Nr Database Research Articles

Transcriptome annotation of 17 porcine tissues using nanopore sequencing technology.

The annotation of animal genomes plays an important role in elucidating molecular mechanisms behind the genetic control of economically important traits. Here, we employed long-read sequencing technology, Oxford Nanopore Technology, to annotate the pig transcriptome across 17 tissues from two Yorkshire littermate pigs. More than 9.8million reads were obtained from a single flow cell, and 69 781 unique transcripts at 50 108 loci were identified. Of these transcripts, 16 255 were found to be novel isoforms, and 22 344 were found at loci that were novel and unannotated in the Ensembl (release 102) and NCBI (release 106) annotations. Novel transcripts were mostly expressed in cerebellum, followed by lung, liver, spleen, and hypothalamus. By comparing the unannotated transcripts to existing databases, there were 21 285 (95.3%) transcripts matched to the NT database (v5) and 13 676 (61.2%) matched to the NR database (v5). Moreover, there were 4324 (19.4%) transcripts matched to the SwissProt database (v5), corresponding to 11 356 proteins. Tissue-specific gene expression analyses showed that 9749 transcripts were highly tissue-specific, and cerebellum contained the most tissue-specific transcripts. As the same samples were used for the annotation of cis-regulatory elements in the pig genome, the transcriptome annotation generated by this study provides an additional and complementary annotation resource for the Functional Annotation of Animal Genomes effort to comprehensively annotate the pig genome.

Response of the metabolic and autophagy pathways in Mytilus under starvation

Being an industrially valuable species of bivalve, Mytilus is widespread in the area around the eastern coast of China. Starvation is an environmental stress that mussels often encounter in their growth. However, few report carried out on the physiological and biochemical response and molecular regulation and adaptation mechanism of mussels under starvation. To illustrate the molecular mechanism of hosts of Mytilus to starvation, the gill transcriptome was used for analysis before and after 9 days of starvation in Mytilus using the Illumina/HiSeq-2000 deep sequencing platform, accompanied by the study of differentially expressed genes (DEGs). In total, 42.137 GB of clean data were obtained from six sample libraries, the average amount of clean data of each sample is 7.023 GB, and 58,540 unigenes that average 780 bp in length were assembled. Unigenes were illustrated by commenting them against the NR, Swiss-Prot, Pfam, String, GO and KEGG databases. After 9 days of starvation, 2,188 and 2,672 genes were determined to be significantly up- or down-regulated expression genes, separately. Amongst, 4,860 genes were associated with 260 pathways, contains vital enrichment pathways, such as “Metabolic”, “PI3K-Akt signaling pathway”, “Phagosome”, “Apoptosis” and “Lysosome”. In inclusion, autophagy cells were investigated by an electron microscopy, alongside further observations of the expression of autophagy-related genes in gill tissue before and after starvation. The data indicates that the amount of autophagosomes increased and found that atg2, atg6 and atg13 were significantly up-regulated. These results indicated that Mytilus may use autophagy to cope with their damage after starvation. With our research results, we have contributed to a deeper understanding of the role of the molecular mechanisms of immune defence in Mytilus under environmental stress, which has given insights into mussel breeding and the understanding of the molecular mechanisms of Mytilus immune system.

Transcriptome profiling and differential expression analysis of the immune-related genes during the acute phase of infection with Photobacterium damselae subsp. damselae in silver pomfret (Pampus argenteus)

Silver pomfret has been widely cultured in China due to its high economic value. Photobacterium damselae subsp. damselae (PDD) is a Gram-negative bacterium that has been shown to infect many fish species. To increase knowledge of the molecular mechanisms of the host defense against PDD, we conducted transcriptome analysis of head kidney in silver pomfret at 24 h and 72 h post-infection (hpi) via Illumina sequencing. The de novo assembly resulted in the identification of 79,063 unigenes, with 59,386 (75.11%) successfully annotated in public databases (NR, NT, KO, Swiss-Prot, Pfam, GO, and KOG databases). Comparison of gene expression profiles between PBS-injected fish (sham control) and PDD-challenged fish revealed 329 and 570 differentially expressed genes (DEGs) were screened at 24 hpi and 72 hpi, respectively. The DEGs were enriched in multiple immune-related pathways such as Hepatitis C, Gastric acid secretion, CAMs and Leukocyte transendothelial migration pathways, Primary immunodeficieny, ECM-receptor interaction, PI3K-Akt signaling pathway. The data obtained in the present study offers valuable information for acute immune response of silver pomfret challenged with PDD, which will facilitate further investigations on strategies against Photobacterium spp. infection in teleosts.

