Nt Identity Research Articles

First report of zucchini tigre mosaic virus infecting four cucurbit crops in China.

Cucurbits including ridge gourd (Luffa acutangula), Chieh-qua (Benincasa hispida Cogn. var. Chieh-qua How), Trichosanthes anguina, and sponge gourd (L. cylindrica) are important vegetables in most Asian countries. The 90 viruses known to infect cucurbits include 15 species in genus Potyvirus. In October 2020, nine cucurbit samples with leaf distortion, blister and mottle were collected from the same field of Foshan City, Guangdong Province, China. All samples were tested by western blot with potyvirus-specific antibody (Agdia lnc., Elkhart, IN) and RT-PCR with potyvirus degenerate primers Sprimer/M4T (Chen et al. 2001). Seven out of nine samples were positive for potyvirus in both tests, including one ridge gourd, one Chieh-qua, one sponge gourd, two bottle gourd (Lagenaria siceraria) and two T. anguina. All PCR products (~700-bp) were cloned and sequenced. Sequences of seven amplicons (OM522614 to OM522618, OP090158 to OP090159) containing partial nib and cp genes shared 80.3-100% nucleotide (nt) identity among themselves, and 81.2-97.7% nt identity with ZTMV isolates from China (MN267689, LC371337, MK988416). Except for one Chieh-qua sample, papaya ringspot virus (PRSV) was detected in the same samples where ZTMV was found through sequencing of the amplicons mentioned above. The obtained sequences (OM808942 to OM808945, OP090170 to OP090171) were 95.4-100% identical with PRSV isolates from China. Further RT-PCR was conducted with ZTMV-specific primers ZTMVdF/ZTMVdR targeting partial P3 and 6K1 genes, and PRSV-specific primers PRSV3778F/PRSV4630R targeting partial P3, full-length 6K1 and partial CI genes for all nine samples. Consistently, seven samples were positive for ZTMV, among which one Chieh-qua sample was infected with only ZTMV and six samples were co-infected with ZTMV and PRSV. Interspecific recombination event has been reported for ZTMV (Peng et al. 2021), to detect the recombinants, RT-PCR was conducted for all nine samples with primers ZTMV600F/ZTMV2400R covering the interspecies recombination site (Peng et al. 2021). A fragment (~1.8 kb) was amplified from one T. anguina sample and sequenced (OP090172), which had 97.0% nt identity with the reported recombinant ZTMV-KF17 (MK988415). To fulfill Koch's postulates, a Chieh-qua sample detected with ZTMV but not PRSV, was used for mechanical inoculation on Chieh-qua seedlings. Blister and leaf distortion similar to the field symptoms were observed 21 days post-inoculation. ZTMV infection was verified by RT-PCR with primer pairs Sprimer/M4T and ZTMVdF/ZTMVdR, respectively, followed by sequencing. No amplicon was detected with primer pairs PRSV3778F/PRSV4630R and ZTMV600F/ZTMV2400R. To study the incidence of ZTMV and PRSV, 33 samples including T. anguina, ridge gourd and Chieh-qua were collected from three different fields in Foshan City in May 2022, and were tested by RT-PCR with ZTMV and PRSV primers aforementioned. 30.3% (10/33) of the samples were positive for ZTMV, 39.4% (13/33) tested positive for PRSV, and 21.2% (7/33) were co-infected with the two viruses. Amplicons of ZTMV (600 bp) from all positive samples were sequenced (OP090160 to OP090169), and were 84.8-85.5% identical with ZTMV-TW (LC371337). Recombinant of ZTMV was detected in one T. anguina with primers mentioned above and was sequenced (OP090173), which had 96.2% nt identity with ZTMV-KF17. To our knowledge, this is the first report of ZTMV infecting ridge gourd, Chieh-qua, T. anguina and sponge gourd. The results implied that ZTMV had a potential risk to more cucurbit crops in the field.

First report of Leek yellow stripe virus, Onion yellow dwarf virus, and the putative allium polerovirus A in elephant garlic (Allium ampeloprasum) in Brazil.

Five elephant garlic plants (Allium ampeloprasum L.) showing leaf symptoms of chlorotic streaks and mosaic (Figure 1A and B) were collected, in September 2021, in an experimental area in municipality of Rio do Sul (27°11'07"S, 49°39'39"W), State of Santa Catarina, Brazil. Total RNA was extracted using TRIzol® reagent (Invitrogen, USA), according to the manufacturer's instructions to investigate viral infection. The RNA from all five plants were pooled into a single sample for cDNA library construction with the TruSeq Stranded Total RNA with Ribo-Zero Plant (Illumina) kit, which was then sequenced on the Illumina HiSeq2500 platform (Proteimax Biotechnology LTDA). After high throughput sequencing (HTS), 49 million raw reads (each 151nt) were generated. They were trimmed with the BBduk tool and de novo assembled with the Tadpole assembler tool (Geneious Software version 2022). A total of 28,345 contigs were generated and searched against the NCBI virus genome database using BLASTn and BLASTx, with positive results for two potyviruses, leek yellow stripe virus (LYSV), onion yellow dwarf virus (OYDV), and the putative polerovirus allium polerovirus A (APVA). The trimmed reads were mapped with the BBmap tool (Bushell 2014), using reference sequences for LYSV (NC_004011), OYDV (NC_005029), and APVA isolate Won (MH898527). A total of 806,060 reads were mapped, resulting in the nearly complete genome of LYSV (isolate RDS22-2, 10,268 bp, ON565071), which shared the highest (89.41%) nucleotide (nt) identity with LYSV isolate MG (KP258216). The nearly complete genome of OYDV (isolate RDS22-1, 10,519 bp, ON565070) was assembled using 311,467 reads, being 90.21% nt identical to OYDV isolate G-118 (KF632714). The APVA genome (isolate RDS22-3, 4,367 bp, ON565072, Figure 1C) was assembled from 116,303 reads and it shared the highest (90.73%) nt identity with APVA isolate Won. Subsequently, each sample was RT-PCR screened separately for potyviruses and poleroviruses, using the generic primer pairs NIb2F/NIb3R (Zheng et al., 2010) and Pol-G-F/Pol-G-R (Knierim et al., 2010), respectively. Amplified DNA fragments with approximately 350 bp and 1000 bp were obtained for potyviruses and poleroviruses, respectively, and were sent for Sanger sequencing (ACTGene, Alvorada, Brazil). The Sanger derived partial sequences shared 98 to 100% nt identities with corresponding HTS-derived sequences. The most common virus was LYSV, which was found in three of the five tested samples, whereas OYDV and APVA were only found in one sample each. The plants were also screened with specific primers for each virus, and none of the samples revealed mixed infections. Elephant garlic is primarily utilized for industrial garlic production in several countries, and it is now being researched in Brazil for the same purpose. It can be observed from this study that elephant garlic is susceptible to two of the most common viruses in garlic (LYSV and OYDV), which must be considered in the future while developing resistant varieties or in using thermotherapy and shoot tip/meristem culture to recover virus-free cultivars. LYSV and OYDV have already been described in Brazil infecting Allium sativum (Kitajima 2020). The only complete APVA sequence available is from China (Isolate Won), but no further characterization of the virus has been performed and published. The occurrence of this virus in Brazil highlights the importance of further research to obtain a more robust virus characterization.

