-brown diffusible pigments were produced. A dark green discoloration was produced on malt extract agar (MEA) using the NaOH spot test (REF). Pycnidia were brown, predominantly spheroidal, and measured 80.1 to 130.2 × 110.5 to 220.6 μm. Conidia were ellipse, aseptate, and in a size range of 4.3 to 6.8 × 2.1 to 3.2 μm. The isolates were initially identified as Epicoccum latusicollum based on morphological features (Chen et al. 2017). To confirm the identity of E. latusicollum, primers TUB2Fd/TUB4Rd, LR0R/LR5, ITS1/ITS4 and RPB2-5F2/fRPB2-7cR (Valenzuela-Lopez et al. 2018) were used to amplify beta tubulin (tub2), nuclear large subunit rDNA (LSU), internal transcribed spacer (ITS), and RPB2 genes, respectively for the representative isolate JF3. These sequences were deposited in GenBank (GenBank accession no. OK490498, OK445527, OK483136, and OK490497) and had 100% (276/276 bp), 100% (842/842 bp), 100% (501/501 bp), and 100% (589/589 bp) nucleotide identity with E. latusicollum isolate GZDS2018BXT010 (GenBank accession no. MK516208, MK516207, MK516206, and MK852278). To fulfill Koch's postulates, pathogenicity tests for all isolates were performed by individually inoculating surface-disinfected stalks of five healthy maize plants (10-leaf stage) between the 2nd and 3rd stem nodes with 20 μL conidial suspension at a concentration of 106 conidia/mL as described by Zhang et al. (2016). Five other healthy surface-disinfected maize plants inoculated with sterile distilled water served as control. All plants were kept at 25 ± 0.5°C in a greenhouse with a photoperiod of 12 h and approximately 90% relative humidity. After 10 days, all inoculated plants showed symptoms that were similar to those of the infected maize plants observed in the field, whereas the control plants were asymptomatic. The Epicoccum isoaltes were re-isolated from symptomatic plants, and species identification was performed using the morphological and molecular methods described above. To our knowledge, this is the first report of E. latusicollum causing maize stalk rot in China, and this report will assist with monitoring distribution of the disease and developing management recommendations.

First Report of Puccinia pelargonii-zonalis Causing Rust on Pelargonium × hortorum in Xinjiang Province, China.

Geranium (Pelargonium × hortorum) is an ornamental plant cultivated throughout world. In May 2019, typical symptoms of rust with nearly 90% disease incidence were observed on leaves of Pel. × hortorum growing in pots in a scenic spot in the ancient city of Kashgar, Xinjiang province, China. Early symptoms of the disease appeared small lesions with pale-yellow halos on the lower leaf surfaces. Infected tissues subsequently formed a concentric circle of sori on lesion reaching a final diameter of 0.5 to 1.5 cm, which resulted in leaf blighting and premature. Two representative specimens were deposited in the Mycological Herbarium of Tarim University (HMUT 8001 and HMUT 8002). Urediniospores were globose or subglobose to ovoid, light brown, echinulate, thin-walled with two conspicuous subequatorial pores, 19.8 to 27.3 × 17.8 to 23.6 μm (24.3 × 21.7 μm average, n=30). Telia and teliospores were not seen. The sizes and characteristics of urediniospores were similar with those of Puccinia pelargonii-zonalis as described by Doidge (1926). To confirm the identification, genomic DNAs were extracted directly from sori on diseased leaves from isolates HMUT 8001 and HMUT 8002. The part of the nuclear large subunit (LSU, 28S) rDNA was amplified and sequenced following Aime et al. (2006), and deposited in GenBank (Accession Nos. MT648851 and MT648852). An NCBI blast search indicated that 99.6% identity of the LSU (772/775 nucleotides) with Puc. pelargonii-zonalis on Pel. hortorum (KX999887) from Australia (Marin-Felix et al. 2017). The phylogenetic analysis based on the LSU sequences using Maximum-Likelihood and Bayesian methods placed the Xinjiang isolates from Pel. × hortorum in the same clade with the reference sequences of Puc. pelargonii-zonalis. Pathogenicity test was confirmed by Koch's postulates. Leaves of three healthy potted plants were sprayed with a spore suspension (2 × 105 spores/ml). Sterile water was sprayed on three healthy seedlings as controls. Inoculated and control plants were covered with a plastic bag and placed in a moist chamber with 90% relative humidity at 25°C. Initial symptoms were observed with small light-yellow spots on the upper surface after 15 days, but not in the control plants. Puc. pelargonii-zonalis has been previously reported on Pel. × hortorum in Argentina, Australia, Canada, Georgia, Greece, India, Mexico, New Zealand, Norway, Portugal, South Africa, the United States, and Venezuela (Farr and Rossman 2021). Geranium rust was first found in Yunnan province in southwestern China (Zhou and Zhuang 2005). However, this is the first report of geranium rust in Xinjiang province in northwestern China. The occurrence of the disease seriously affected their ornamental and economic value.