Regulatory mechanisms of fatty acids biosynthesis in Armeniaca sibirica seed kernel oil at different developmental stages.

BackgroundArmeniaca sibirica seed kernel oil is rich in oleic acid and linoleic acid, thus holding potential value as a source of high-quality edible oils. However, some regulatory factors involved in fatty acids accumulation in A. sibirica seed kernels remain largely elusive. Thus, the aim of this study was to elucidate the regulatory mechanisms underlying fatty acids biosynthesis in A. sibirica developing seed kernels.MethodsSeed kernels from six plants from a single A. sibirica clone were taken at five different developmental stages (days 30, 41, 52, 63, and 73 after anthesis). Fatty acid composition in seed kernel oil was determined by gas chromatography-mass spectrometry (GC-MS). In addition, transcriptome analysis was conducted using second-generation sequencing (SGS) and single-molecule real-time sequencing (SMRT).ResultsRapid accumulation of fatty acids occurred throughout the different stages of seed kernels development, with oleic acid and linoleic acid as the main fatty acids. A total of 10,024, 9,803, 6,004, 6,719 and 9,688 unigenes were matched in the Nt, Nr, KOG, GO and KEGG databases, respectively. In the category lipid metabolism, 228 differentially expressed genes (DEGs) were annotated into 13 KEGG pathways. Specific unigenes encoding 12 key enzymes related to fatty acids biosynthesis were determined. Co-expression network analysis identified 11 transcription factors (TFs) and 13 long non-coding RNAs (lncRNAs) which putatively participate in the regulation of fatty acid biosynthesis. This study provides insights into the molecular regulatory mechanisms of fatty acids biosynthesis in A. sibirica developing seed kernels, and enabled the identification of novel candidate factors for future improvement of the production and quality of seed kernel oil by breeding.

Analysis of terpenoids and their gene regulatory networks on the basis of the transcriptome and metabolome of Opisthopappus longilobus.

Opisthopappus longilobus, which is a unique wild plant resource in China, produces leaves and flowers with distinct aromas. However, there have been relatively few molecular studies on its floral aroma, which has hindered the research on this plant species at the molecular level and the breeding of novel varieties. In this study, transcriptome and metabolome analyses were performed using O. longilobus leaves, buds, and inflorescences at the exposure, initial opening, and blooming stages. Using high-quality reads and assembly software, a total of 45,674 unigenes were annotated according to the Nr, Swiss-Prot, KOG, and KEGG databases. Additionally, a GC-MS system and a self-built database were used to detect 1,371 metabolites in the leaves, buds, and inflorescences. Terpene metabolites were the most common compounds (308 in total). We analyzed the gene network regulating terpenoid accumulation in O. longilobus and identified 56 candidate genes related to terpenoid synthesis. The expression of OlPMK2, OlMVK1, OlTPS1, and OlTPS3 may lead to the accumulation of 11 different terpenoids specifically in the inflorescences at the exposure, initial opening, and blooming stages. The generated data may be useful for future research on O. longilobus genetic resources and the molecular mechanism regulating aroma formation in this plant species. The findings of this study may be used to accelerate the breeding of new O. longilobus varieties with enhanced aromatic traits.

Single-molecule Real-time (SMRT) Sequencing Facilitates Transcriptome Research and Genome Annotation of the Fish Sillago sinica.