First report of Watermelon crinkle leaf‐associated virus 1 (WCLaV‐1) on Cucurbita pepo in the United States

Zucchini (Cucurbita pepo) is widely grown in Florida and contributes to the US$35 million value production of all types of squash in the state (United States Department of Agriculture/ National Agricultural Statistics Service, 2021). In August 2022, zucchini (cv. Renegade) in a commercial field in North Florida, USA, showed pronounced chlorosis and mild crinkle on leaves in scattered areas (Fig. 1). The disease incidence was approximately 35%. One diseased leaf from each of six zucchini plants were collected randomly for diagnosis; three from 21-day-old plants (noted as Z272), and three from 28-day-old plants (noted as Z273). All samples tested negative for Cucumber mosaic virus, Squash mosaic virus and Zucchini yellow mosaic virus using ImmunoStrips (Agdia, USA). Subsequently, total plant RNA was extracted using a Quick-RNA MiniPrep kit (Zymo Research, USA). A conventional one-step RT-PCR (New England Biolabs, USA) was used to test the samples using primer pairs for Cucurbit chlorotic yellows virus (CCYV; Jailani et al., 2022), Watermelon crinkle leaf-associated virus 1 and 2 (WCLaV-1 and WCLaV-2; genus Coguvirus) (Hernandez et al., 2021) and Watermelon mosaic virus 2 (WMV-2; 5′-AAAGCTCCATACATAGCTGAGAC-3′/ 5′-CGGCCTTCATTTGTGCTATTG-3′). The samples were negative for CCYV, WMV-2 and WCLaV-2, but positive for WCLaV-1 using specific primers for the RNA-dependent RNA polymerase (RdRP) region on RNA-1 (Table 1). To confirm the detection of WCLaV-1, specific RNA-2 primers, targeting the coding regions of movement protein (MP) and nucleocapsid protein (NP), respectively, were used in an RT-PCR assay (Table 1, Hernandez et al., 2021). The sequences of the RdRP amplicon (881 bp) (GenBank Accession No. OP484885) had 99% nucleotide identity with WCLaV-1 isolates from China (KY781184) and the USA (OL469153 and OL469154). The sequences of the MP amplicon (538 bp) (OP484884) shared 99% nt identity with Australian WCLaV-1 isolate S6 (ON934517) and American isolates “Turner” and “Wilcox-02” (OM751929 and OM751928). The NP amplicon sequences (786 bp) (OP484883) shared 99% nt identity with Chinese isolate KF-1 (KY781186) and American isolate Wig-WM-D10 (MW559081). Both the samples (Z272 and Z273) had similar results, therefore only sequences from sample Z272 were submitted to GenBank. The results were further confirmed by SYBR®-based real-time RT-PCR using the WCLaV-1 MP gene-specific primer pairs (WCLaV-1FP/WCLaV-1RP) (Adeleke et al., 2022). WCLaV-1 and WCLaV-2 were first reported in watermelon in China (Xin et al., 2017), followed by America (Hernandez et al., 2021), Brazil (Maeda et al., 2022) and Australia (Mulholland et al., 2023). To our knowledge, this is the first report of WCLaV-1 on zucchini in America and globally. The mode of transmission of the virus in currently unknown. Studies to understand the potential of vector and seed transmission should be conducted to aid the development of best management practices. In the meantime, growers will have to rely on keeping pests of zucchini crop under control, practicing tillage of plant residues, and removing weeds routinely as general good practices.

First report of Cotton leafroll dwarf virus infecting cacao (Theobroma cacao L.) trees in Brazil.

Cotton leafroll dwarf virus (genus Polerovirus, family Solemoviridae) has been commonly reported affecting cotton plants (Gossypium spp., family Malvaceae) and several weed species (Ramos-Sobrinho et al., 2021; Sedhain et al., 2021). During a recent survey, cacao (Theobroma cacao L.) trees exhibiting virus-like symptoms such as leaf mosaic, vein clearing, and yellow spot were observed in the south part of the state of Bahia, northeastern Brazil, in 2022. Leaf samples were randomly collected from symptomatic cacao plants (n=30) growing in an affected area of approximately 30 ha. Total RNA obtained from pooled cacao samples were subjected to Illumina HiSeq 2500 sequencing as previously described (Keith et al., 2021), and partial sequences of cotton leafroll dwarf virus (CLRDV), and other virus-specific sequence contigs, were de novo assembled according to Ramos-Sobrinho et al. (2021). To further investigate the presence of CLRDV in cacao leaves, total RNA was individually extracted using a modified silica protocol (Rott and Jelkmann, 2001) and used as template for cDNA synthesis with random hexamers using the SuperScript™ IV First-Strand Synthesis System (Invitrogen, CA, USA) following the manufacturer´s protocol. Detection of CLRDV was carried out by reverse transcription-polymerase chain reaction (RT-PCR) with the primers PL4F and o3-R, which amplify the open reading frame 3 (ORF3) encoding the capsid protein (Corrêa et al., 2005). Expected size amplicons (~0.6 kb) were observed from 16 out of 30 symptomatic plants, indicating ~53% of the cacao trees were infected by CLRDV. Considering 14 symptomatic plants tested negative for CLRDV, the symptoms observed here could also be caused by other viral groups or abiotic stress. To confirm the detection of CLRDV, the first half (~3.5kb) of the viral genome was amplified from two representative cacao samples using the primers P20F and P22R (Avelar et al., 2020). The RT-PCR products were gel-purified using the Wizard® SV Gel and PCR Clean-Up System (Promega, WI, USA) and Sanger sequenced. The RNA Illumina sequencing from pooled cacao samples (n=30) yielded 34,610,572 million trimmed reads. Two contigs of 868 and 839 nucleotides (nt) in length, and sharing high nt identity with CLRDV isolates, were assembled from 6,903 and 10,271 reads, at a coverage depth of 795 and 1,224x, respectively. Together, these contigs represent ~29% of the complete viral genome and included part of the 5´-untraslated region, ORF0 and the second half of ORF1-ORF2. Additional CLRDV-like contigs were observed across the viral genome, but they were not considered for further analyses due to the poor sequence quality. The Illumina- and Sanger-derived ORF0 and partial ORF1-ORF2 sequences shared >97% nt identity, suggesting they were congruent. Pairwise sequence comparisons for ORF0, encoding the gene silencing suppressor P0, indicated the cacao-associated isolates shared 99.7 and 99.2% nt and amino acid (aa) identity one with another, respectively. The ORF0 nt sequences showed 91.9-93.8 and 90.7-93.6% identity, while the aa sequences shared 85.8-88.5 and 86.2-90.0% similarity, with CLRDV isolates previously reported in South America and the USA, respectively. Finally, the ~3.5kb nt sequences of cacao-infecting CLRDV isolates shared 92.9-95.8% identity with CLRDV genomes deposited in NCBI-GenBank. The Bayesian phylogenetic tree reconstructed based on ORF0 nt sequences showed the new sequences were more closely related to CLRDV-atypical isolates (GenBank accession nos. KF359946, KF359947, KF906260, and KF906261). Together, these results suggest the new ORF0 sequences belong to CLRDV and were deposited in GenBank under accession nos. ON954058-ON954059. To our knowledge, this is the first report of CLRDV infecting cacao plants, expanding the range of malvaceous hosts of this polerovirus. CLRDV is largely known for causing yield losses in cotton crops, but additional studies are needed to determine if CLRDV infection is detrimental to cacao production.