One New Species and Two New Host Records of Apiospora from Bamboo and Maize in Northern Thailand with Thirteen New Combinations

The genus Apiospora is known as a cosmopolitan genus, found across various substrates. In this study, four Apiospora taxa were obtained from the decaying stems of bamboo and maize in northern Thailand. Apiospora collections were compared with known species based on the morphological characteristics and the DNA sequence data of internal transcribed spacer (ITS), the partial large subunit nuclear rDNA (LSU), the translation elongation factor 1-alpha gene (TEF1-α) and beta-tubulins (TUB2). Apiospora chiangraiense sp. nov. and two new host records (Ap. intestini and Ap. rasikravindra) are introduced here based on the morphological characteristics and multi-locus analyses. Additionally, thirteen species previously identified as Arthrinium are introduced as new combinations in Apiospora, viz., Ap. acutiapica, Ap. bambusicola, Ap. biserialis, Ap. cordylines, Ap. cyclobalanopsidis, Ap. euphorbiae, Ap. gelatinosa, Ap. locuta-pollinis, Ap. minutispora, Ap. pseudorasikravindrae, Ap. septate, Ap. setariae and Ap. sorghi.

Four new species in the Tremellafibulifera complex (Tremellales, Basidiomycota).

Samples of species close to Tremellafibulifera from China and Brazil are studied, and T.fibulifera is confirmed as a species complex including nine species. Five known species (T.cheejenii, T.fibulifera s.s., T. “neofibulifera”, T.lloydiae-candidae and T.olens) and four new species (T.australe, T.guangxiensis, T.latispora and T.subfibulifera) in the complex are recognized based on morphological characteristics, molecular evidence, and geographic distribution. Sequences of eight species of the complex were included in the phylogenetic analyses because T.olens lacks molecular data. The phylogenetic analyses were performed by a combined sequence dataset of the internal transcribed spacer (ITS) and the partial nuclear large subunit rDNA (nLSU), and a combined sequence dataset of the ITS, partial nLSU, the small subunit mitochondrial rRNA gene (mtSSU), the translation elongation factor 1-α (TEF1), the largest and second largest subunits of RNA polymerase II (RPB1 and RPB2). The eight species formed eight independent lineages with robust support in phylogenies based on both datasets. Illustrated description of the six species including Tremellafibulifera s.s., T. “neofibulifera” and four new species, and discussions with their related species, are provided. A table of the comparison of the important characteristics of nine species in the T.fibulifera complex and a key to the whitish species in Tremella s.s. are provided.

An Overview of 24 Years of Molecular Phylogenetic Studies in Phallales (Basidiomycota) With Notes on Systematics, Geographic Distribution, Lifestyle, and Edibility.