As a newly described Sillaginidae species, Chinese sillago (Sillago sinica) needs a better understanding of gene annotation information. In this study, we reported the first full-length transcriptome data of S. sinica using the PacBio isoform sequencing Iso-seq and a description of transcriptome structure analysis. A total of 454,979 high-quality full-length transcripts were obtained by single-molecule real-time (SMRT) sequencing, which was corrected by Illumina sequencing data. After that, 66,948 non-redundant full-length transcripts were generated after mapping to the reference genome of S. sinica, including 49 fusion isoforms and 9,250 novel isoforms. 63,459 isoforms were successfully annotated by one of the Nr, Nt, SwissProt, Pfam, KOG, GO, and KEGG databases. Additionally, 30,987 alternative polyadenylation (APA) sites, 451,867 alternative splicing (AS) events, 21,928 long non-coding RNAs (lncRNAs) and 12,911 transcription factors (TFs) were identified. The full-length transcripts of S. sinica would provide a precious resource for characterizing the transcriptome of S. sinica and for the further study of gene function and regulatory mechanism of this species.

Transcriptome characterization and profiling related to detoxification enzyme genes in Chilo sacchariphagus (Lepidoptera Crambidae)

AbstractChilo sacchariphagus Bojeris is one of the most dangerous pests of sugarcane. The larvae damage the seedlings and stems of sugarcane and also harm sorghum, corn and other crops, which causes great economic losses to the sugar industry every year. Transcriptome sequencing and expression profile analysis of cytochrome P450 monooxygenase (CYP), carboxylesterase and glutathione S‐transferase (GST) were carried out, which could provide a basis for drug resistance monitoring and drug resistance management of the pest. Unigenes of C. sacchariphagus were obtained by using the Illumina HiSeqTM 4,000 platform as 150 bp paired‐end reads. A total of 173,013 unigenes were obtained after data assembly and redundancy removal. 28,330 unigenes were annotated based on multiple public databases, and the number of unigenes annotated by NR database was the largest. According to the transcriptome analysis, 214 candidate detoxification enzyme genes were identified, including 44 GSTs, 138 CYPs, and 32 CarEs. Phylogenetic analysis showed that the CYPs were mainly clustered in CYP4, CYP6, CYP9 and CYP12 subfamilies; CarEs mainly include antennal CarEs, venom CarEs and CarEs NOTUM; while the GSTs cluster mainly contains subfamilies such as delta, omega, epsilon, theta, zeta and sigma. In this study, transcriptome information of C. sacchariphagus was obtained, and genes related to detoxification were identified, which could provide data and a basis for the further study of detoxification and host plant adaptation mechanism of C. sacchariphagus.

Transcriptome analysis and identification of the genes associated with the heat stress response in four rhododendron species

• The order of thermotolerance of four rhododendrons was determined. • ROS and secondary metabolites played important roles in rhododendrons heat response. • TFs related to heat response of rhododendrons was screened out. • Abundant genomic information of rhododendrons was provided. Rhododendrons are prominent ornamental plants worldwide. The molecular mechanism of thermotolerance in the Rhododendron genus is still largely unknown. Here, R. molle, R. delavayi, R. irroratum , and R. decorum were selected to determine the molecular mechanism of the heat stress response in rhododendrons by transcriptomic studies. According to the heat injury index, the order of thermotolerance was R. molle > R. irroratum > R. decorum > R. delavayi. R. delavayi was sequenced with the reference genome, while other rhododendrons were sequenced without the reference genome. Two sequencing libraries of each rhododendron, namely one control and one heat stress-treated sample, were constructed for comparative transcriptomic analysis. In R. delavayi , 90.99% clean reads were mapped, and 86,621, 121,343, and 99,992 unigenes were identified in R. molle, R. irroratum , and R. decorum , respectively. Unigenes were annotated in the KEGG, GO, and Nr databases. According to the Nr annotation results, rhododendrons had a high gene similarity with Actinidia chinensis and Camellia sinensis . Between two sequencing libraries of R. molle, R. delavayi, R. irroratum , and R. decorum , 9017, 6916, 5243, and 11751 transcripts, respectively, were further identified as differentially expressed genes (DEGs). Transcription factor (TF) families enriched in DEGs mainly include ERF, bHLH, MYB, WRKY, and MYB_related, and several TFs were commonly regulated in all plants, such as BBR / BPC7, bZIP1, bZIP12, COL15, BBX22, ERF118-2, DREB2C, HsfC1, HSF8, LBD41, PHERES, RADIALIS-like 4, SPL14, SPL9 bHLH041, Dof5.4, ERF061 , and PTI6 . The data obtained in this study can provide abundant genomic information for future research and help to clarify the molecular mechanisms of rhododendrons’ heat stress response.