First Report of Youcai Mosaic Virus Infecting Yam in China.

Yam (Dioscorea opposita Thunb.) is cultivated mainly as a functional food and for nutritional and medicinal purposes in China (1). It is propagated through tubers and this facilitates the spread and accumulation of viruses in the crop, eventually leading to yield losses (2). At present, different virus species belonging to the genera Aureusvirus, Badnavirus, Carlavirus, Comovirus, Cucumovirus, Fabavirus, Macluravirus, Potexvirus and Potyvirus have been reported in yams (3) and fifteen viruses in these genera have been detected in China. In July 2020, a survey of viral diseases on yam was conducted in plantations of Wenxian and Mengzhou counties in Henan Province, China. Fifty-four leaf samples of Dioscorea opposite showing mosaic and leaf discoloration (Supplementary Fig1) were collected from eight fields (five to ten plants per field). These leaf samples were ground in liquid nitrogen and total RNA was extracted from a portion of the mixed powder using RNAprep Pure Plant Plus Kit (TIANGEN Biotech, Beijing, China). A cDNA library was constructed using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, USA) after ribosomal RNA depletion using Ribo-off rRNA Depletion Kit (Vazyme Biotech, Nanjing, China), and sequenced on the Illumina NovaSeq 6000 system at the Berry Genomics Corporation (Beijing, China). A total of 87,075 contigs (>200 bp) were generated from de novo assembly (CLC Genomic Workbench 10.0) from a total of 34,656,172 paired-end reads. After BLASTn analysis, three contigs with the length of 1009, 1340 and 1859 nucleotides shared 96.33%, 96.72% and 96.29% nt identity respectively with youcai mosaic virus SX isolate, a tobamovirus (YoMV GenBank accession no. JX422022). In addition to YoMV, broad bean wild virus 2 and yam latent virus were also identified, which had previously been reported in yams in China. To confirm the NGS result, total RNAs were extracted from fifty-four above-mentioned samples and RT-PCR was carried out to amplify a 528 bp fragment of the coat protein (CP) of YoMV by using a pair of specific primers CP gene. PCR products with expected size were obtained from 26 out of 54 samples, and seventeen amplicons of YoMV-CP were sequenced (accession nos. ON052726 to ON052742). The nt sequence identities of CP gene among these seventeen isolates were 99.6%-100%. Furthermore, the near-full-length genomic sequence of YoMV-Do41 isolate was obtained from sample 41 by RT-PCR amplification of four overlapping fragments using the following primer pairs: YoMV-15F/YoMV-1910R, YoMV-1770F/YoMV-3750R, YoMV-3645F/YoMV-5404R and YoMV-4921F/YoMV-6280R (Supplementary Table1). The YoMV-Do41 isolate was 6, 274 nt in length (accession no. ON149803) and shared 89.65% and 97.31% nt identities to As1-2 isolate (GenBank accession no. MW307290) and to SX isolate (accession no. JX422022), respectively.To the best of our knowledge, this is the first report of YoMV infecting yam in China. YoMV has a wide host range including genera Impatiens, Rehmannia, Brassica, Chelidonium, Trifolium, Crossandro, Alstroemeria, Stellaria. This study will serve as an important reference for the host range of YoMV. According to the detection rate infections with YoMV in yam are common in these producing regions. Further studies will be required to determine the infection rate in other producing regions and the potential threat posed by YoMV on yam production should be considered.

A Previously Undescribed Polerovirus (Solemoviridae) Infecting Theobroma cacao Germplasm.

Cacao Theobroma cacao L. (Malvaceae) is an economically important crop cultivated in tropical climates for the bean from which chocolate and other products are made (Zarrillo et al., 2018). Virus-like symptoms consisting of discoloration, leaf distortion with downward rolling of leaves, and yellow speckling or mottling (Fig. S1), were observed in imported cacao germplasm at the USDA-ARS-SHRS cacao quarantine facilities in the fall of 2020. Total RNA was isolated from leaves collected from four symptomatic plants using silica RNA extraction method (Rott and Jelkmann, 2001). Ribosomal RNA (rRNA)-depleted RNA samples were used for cDNA library construction, followed by high throughput sequencing on Illumina® NovaSeq 6000 platform (Novogene Corp., Sacramento, CA). Quality-filtered, 150-bp paired-ended reads (2,601,293-3,104,474) were assembled de novo using SPAdes v.3.14.1 (Nurk et al., 2013). The contigs (200,799 to 276,851) were queried against the NCBI virus reference sequence (RefSeq) database using the discontiguous megablast algorithm (https://blast.ncbi.nlm.nih.gov/Blast.cgi?). The resultant contigs (n=1,344) were 150-nt to 1463-nt in length (k-mer coverage from 6.3x to 26,721.7x) and shared their highest nucleotide (nt) identity with potato leafroll virus (PLRV; NC_001747; genus Polerovirus; family Solemoviridae), at 69.1%-72.8%. The contigs pooled from the four samples were assembled into 15 scaffolds. BLASTn analyses of the 15 scaffolds against the RefSeq database indicated the best matches were to thirteen other polerovirus species, with top hits to cereal yellow dwarf virus-RPV (D10206) and pepper vein yellows virus (LC528383), having similarity scores of 66.2% and 100% respectively. The 15 scaffolds matched to the 5' terminal end, ORF1-2, ORF3, ORF4 and ORF3-5 of the different polerovirus genomes. For confirmatory sequencing, total RNA was subjected to reverse transcription using SuperScript IV (Invitrogen, Carlsbad, CA), followed by RT-PCR amplification with general polerovirus primers PoconF/PoconcpR (Xiang et al., 2008) expected to yield an amplicon of ~1,400-bp located at the 3' end of the RNA-dependent, RNA polymerase (RdRp), including the complete coat protein (CP) and movement protein (MP) genes. Amplicons were ligated to pGEM-T Easy vector (Promega, Madison, WI) and sequenced bi-directionally by Sanger sequencing (Eton Bio, Research Triangle Park, NC). BLASTn analysis of the polerovirus-like nt sequences (GenBank accession nos. (ON745771-ON745774) indicated the closest relatives were potato leafroll virus (OK058524) and cucumber aphid-borne yellows virus (FJ460218), at 71% and 73%, respectively. The CP amino acid (aa) sequence shared the greatest similarity to cereal yellow dwarf virus RPV (NP_840023), at 53%, and the MP aa sequence shared the greatest aa similarity to wheat yellow leaf dwarf virus-GPV (YP_003029842), at 38%. These results provide robust support for the association of a previously undescribed polerovirus with symptomatic cacao trees, herein named, cacao leafroll virus (Solemoviridae; Polerovirus). Although Koch's postulates have not been completed to confirm causality, the presence of this virus in cacao germplasm undermine efforts to distribute pathogen-free germplasm and may pose a risk to cacao production in trees established from virus-infected plant material. To our knowledge, this is the first report of a polerovirus infecting cacao trees. All trees of these accessions at the quarantined facility in Miami, FL have been destroyed.

First report of Watermelon crinkle leaf-associated virus 2 infecting watermelon (Citrullus lanatus) in Oklahoma.