The order Phallales (Basidiomycota) is represented by gasteroid fungi with expanded and sequestrate basidiomata, known as stinkhorns and false truffles. In phalloids, the first DNA sequence was published in 1997, and after that, some studies aimed to resolve phylogenetic conflicts and propose new species based on DNA markers; however, the number of families and genera in the order still generates controversies among researchers. Thus, this work aims to provide an overview of Phallales diversity represented by selected DNA markers available in public databases. We retrieved Phallales sequences from DNA databases (GenBank and UNITE) of seven markers: ITS (internal transcribed spacer), nuc-LSU (nuclear large subunit rDNA), nuc-SSU (nuclear small subunit rDNA), mt-SSU (mitochondrial small subunit rDNA), ATP6 (ATPase subunit 6), RPB2 (nuclear protein-coding second largest subunit of RNA polymerase), and TEF1-α (translation elongation factor subunit 1α). To compose our final dataset, all ITS sequences retrieved were subjected to BLASTn searches to identify additional ITS sequences not classified as Phallales. Phylogenetic analyses based on Bayesian and maximum likelihood approaches using single and combined markers were conducted. All ITS sequences were clustered with a cutoff of 98% in order to maximize the number of species hypotheses. The geographic origin of sequences was retrieved, as well as additional information on species lifestyle and edibility. We obtained a total of 1,149 sequences, representing 664 individuals. Sequences of 41 individuals were unidentified at genus level and were assigned to five distinct families. We recognize seven families and 22 genera in Phallales, although the delimitation of some genera must be further revisited in order to recognize only monophyletic groups. Many inconsistencies in species identification are discussed, and the positioning of genera in each family is shown. The clustering revealed 118 species hypotheses, meaning that approximately 20% of all described species in Phallales have DNA sequences available. Information related to geographic distribution represents 462 individuals distributed in 46 countries on all continents, except Antarctica. Most genera are saprotrophic with only one putative ectomycorrhizal genus, and 2.1% of the legitimate specific names recognized in Phallales are confirmed edible species. Great progress in the molecular analyses of phalloids has already been made over these years, but it is still necessary to solve some taxonomic inconsistencies, mainly at genus level, and generate new data to expand knowledge of the group.

Molecular systematics of Keratinophyton: the inclusion of species formerly referred to Chrysosporium and description of four new species

Four new Keratinophyton species (Ascomycota, Pezizomycotina, Onygenales), K. gollerae, K. lemmensii, K. straussii, and K. wagneri, isolated from soil samples originating from Europe (Austria, Italy, and Slovakia) are described and illustrated. The new taxa are well supported by phylogenetic analysis of the internal transcribed spacer region (ITS) region, the combined data analysis of ITS and the nuclear large subunit (LSU) rDNA, and their phenotype. Based on ITS phylogeny, within the Keratinophyton clade, K. lemmensii is clustered with K. durum, K. hubeiense, K. submersum, and K. siglerae, while K. gollerae, K. straussii and K. wagneri are resolved in a separate terminal cluster. All four new species can be well distinguished from other species in the genus based on phenotype characteristics alone. Ten new combinations are proposed for Chrysosporium species which are resolved in the monophyletic Keratinophyton clade. A new key to the recognized species is provided herein.

First Report of Leaf Blight Caused by Limonomyces roseipellis on Maize (Zea mays L) in China.