Transcriptome Analysis Provides Insights into Potentilla bifurca Adaptation to High Altitude.

Potentilla bifurca is widely distributed in Eurasia, including the Tibetan Plateau. It is a valuable medicinal plant in the Tibetan traditional medicine system, especially for the treatment of diabetes. This study investigated the functional gene profile of Potentilla bifurca at different altitudes by RNA-sequencing technology, including de novo assembly of 222,619 unigenes from 405 million clean reads, 57.64% of which were annotated in Nr, GO, KEGG, Pfam, and Swiss-Prot databases. The most significantly differentially expressed top 50 genes in the high-altitude samples were derived from plants that responded to abiotic stress, such as peroxidase, superoxide dismutase protein, and the ubiquitin-conjugating enzyme. Pathway analysis revealed that a large number of DEGs encode key enzymes involved in secondary metabolites, including phenylpropane and flavonoids. In addition, a total of 298 potential genomic SSRs were identified in this study, which provides information on the development of functional molecular markers for genetic diversity assessment. In conclusion, this study provides the first comprehensive assessment of the Potentilla bifurca transcriptome. This provides new insights into coping mechanisms for non-model organisms surviving in harsh environments at high altitudes, as well as molecular evidence for the selection of superior medicinal plants.

Genome and Transcriptome Sequence Resources and Effector Repertoire of Pythium myriotylum Drechsler.

Genome and Transcriptome Sequence Resources and Effector Repertoire of Pythium myriotylum Drechsler.

Transcriptome Sequencing of Agave angustifolia Reveals Conservation and Diversification in the Expression of Cinnamyl Alcohol Dehydrogenase Genes in Agave Species

Agave angustifolia is an important crassulacean acid metabolism plant species, with wide applications in beverage and sisal fiber production. In this study, we carried out a transcriptome analysis of A. angustifolia leaves, generating a total of 58,482,436 clean reads through Illumina paired-end sequencing. De novo transcriptome assembly generated 67,314 unigenes, with about half of them having homologs in four public databases. In the Nr database, Asparagus officinalis was shown to be most closely related to agave, and the early angiosperm Amborella trichopoda was selected as an outgroup species. We further identified five, two, seven, seven, seven, six and six CAD genes in asparagus, amborella, A. deserti, A. tequilana, A. americana, A. hybrid H11648 and A. angustifolia, respectively. The maximum likelihood phylogenetic tree revealed the species-specific expansion of CAD genes in arabidopsis, rice and agave. The expression analysis indicated the conservatively expressed CAD1/2/4/6, providing candidate targets for manipulation to improve lignin traits. The species-specific expression of CAD3/5/7 indicates the existence of different regulatory mechanisms controlling the expression of these genes in agave species. This study presents the first transcriptome dataset of A. angustifolia, facilitating future studies on lignin biosynthesis in agave.

First Report of Collar Canker and Dieback of Camellia sinensis Caused by Fusarium solani Species Complex in Henan, China.