Watermelon (Citrullus lanatus) is one of the major cucurbit crops in Oklahoma, which is grown on >1,200 acres. It contributes $16 million to the state's economy (Shrefler et al., 2017; NASS, 2022). During the 2021 growing season, virus-like symptoms on watermelon plants were observed in a grower's field in Blaine County, Oklahoma. These symptoms included mottling, crinkled leaf edges, and a unique yellow mosaic pattern (Fig. 1). Leaf tissue samples were randomly collected from nine plants and total RNA was extracted using Spectrum Plant Total RNA Kit (Sigma-Aldrich). Total RNA from one sample (named BL13) was subjected to high-throughput sequencing (HTS) on the NextSeq 500/550 High-Output kit v2.5 (Illumina, USA) at the genomic facility of Oklahoma State University. A total of 21,52,786 trimmed pair-end reads were assembled using CLC Genomics Workbench (v12.0.3) (Qiagen, Inc.) and subjected to BLASTn analysis. Of these, three contigs of 6,626 bp, 1,383 bp and 1,233 bp (average coverage 20,658X) showed 99% nucleotide (nt) sequence identity with RNA1 of a watermelon crinkle leaf-associated virus (WCLaV-2) isolate from Brazil (LC636073). The HTS data for BL13 samples also revealed three contigs of 263 pb, 567 bp and 1,066 bp that matched with cucumis melo crytpic virus isolate CmCV-HLI but was not confirmed by RT-PCR. The presence of WCLaV-2 in the BL13 sample was confirmed by RT-PCR using primers (RNA1-F: 5'-CAAAACGCCCATAAG AATAG-3'and RNA1-R: 5'- CTCCATTAATGAGAACTAGGAG-3') which amplified a 1.2 kb segment of the RNA1. The PCR product was confirmed on 1% agarose gel, cloned and three independent recombinant clones Sanger sequenced (Eurofins Genomics LLC, Louisville, KY, USA). The resulting consensus sequence (1.2 Kb) (ON453838) was subjected to a BLASTn search against the Genbank databases, resulting in 99.76% nt identity with WCLaV-2 RNA1 (Accession no. LC636073). Screening of the remaining eight symptomatic samples by RT-PCR revealed another positive sample (named BL7) for WCLaV-2. Consensus nt sequence (1.2 Kb) analysis for the virus isolate from the BL7 sample (Accession no. ON453839) shared 99.84% nt identities with WCLaV-2 RNA1 (LC636073). Total RNA from BL13 and BL7 samples, as well as the remaining seven samples, were tested against three major potyviruses (PRSV-W, WMV, and ZYMV) by multiplex RT-PCR (Rajbanshi & Ali, 2019). Both BL13 and BL7 samples were negative to all three potyviruses but the other eight samples were positive to one or two of the potyviruses. WCLaV-2 is a negative-sense ssRNA virus (family Phenuiviridae) and has been recently reported from watermelon in China (Xin et al., 2017) and Brazil (Maeda et al. 2022). In the United States, it has been reported from Florida (Hendrick et al., 2021), Georgia (Adeleke et al., 2022), and Texas (Hernandez et al., 2021). The mode of transmission of WCLaV-2 and its direct effect on watermelon fruit is not known (Xin et al., 2017; Maeda et al., 2022). Our results report for the first time the occurrence of WCLaV-2 infecting watermelon naturally in Oklahoma and show a further potential threat to watermelon production in the State. Further studies are needed to determine the incidence of WCLaV-2 in other counties of Oklahoma.

First report of pepino mosaic virus infecting tomato in South Korea.

Pepino mosaic virus (PepMV), a member of the genus Potexvirus in the family Alphaflexiviridae, has been responsible for economic losses in tomato across Africa, Asia, Europe, and the Americas over the last two decades, but has not previously been reported in South Korea. In December 2020, virus-like symptoms (foliar interveinal chlorosis and unevenly discolored fruits) were observed on ~5% of tomato (Solanum lycopersicum) plants growing in a greenhouse in Jeolla province, South Korea. To identify the causal virus, total RNA from a leaf sample of the symptomatic tomato was extracted using an RNeasy Plant Mini Kit (Qiagen, Germany) and analyzed by high-throughput sequencing. Ribosomal RNA was removed and a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA LT Sample Prep Kit (Plants) and sequenced on an Illumina NovaSeq 6000 system (Macrogen, Korea), yielding 151 nt paired end reads. De novo assembly of the 74,417,192 reads was performed using Trinity software (r20140717) while the 308,940 initially assembled contigs were screened against the NCBI viral genome database using BLASTN. Two contigs of 6,419 and 6,391 bp (GenBank LC656469, JKT1; and LC656470, JKT2) shared 94.81% and 98.34% nucleotide (nt) identities with isolates of the CH2 group (MK133092 and MF422613) and US1 group (FJ940225), respectively. No contigs representing other plant viruses were identified. A phylogenetic tree of the genomes of 44 isolates encompassing different PepMV strains (Abrahamian et al., 2020) also placed JKT1 in the CH2 clade, and JKT2 in the US1 clade. Leaf samples from 24 randomly selected plants from the same greenhouse were tested by reverse transcription-polymerase chain reaction (RT-PCR) with PepMV-specific primers, Pep3/Pep4 and PepCP-D/PepCP-R (Souiri et al., 2019), yielding products of the expected sizes (625 bp for Pep3/Pep4 and 848 bp for PepCP-D/PepCP-R) from all samples. Amplicons were cloned into the pGEM-T Easy Vector (Promega, USA); two clones for each amplicon were bidirectionally sequenced (BIONEER, Korea) and deposited in GenBank. The 848 bp amplicon (accession no. LC637517) showed 99.65% nt identity to the JKT1 genome (LC656469) and 94.69% identity to a CH2 isolate (JN835466); the 625 bp amplicon (LC637518) had 99.36% nt identity to the JKT2 genome (LC656470) and 97.28% identity to a US1 isolate (FJ940225). Primers specific to the coat protein gene of each isolate (JKT1-F/JKT1-R, CGCTTGCTGGTGCTGTTCAAG/ACGTCTAGACAAAGCAGGGTT, 934 bp; JKT2-F/JKT2-R, CACTAAATGCAGCAGTTTCTG/AGTTTCATTAGCAGCCAGTC, 830 bp) also yielded the expected amplicons from all 24 samples, indicating mixed infections of PepMV strains CH2 and US1. The PCR products from three randomly-selected samples shared 79.93-80.17% nt identity between (JKT1/JKT2) two JKT1-derived sequences (LC683791 and LC683792) and two JKT2-derived sequences (LC683793 and LC683794), further supporting the presence of mixed infections in the samples. To our knowledge, this is the first report of PepMV infecting tomato in South Korea. The virus is carried on tomato seeds (Córdoba-Sellés et al., 2007; Hanssen et al., 2010), and efficiently transmitted by mechanical means leading to rapid spread in tomato crops, and the severe strain CH2 may be a serious threat to tomato production in South Korea. It is important to concentrate on the phytosanitary control for both importation and exportation to manage and prevent further spread of contaminated seeds or infected transplants.