Maize (Zea mays L.) is one of the major crops in China. In July 2020, leaf blight was observed on approximately 18% of maize plants at the 852 Farm, Heilongjiang province. Symptoms appeared as yellow necrotic lesions on leaf tips and margins, which later expanded to the entire. The disease was first observed on the lower leaves of the plants and then progressed up the plant. Thirty symptomatic leaves were collected in 2020, and tissue samples between healthy and necrotic area (4 × 2 mm) were surface disinfected with 1% NaOCl for 3 min, 70% ethanol for 10 s, and washed three times with sterile water. Disinfected tissues were placed on potato dextrose agar (PDA) amended with streptomycin sulfate (50 mg/liter) and incubated at 25°C for 1 week. Cultures were purified using the hyphal-tip technique for morphological and molecular analyses. Morphological characteristics were observed on 1-week-old PDA cultures grown at 25°C. Mycelium changed from cream colored to pale pink or reddish, and the back of plate turned pink with time. Hyphae were hyaline, 2 to 7 μm wide, with clamps at primary septa. Hyaline basidiospores were sphere to ellipsoid, and ranged from 8 to 10 × 6 to 9 μm. Based on the presence of clamp connections and morphological features, the fungus was preliminarily identified as Limonomyces roseipellis (Stalpers et al. 1982). To confirm the identity of L. roseipellis, primers ITS1/ITS4 (White et al. 1990), MS1/MS2 (White et al. 1990), and LR0R/LR5 (Vilgalys and Hester 1990) were used to amplify the internal transcribed spacer (ITS) region, the partial mitochondrial small subunit rDNA (mtSSU) and nuclear large subunit rDNA (nuLSU), respectively. These sequences were deposited in GenBank (GenBank accession no.s MW067756, MW322806 and MW386178). The ITS sequence had 99.55% nucleotide identity (660 bp/668 bp) with L. roseipellis isolate EF82 (GenBank accession no. MK918632). The mtSSU sequence was 99.69% identical (634 bp/636 bp) to that of L. roseipellis strain SY-LQG101 (Genbank accession no. KF824718). The nuLSU sequence was 99.14% identical (924 bp/932 bp) to that of L. roseipellis (GenBank accession no. EU622844). A single basidiospore was isolated and cultured on PDA for pathogenicity testing. To fulfill Koch's postulates, ten healthy, surface-disinfected maize plants grown in pots (four to five leaves stage) were sprayed with basidiospore suspension (1×106 spores/ml); another ten healthy surface-disinfected maize plants sprayed with distilled water to serve as controls. Plants were sealed in plastic bags immediately after inoculation and maintained at 90% relative humidity in a mist chamber for 24 h at 25°C with a 12-h light cycle (Nicoli et al. 2016). Plants were moved and maintained in the greenhouse and observed for disease development. The experiment was conducted twice. Leaf blight symptoms appeared on all inoculated plants 3 to 5 days postinoculation and were consistent with symptoms observed in the field. No disease symptoms were observed on control plants. The pathogen was reisolated from diseased plants, and species identification was confirmed by the morphological and molecular method described. L. roseipellis has been reported to infect Cynodon dactylon, Lolium perenne and Festuca arundinacea, respectively. To our knowledge, this is the first report of the identification of L. roseipellis as a pathogen of maize in China, and this report will assist with monitoring distribution of the disease to assist with developing management recommendations.

The Evolution of Life Modes in Stictidaceae, with Three Novel Taxa.

Ostropales sensu lato is a large group comprising both lichenized and non-lichenized fungi, with several lineages expressing optional lichenization where individuals of the same fungal species exhibit either saprotrophic or lichenized lifestyles depending on the substrate (bark or wood). Greatly variable phenotypic characteristics and large-scale phylogenies have led to frequent changes in the taxonomic circumscription of this order. Ostropales sensu lato is currently split into Graphidales, Gyalectales, Odontotrematales, Ostropales sensu stricto, and Thelenellales. Ostropales sensu stricto is now confined to the family Stictidaceae, which includes a large number of species that are poorly known, since they usually have small fruiting bodies that are rarely collected, and thus, their taxonomy remains partly unresolved. Here, we introduce a new genus Ostropomyces to accommodate a novel lineage related to Ostropa, which is composed of two new species, as well as a new species of Sphaeropezia, S. shangrilaensis. Maximum likelihood and Bayesian inference analyses of mitochondrial small subunit spacers (mtSSU), large subunit nuclear rDNA (LSU), and internal transcribed spacers (ITS) sequence data, together with phenotypic data documented by detailed morphological and anatomical analyses, support the taxonomic affinity of the new taxa in Stictidaceae. Ancestral character state analysis did not resolve the ancestral nutritional status of Stictidaceae with confidence using Bayes traits, but a saprotrophic ancestor was indicated as most likely in a Bayesian binary Markov Chain Monte Carlo sampling (MCMC) approach. Frequent switching in nutritional modes between lineages suggests that lifestyle transition played an important role in the evolution of this family.