Genetic Evolution and Biological Characteristics of Feline Caliciviruses Isolated from Dogs

Feline calicivirus (FCV) is a highly contagious pathogen associated with oral and upper respiratory tract diseases (URTD), and it is also possibly considered as an enteric pathogen. Some studies found FCV-like viruses in the enteric tract of dogs, but there was a lack of understanding regarding the epidemiology and biological properties of FCVs in dogs. In this study, 252 fecal/feces samples were collected from dogs, with or without diarrhea, from 2020 to 2021. There were 6 FCV-positive samples (2.41%, 6/252), from which only two FCVs were successfully isolated and the complete genome sequences obtained. Phylogenetic analysis showed that the two canine-origin FCV isolates belonged to genogroup I and formed a monophyletic cluster with previous FCV strains, sharing a common ancestor. However, there was genetic diversity when the nt identity of the VP1 proteins between the two canine-origin FCV isolates (77.4% nt identity) was compared. In particular, the genomic sequence of the canine/GXHC01-21 isolate showed evidence of recombination at the 3ʹ end of the ORF1 gene with sequence identity very similar to the FCV strain, GX2019, previously isolated from cats in Guangxi in 2019. A comparison of their replication properties indicated that the two isolates could not replicate efficiently in MDCK cells. This was also seen in the enteric FCV isolate, GXNN04-20. However, both displayed similar plaque phenotypes to the respiratory FCV isolate, GX01-13. In addition, it was found that sera from vaccinated cats had low cross-reactivity in a neutralizing antibody test against the two canine-origin FCV isolates. Moreover, high neutralizing antibody titers (≥1 : 128) against canine-origin FCV viruses were observed in the two canine serum samples. This confirmed that interspecies transmission had occurred between cats and dogs. Our results provided an in-depth understanding of the genetic evolution and characteristics of FCVs circulating in dogs.

First Report of Tomato Yellow Leaf Curl Virus Infecting Pepper and Tomato in Oklahoma.

Tomato yellow leaf curl virus (TYLCV), (genus Begomovirus and family Geminiviridae) is one of the devastating viruses infecting tomatoes (Solanum Lycopersicon) and could have a significant impact on tomato production worldwide (Moriones and Navas-Castillo, 2000; Rybicki, 2015; Perez-Padilla et al. 2019). TYLCV was first reported in the United States (US) in 1997 in Florida (Polston et al. 1999) and since then it has been reported in several other states but not in Oklahoma (de Sa et al. 2008). Both pepper (Capsicum spp.) and tomato are grown in >50 counties of Oklahoma for fresh produce in the local market, and for processing industries. During a survey in 2021, pepper (bell pepper cv SV3964) and tomato (cv grand marshall) plants grown in a commercial field in Bixby, Oklahoma, showed typical virus-like symptoms including yellowing, leaf curling, cupping, twisting, and mottling (Fig. 1). Estimated disease incidence was 10% in both crops. In addition, whiteflies (Bemisia tabaci) were also observed on these plants. Twenty symptomatic samples from pepper (n=16) and tomato (n=4) plants, and four asymptomatic from pepper (n=2) and tomato (n=2) plants were collected and brought to the Plant Virology Lab at the University of Tulsa for further analysis Total RNA was extracted from all samples using the Spectrum Plant Total RNA Kit (Sigma-Aldrich, LOT: SLCG7913). RNA from two symptomatic samples, one each from pepper and tomato (named BX6 and BX11, respectively) were subjected to high-throughput sequencing (HTS) on the NextSeq 500/550 high-output kit v2.5 (Illumina, USA) at the genomic facility, Oklahoma State University (Stillwater, OK, USA). A total of 22,385,404 (average length 73.6 bp) and 19,012,605 (average length 73.7 bp) trim pair-end for both samples (BX6 and BX11) were assembled using CLC Genomics Workbench (v12.0.3) (Qiagen, Inc) and subjected to BLASTn analysis. The three contigs: 393 bp (coverage 363.24X), 670 bp (coverage 489.92X), and 990 bp (coverage 112.96X) for BX6 isolate, and four contigs: 393 bp (coverage 341.64X), 668 bp (coverage 457.23X), 814 bp (coverage 107.86X), and 990 bp (coverage 93.71X), for BX11 isolate, showed from 96 to 99% nucleotide (nt) identities with movement protein, capsid protein, C3, V2, C4, AC1, AC2, AC3 protein genes of the TYLCV isolates from Australia, China, Iran, Mexico, South Korea, and the US. The HTS data did not reveal any other viral sequence in these two samples. To further confirm the presence of TYLCV in these samples, three overlapping TYLCV-specific primer pairs (Supplementary Table 1) were designed based on the alignment of complete genome sequences of TYLCV isolates present in the Genbank. Total DNA was extracted from fresh leaf tissues of BX6 and BX11 samples using the Plant DNA Kit (Omega BIO-TEK,) and used in the PCR assay. The expected PCR products (814 bp, 1,085 bp and 1,068 bp) were generated from both samples providing further evidence of TYLCV infection. To obtain the complete genome sequence, these PCR amplified DNA fragments of both isolates were gel extracted and cloned using the pGEM-T® Easy Vector system. Three independent clones of each fragment were sequenced and analyzed by Sanger sequencing. The resulting consensus sequences were used in a BLASTn search against the GenBank and had the highest identities (99-99.2%) with TYLCV sequences. The overlapping consensus nt sequence of the BX6 isolate was 2,782 nt (Accession no ON321843), whereas that of BX11 was 2,777 nt (Accession no ON785706) showed 99.2% and 99.0% nt identities with the corresponding sequence of TYLCV isolates (KX347141 and KX347142) respectively from Australia. The nt identity between BX6 and BX11 was 99.7%. Further screening by PCR of the remaining 18 symptomatic field samples (pepper, n=15 and tomatoes, n=3) revealed TYLCV infection in two pepper and all three tomato samples consistent with the greater susceptibility of tomato. None of the asymptomatic pepper and tomato samples were positive for TYLCV. DNA from both BX6 and BX11 samples was also used in the rolling circle amplification (RCA) assay (TempliPhi Amplification Kit, Cytiva) and the presence of circular TYLCV DNA was detected. Our results demonstrated the presence of TYLCV infection in these symptomatic pepper and tomato plants. This is the first report of TYLCV infecting pepper or tomato in open fields in Oklahoma. Further surveys are needed to determine the incidence of TYLCV and the presence of its vector in other counties throughout Oklahoma.

First report of grapevine red globe virus (GRGV) and grapevine rupestris vein feathering virus (GRVFV) infecting grapevine (Vitis vinifera L.) in Portugal.

Grapevine Red globe virus (GRGV) and grapevine rupestris vein feathering virus (GRVFV) are relatively recently described grape viruses that respectively belong to the genera Maculavirus and Marafivirus in the family Tymoviridae [1]. Owing to their rather recent description, still limited information on their biology, on their molecular variability and on their geographic distribution is available. Both viruses are apparently completely or largely asymptomatic in European grapevine and have likely been overlooked in a wide range of situations (Martelli, 2014). According to sequences in GenBank, GRGV has been identified in Asia (Iran, Japan, China), the Americas (USA, Brazil) and Europe (Spain, France, Slovenia, Hungary, Czech Republic and Germany). GRVFV has been reported from the same countries but also in Oceania (New Zealand, Australia) and from a range of other countries including India, Pakistan and South Korea for Asia, Canada for North America and Switzerland, Slovakia, Italy and Russia for Europe. Evidence for the presence of GRGV and GRVFV in grapevine plants from northern Portugal (variety(ies) unknown) was obtained through the bioinformatic analysis [2] of RNASeq Illumina data obtained from phloem scrapings from five grapevine samples collected in different plots in 2016 [3]. Following grapevine genome substraction, contigs assembly and Blast-based contigs annotation using CLC Genomics Workbench, two plants, #4 and #5b, yielded contigs representing near complete GRGV genomes. The plant #4 contig integrated 474 reads (0.15% of reads for an average coverage of 10.1x) while the corresponding values for the contig for plant #5b are 2185 reads (2.4% of total reads) for a coverage of 47.2x. The two GRGV contigs show 91.4% nucleotide (nt) identity and the closest GRGV full genome sequence in GenBank, MZ451067 from Canada, shares respectively 98.9% and 91.6% nt identity with them. The near complete genome contigs have been deposited in GenBank (ON603917 and ON603918). Simultaneously, two near full length genomic contigs for GRVFV were identified from plant #5b and have also been deposited in GenBank (ON603919 and ON603920). These contigs show 84.4% nt identity to each other and were respectively assembled from 4643 (5.2% of total reads) and 5326 reads (6.0% of total reads) for respective average coverages of 102.3x and 117.3x. The closest full GRVFV genome in GenBank is MZ027155 from the USA, with 84.3-85.3% nt identity. Confirmation of the presence of GRVG and GRVFV in the doubly infected plant #5b was achieved by specific RT-PCR assays. A published assay [4] was used for GRGV and primers GRVFV-Cp-F 5'AAYCCTGTCACHCTCCACTG3' and GRVFV-Cp-R 5'TTCATGGTGGTGCCDGTGAG3' (Tm 55°C) were used for GRVFV. The obtained 447nt GRGV amplicon showed a single difference with the HTS contig while the 218 nt GRVFV amplicon showed 3 mutations as compared to one of the HTS contigs. The different grapevines had initially been sampled because they showed relatively poor and stunted growth but besides GRVFV and/or GRGV the HTS analysis indicated that they were also infected by hop stunt viroid, grapevine yellow speckle viroid 1, grapevine rupestris stem pitting virus, plus respectively a novel nepovirus (plant #4) and grapevine leafroll-associated virus 2 and grapevine Pinot gris virus (plant #5b) so that the results reported here do not shed novel light on the potential pathogenicity of GRGV or GRVFV. To the best of our knowledge, this is the first report of GRGV and GRVFV in Portugal.

First report of barley virus G infecting winter barley (Hordeum vulgare L.) in France.

As part of a cereals virome project high throughput sequencing (HTS)-based viral indexing was performed on plants with symptoms of barley yellow dwarf disease collected in June (2017-2020) in the main French cereals production areas. Total RNAs from 32 individual plants were purified (RNeasy Plant Mini Kit, Qiagen, Courtaboeuf, France) and Illumina sequenced (2x150 nt) following ribodepletion (Genewiz-Azenta, Leipzig, Germany). Following quality trimming, reads for each sample were de novo assembled (CLC Genomics Workbench 21, Qiagen) [1] and contigs annotated by BlastX analysis. In four winter barley samples collected in 2018 (18-58, 18-325 and 18-326) and 2019 (19-30A), besides contigs representing diverse viruses such as barley yellow dwarf viruses-PAV and PAS, Hordeum vulgare endornavirus, cereal yellow dwarf virus-RPV (18-326), wheat dwarf virus (18-325 and 18-326) and a novel Polerovirus (18-58 and 18-326), large contigs with high identity to barley virus G (BVG) were identified. BVG, a tentative Polerovirus, was initially reported in barley in South Korea in 2016 [2] and has so far been identified in a few other hosts including wheat, oat, maize, proso and foxtail millets as well as switchgrass. It has been reported from the USA and Australia [3] and, in Europe, from the Netherlands, Germany, Hungary and Greece [4]. Large BVG scaffolds representing near complete genomes could be reconstructed for each sample, integrating a total of 128.339, 7.188, 8.078 and 20.073 reads, for samples 19-30A, 18-58, 18325 and 18-326 respectively. Given that between 17.2 and 20.5 million reads had been obtained per sample, these values translate into between 0.04% (18-58 and 18-325) and 0.6% (19-30A) of total reads, and to average coverages of between 158x (18-58) and 2866x (19-30A) for the genomic scaffolds. The four assembled sequences (5584-5610 nt) have been deposited in GenBank (ON419453-ON419456). They are nearly identical (98.4 to 99.5% nt identity) and share between 97.7% and 98.5% nt identity with a barley reference isolate from the South Korea (NC_029906). To confirm the presence of BVG, a primer pair was designed based on available BVG sequences. Primers BVG-F(5'-CTAGCCCAACGAGTTGCGGG-3') and BVG-R(5'-GGTACAGAAGCTCTACGGTTC-3') amplifying a 394 nt were used in a two-step RT-PCR on new RNA extracts obtained from the 18-325 and 18-326 infected plants. The amplicons were directly sequenced and showed respectively 99.2% (ON419457, 18-325) and 100% (18-326) nt identity with the corresponding de novo scaffolds. The four analyzed samples have been collected respectively in 2018 (18-58, 18-325, 18-326) and 2019 (19-30A) in three different regions of France (Auvergne-Rhône-Alpes, Occitanie and Centre-Val de Loire), indicating a wide distribution and a persistence over time of BVG in France. To our knowledge, this represents the first report of a natural infection of BVG in cultivated winter barley in France. Presence of BVG may have been overlooked in a range of situation, as indicated by its retrospective discovery in a 34 years old Australian sample [3], possibly explaining its broad distribution in France. While the mixed infection status of the analyzed plants precludes any conclusion on its pathogenicity in French cereals, BVG has been reported to be associated with a range of symptoms in various hosts so that further studies to evaluate its prevalence and impact in France and to begin to understand its epidemiology are clearly warranted by the present results.

Discovery of a Closterovirus Infecting Jujube Plants Grown at Aksu Area in Xinjiang of China.

Chinese jujube (Ziziphus jujuba Mill.) is a widely grown fruit crop at Aksu in Xinjiang Uygur Autonomous Region of China. Viral disease-like symptoms are common on jujube plants. Here, for the first time, we report a virus tentatively named persimmon ampelovirus jujube isolate (PAmpV-Ju) infecting jujube plants. The virus was identified using high-throughput sequencing from a jujube plant (ID: AKS15) and molecularly related to viruses in the family Closteroviridae. The genomic sequences of two PAmpV-Ju variants named AKS15-20 and AKS15-17 were determined by RT-PCR amplifications. The genome structure of PAmpV-Ju was identical to that of a recently reported persimmon ampelovirus (PAmpV) and consisted of seven open reading frames. The genomes of AKS15-20 and AKS15-17 shared 83.7% nt identity with each other, and the highest nt sequence identity of 79% with two variants of PAmpV. The incidence of PAmpV-Ju on Aksu jujube plants was evaluated by RT-PCR assays. The phylogenetic analysis of amplified partial sequences coding for polymerase, HSP70h, and CP revealed two phylogenetic clades represented by AKS15-20 and AKS15-17. Our study provides important evidence for understanding viruses infecting jujube plants and establishing efficient measures to prevent virus spread.

Identification of Novel Begomoviruses Associated with Leaf Curl Disease of Papaya (Carica papaya L.) in India

Papaya (Carica papaya L.) is one of the most important fruit crops grown in tropical and subtropical regions of the world. Papaya leaf curl disease is one of the greatest concerns next to Papaya ring spot disease for India and the world. A survey was conducted during the year 2019 to 2021 for assessing the leaf curl disease incidence in five major papaya-growing districts of Karnataka State, India. The incidence ranged from 10 to 21 percent, with plants expressing typical begomovirus symptoms. Thirty-two virus-infected papaya samples (PLC-1 to PLC-32), collected from different farmer’s fields, gave positive amplification for begomovirus detection. Based on the partial genome analysis, 13 representative papaya leaf curl isolates were selected for complete genome amplification by rolling circle DNA amplification (RCA). The RCA products were cloned, sequenced and analyzed. Based on the analysis and strain classification criteria for begomoviruses, five isolates (PLC-2, 3, 9, 11 and 18) were considered variants of Chilli leaf curl virus (ChiLCV). Isolate PLC-22 is considered a strain of ChiLCV, with 93.5% nt identity sharing. Similarly, isolate PLC-28 is considered a strain of Croton yellow vine mosaic virus (CYVMV), and isolates PLC-25 and PLC-31 were considered as strains of Papaya leaf curl virus (PaLCuV). Among the remaining four isolates, three (PLC-1, PLC-4 and PLC-7) share more than 91% nt identity among them and less than 91% nt identity with all other reported begomovirus isolates. Hence, they are considered to be isolates of the novel begomovirus, and the name Papaya leaf curl Bagalkote virus [India:Karnataka:Bagalkote:Papaya:2021] is proposed. One isolate (PLC-32) is also found to be distinct from all other begomovirus isolates, including the isolates in the current study also considered to be novel begomovirus, for which we propose the name Papaya leaf curl Haveri virus [India:Karnataka:Haveri:Papaya:2021]. The putative recombination analysis of all 13 papaya isolates showed that a major part of the viral genome was likely descended from the begomoviruses reported previously. This is the first report on the diversity and a distribution of the begomoviruses infecting papaya in Karnataka, India. The current investigation results revealed five major papaya-infecting begomoviruses (PaLCuBKV, ChiLCV, PaLCuV, CYVMV and PaLCuHV) in the sampled regions.

Genetic characterization of a novel pheasant-origin orthoreovirus using Next-Generation Sequencing.

A field isolate (Reo/SDWF /Pheasant/17608/20) of avian orthoreovirus (ARV), isolated from a flock of game-pheasants in Weifang, Shandong Province, was genetically characterized being a field variant or novel strain in our recent research studies in conducting whole genome sequencing by using Next-Generation Sequencing (NGS) technique on Illumina MiSeq platform. Among a total of 870,197 35-151-mer sequencing reads, 297,711 reads (34.21%) were identified as ARV sequences. The de novo assembly of the ARV reads resulted in generation of 10 ARV-related contigs with the average sequencing coverage from 1390× to 1977× according to 10 ARV genome segments. The complete genomes of this pheasant-origin ARV (Reo/SDWF /Pheasant/17608/20) were 23,495 bp in length and consist of 10 dsRNA segments ranged from 1192 bp (S4) to 3958 bp (L1) encoding 12 viral proteins. Sequence comparison between the SDWF17608 and classic ARV reference strains revealed that 58.1-100% nucleotide (nt) identities and 51.4-100% amino acid (aa) identities were in genome segment coding genes. The 10 RNA segments had conversed termini at 5' (5'-GCUUUU) and 3' (UCAUC-3') side, which were identical to the most published ARV strains. Phylogenetic analysis revealed that this pheasant ARV field variant was closely related with chicken ARV strains in 7 genome segment genes, but it possessed significant sequence divergence in M1, M3 and S2 segments. These findings suggested that this pheasant-origin field variant was a divergent ARV strain and was likely originated from reassortments between different chicken ARV strains.

Identification of Novel Reassortant Shuni Virus Strain in Clinical Cases of Israeli Ruminants, 2020-2021.

The Shuni virus (SHUV) causes an endemic viral infection in Israel and South Africa. It belongs to the Simbu serogroup within the order Bunyavirales, family Peribunyaviridae, genus Orthobunyavirus. Recently, it has been identified in aborted cases of domestic ruminants, young cattle and horses manifesting neural signs and acute death, symptomatic cows, and in carcasses of wild animals. Moreover, SHUV was isolated and identified in humans. In this study, we describe clinical cases of SHUV infection in Israeli domestic ruminants in 2020–2021, which represented clinical manifestations of simbuviral infection including abortions, a neural lethal case in a fattening calf, and an acute symptomatic case in a beef cow. In all cases, SHUV was confirmed by complete or partial viral genome sequencing. There is a significant difference of M and L segments of the novel strains compared with those of all known SHUV strains, while the S segments have more than 99% nucleotide (nt) identity with Israeli and African “Israeli-like” strains previously circulated in 2014–2019. This indicates a reassortment origin of the strain. At the same time, M and S segment nt sequences showed about 98–99% nt identity with some South African strains collected in 2016–2018. Nevertheless, the viral origin and the geographical place of the reassortment stayed unknown.

First report of Vitis cryptic virus from grapevines in China.

Vitis cryptic virus (VCV) was recently identified on wild Vitis coignetiae in Japan in 2021, and was tentatively classified as a new member of the genus Deltapartitivirus, which is consistent with the two-segmented genome encoding RdRp and CP (Nabeshima et al., 2021). In June 2020, a grapevine cv. Jinhuanghou in a vineyard exhibiting chlorotic mottling (Figure S1) was collected in Xingcheng, Liaoning province of China. Total RNAs were extracted using RNAprep Pure Plant Plus Kit (DP441, TIANGEN BIOTECH, Beijing), and the ribosomal RNA were removed by the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA). The ribosomal RNA-depleted RNA was then used to construct a cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA), which was sequenced on an Illumina NovaSeq 6000 platform (Biomarker Biology Technology), resulting 60,208,348 paired-end clean reads (150 nt × 2). Reads mapping to the grapevine genome (PN40024 assembly 12X) were removed by hierarchical indexing using hisat2 2.1.0 software (Kim et al., 2019). The unmapped reads were de novo assembled into 116,809 contigs using the rnaviralSPAdes method in the SPAdes v3.15.3 software with default parameters (Prjibelski et al., 2020) and analyzed through BLAST analysis. Two viruses and two viroids were identified: VCV (2 contigs), grapevine emaravirus A (GEVA; 5 contigs), grapevine yellow speckle viroid 1 (GYSVd1; 1 contig) and hop stunt viroid (HSVd; 1 contig). The two contigs of VCV had lengths of 1575 nt and 1563 nt, and shared 95% and 90% nt identity with RNA1 and RNA2 genomes of the VCV isolate H1 (GenBank accession nos. LC602838-39) with 99% and 96% coverage respectively. To further confirm the infection of VCV, we designed two pairs of primers VCV-RP1a/1b (5'- TGGTCGAGAAGTTACTATACTCG -3'/5'- AGACCACAATATTGCTTTGGCTC -3') and VCV-CP1a/1b (5'-TTACGAAGTCCGCACTATTGC-3'/5'- AGCATACGGATAGCTCCTGAC-3'), which were to amplify the 297-bp and 279-bp fragments in the RdRp and CP gene encoded by RNA1 and RNA2 genomes of VCV respectively. The amplified PCR products were cloned and sequenced and the two sequences (OM460075-76) showed 93% and 91% nt identity with the genomic segments of the VCV isolate H1 respectively. The graft transmissibility of VCV was assessed in July 2021 by grafting the VCV-infected grapevine buds onto 2-year-old VCV-free 'Beta'grapevine seedlings with four replicates, the leaves of the first bud below the grafting site behaved chlorotic mottling symptoms (Figure S2) and tested positive for VCV two months after grafting. To further determine the incidence and distribution of VCV in China, 470 grapevine samples of 71 cultivars were collected from 21 provinces and tested by RT-PCR using primers VCV-RP1a/1b and VCV-CP1a/1b. The results showed that 2.6% (12/470) of the samples tested positive with both primers, including 10 'Jinhuanghou' grapevines (Jilin province), 1 'Zuoyouhong' (Jilin province) and 1 'Куртсет' grapevine (Liaoning province). This is the second report of VCV in the world, and confirm the graft transmissibility of VCV for the first time. Given the VCV infectivity in the two important cultivars in Jilin province and strong graft transmissibility, it is necessary to further study its pathogenicity and its effect on grapes. Unveiling the presence of VCV in China contributes to understanding the occurrence of the virus and developing management measures should they become necessary.

First report of Ranunculus mild mosaic virus in Ranunculus asiaticus in Korea.

Ranunculus (Ranunculus asiaticus L.) is a popular ornamental plant mainly cultivated for cut flowers and flowering potted plants. In January 2021, a leaf sample of R. asiaticus that showed virus-like symptoms including mosaic, yellowing and malformation on leaves was collected from a greenhouse in Jangheung, South Korea for disease diagnosis (Fig. S1). Disease incidence was greater than 30% in the greenhouse (~1,000 m2). Transmission electron microscopy (TEM) of symptomatic leaves identified potyvirus-like filamentous virus particles of about 800 nm. To confirm the TEM results, a symptomatic leaf sample was further analyzed by reverse-transcription polymerase chain reaction (RT-PCR) using species-specific detection primers for six potyviruses that infect R. asiaticus (Sacco et al., 2018). The sample was positive only for ranunculus mild mosaic virus (RanMMV). Additional analysis of nine symptomatic R. asiaticus plants from the infected greenhouse found that all samples were positive for RanMMV. To exclude the presence of the other viruses, next generation sequencing (NGS) was carried out. Total RNA was extracted from symptomatic leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and a transcriptome library was generated using the TruSeq Stranded Total RNA LT Sample Prep kit (Illumina, San Diego, CA) acccording to the recommended protocol. NGS was performed using an Illumina NovaSeq 6000 system (Macrogen Inc., Korea). A total of 75.58 million reads were obtained, and the reads were de novo assembled to contigs using Trinity software (Grabherr et al., 2011). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database identified the assembled large contig of 9,539 nt (5,321 mapped reads, mean read coverage of 84.2 times) as RanMMV. This sequence shared 98% nt identity (99% coverage) with the RanMMV NL isolate (acc. no. LC604020) isolated from an anemone plant (A. blanda cv. Charmer) from Netherlands. To obtain the complete genome sequence, the termini sequences were determined by 5' and 3' rapid amplification of cDNA ends (RACE) methods as reported recently (Imamura et al., 2021). The assembled full-length genome sequence of RanMMV-JH is 9,574 nt in length, excluding the poly(A) tail, and encoding a polyprotein of 3,074aa. The sequence was deposited in GenBank under the accession no. OL742438. RanMMV is transmitted by aphids in a nonpersistent manner and has very narrow host range. RanMMV, one of causative agents of ranunculus mosaic disease, has been problematic in ranunculus production area of Japan (Hayahi et al., 2018; Kamikawa et al., 2022). Recently, some perennial weeds from the Ranunculaceae family (e.g. R. japonicus, R. silerifolius and R. tachiroei) are known to may act as a virus reservoir (Kamikawa et al., 2022). As R. asiaticus is cultivated by vegetative propagation, there is need to develop certification system for producing virus-free R. asiaticus. To our knowledge, this is the first report of RanMMV infection in R. asiaticus in Korea.

First report of strawberry polerovirus 1 in strawberry in Nepal.

Strawberry (Fragaria x ananassa Duch.) was introduced to Nepal from Japan in the 1990s, and thus, is a relatively new crop in the country. After the initial introduction of cultivar 'Nyoho' in Kakani, Nuwakot, different agencies and growers have introduced a number of cultivars in large numbers from Japan, Europe, America and India to expand the cultivation of strawberry in Nepal. Such practice has increased the risk of introducing new pathogens in the country. During a field visit at Kakani in October 2018, virus-like symptoms were observed in 5-10% of the plants in a polyhouse (~200 m2). Three strawberry leaf samples showing vein banding, vein clearing or tip necrosis with leaf puckering were collected. Total RNA was extracted from leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high-throughput sequencing (HTS). After ribosomal RNA depletion using the Ribo-Zero rRNA kit, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo transcriptome assembly of the 67,748,658 reads with Trinity software (r20140717) yielded 116,854 contigs of 201-17,773 nucleotides (nt). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database showed that one contig with the nearly full genome sequence (5,968 nt, deposited under GenBank accssion number MZ355624) was identified as strawberry polerovirus 1 (SPV-1). A total of 10,401 reads was mapped to the reference SPV-1 nucleotide genome (GenBank accession number NC_025435) with a 263.2 sequence depth. The contig shared 99% nt sequence identity with SPV-1 isolate AB5301 (GenBank accession number KM233705) from Canada and 97% identity with the Argentine SPV-1 isolate 15CA (GenBank accession number MK142237). To confirm the presence of SPV-1, reverse transcription-PCR (RT-PCR) was performed using previously reported specific primers, SPV-1F (AGAGATCGCCGGATTCCGCAA) and SPV-1R (TGACACGCTCGGTATTCACAAACAG), amplifying 281 nt of the P1-P2 fusion protein gene (Thekke-Veetil and Tzanetakis 2016). Of the three samples, only one showing vein banding symptoms (Figure S1) was positive for SPV-1. Sanger sequencing of the RT-PCR products showed 100% nt identity with the HTS-derived sequence. SPV-1, a member of the genus Polerovirus in the family Solemoviridae, was first reported in strawberry showing decline symptom in Canada (Xiang et al. 2015), and was subsequently detected in the USA (Thekke-Veetil and Tzanetakis 2016) and in Argentina (Luciani et al. 2016; 2018). To our knowledge, this is the first report of SPV-1 infection in strawberry in Nepal and Asia.

Rhinolophus sinicus virome revealed multiple novel mosquito-borne zoonotic viruses.

To exploit the Rhinolophus sinicus–specific virome, 29 Rhinolophus sinicus were gathered in Lincang, China. Enriched viral sequences of 22 virus families were acquired by metavirome techniques. Hereby, the part of virome in Rhinolophus sinicus, including Chikungunya virus (CHIKV), Getah virus, and Japanese encephalitis virus (JEV) were validated by PCR. Five CHIKV viral sequences were amplified, among which CHIKV-China/B2016C-1 shared the highest homology to CHIKV isolated from Italy in 2007, with the genotype as African ECS. Eight JEV viral sequences were amplified, of which JEV-China/B2016E-1 shared the highest homology with at least 91.3% nt identity with the JEV sequence found in South Korea in 1988 and was classified as genotype III. Notably, JEV was isolated for the first time in Rhinolophus sinicus. The newly isolated JEV-China/B2016-1 could increase infectivity while passaging in Vero cells from BHK-21 cells. Overall, the research sheds insight into the diversity and viral susceptibility dynamics of the virome in Rhinolophus sinicus and reveals new light on the ecology of other important viral hosts.