Tea (Camellia sinensis) is a significant commercial crop cultivated in China. A collar canker and dieback disease of tea has recently been reported in Sri Lanka (Sinniah et al. 2017). During the Spring of 2020, tea bushes with symptoms of fewer leaves, yellowing of leaves with cankers having cracks and peeling of bark, premature falling in the early stage and progressive dieback of branches followed by death of the whole tree that were partially covered with white-colored mold were observed in tea plantations over a 200 hm2 area in Xinyang, Henan Province, China (Figure 1A). To determine the causative agent, dead tea plant stems with white-colored mold were collected, cut into small pieces and surface-sterilized with 75% ethanol, followed by rinsing twice with sterile distilled water and then air-drying. The pieces were placed on potato dextrose agar (PDA) and incubated at 28℃ for 7 days. A total of 19 fungal colonies were isolated and transferred to fresh PDA. Single-spore isolates were made for each and all were observed to produce white flocculent mycelium with the reverse side being pale yellow on PDA. The appearance of a representative strain, XYWLD-07, on PDA is shown (Figure 1B and 1C). Macroconidia (14.26 to 42.13 × 3.53 to 6.79μm) and microconidia (6.93 to 11.85 × 2.72 to 6.33μm) were observed in the cultures (Figure 1E). The genomic DNA from XYWLD-07 was extracted and the internal transcribed spacer region (ITS) of ribosomal DNA, beta-tubulin, translation elongation factor 1-alpha (TEF- 1α), RNA polymerase I beta subunit (RPB1) and RNA polymerase II beta subunit (RPB2) genes were amplified using the primer pairs ITS1/ITS4 (5'- CTTGGTCATTTAGAGGAAGTAA -3'/5'- TCCTCCGCTTATTGATATGC -3') (Gardes & Bruns 1993) , Bt-F/Bt-R (5'- AACATGCGTGAGATTGTAAGT -3'/5'- TCTGGATGTTGTTGGGAATCC -3'), EF-1/EF-2 (5'- ATGGGTAAGGARGACAAGAC -3'/5'- GGARGTACCAGTSATCATGTT -3'), RPB-1F/1R (5'- TTTTCCTCACAAAGGAGCAAATCATG -3'/5'- GTTCACCCAAGATATGGTCGAAAGCC -3') and RPB2-5F2/11aR (5'- GGGGWGAYCAGAAGAAGGC -3'/5'- GCRTGGATCTTRTCRTCSACC -3') (O'Donnell et al. 2010), respectively. The PCR products were sequenced and deposited in GenBank (Accession Nos. MZ411431, MZ439920, OL982608, OM069738 and OM265212), respectively. BLASTn against NCBI nr and Fusarium-ID database revealed that the ITS sequence had 99.65% homology with BLAST sequences of F. solani (GenBank Accession Nos. JN882257.1 and JN882255.1), the beta tubulin sequence had 96.92% similarity with BLAST sequences of F. solani (KU983876.1 and MN692929.1), TEF- 1α gene sequence had 99.15% and 99.29% homology with BLAST sequences of F. solani (KM096405.1 and KM096409.1), RPB1 gene sequence had 99.32% and 99.41% homology with BLAST sequences of F. solani (KU974331.1 and MT305119.1) and RPB2 gene sequence had 98.15% and 98.20% homology with BLAST sequences of F. solani (MT305182.1 and MT305177.1), respectively. Furthermore, TEF- 1α, RPB1 and RPB2 gene sequences had more than 98.52% match with F. solani sequences in Fusarium-ID databases. To test for pathogenicity, the inoculum was grown for 10 days at 25°C on 200g sterilized boiled wheat grain and sand (3:1, v/v) with 20-ml spore suspension (107 conidia /ml) of strain XYWLD-07. Two-year tea seedlings were planted in pots of autoclaved soil with 5% (m/m) strain XYWLD-07 inoculum but controls were grown in autoclaved soil with only sterile wheat/sand mix. The experiment was performed five times. After 30 days, collar canker symptoms appeared on inoculated tea branches, whereas the control was asymptomatic (Figure 1F). The fungal pathogen was reisolated from the symptomatic tea tissues and again identified as F. solani based on the above analysis of the five gene sequences (Figure 1D). F. solani has been previously identified as causal agent of collar canker and dieback of C. sinensis in Sri Lanka (Sinniah et al. 2017) and India (Sarmah et al. 2017).To our knowledge, this is the first report of F. solani causing collar canker and dieback of C. sinensis in China. As this disease could result in death of tea bushes, effective management strategies should be investigated and applied.

Transcriptome Analysis of Sugarcane Response to Sugarcane Yellow Leaf Virus Infection Transmitted by the Vector Melanaphis sacchari.

Sugarcane yellow leaf disease severely affects sugarcane production. As a viral disease, the pathogen sugarcane yellow leaf virus can only be transmitted by aphid vectors rather than mechanical means. To understand the sugarcane responses to ScYLV infection, the corresponding transcriptomic profile of ScYLV-infected and ScYLV-free plants were analyzed with RNA-Seq technology. In this study, Melanaphis sacchari was used as the vector to transmit ScYLV to the susceptible sugarcane cultivar CP72-1210 and transcriptome was sequenced as well as differentially expressed genes between disease-infected and non-infected sugarcane plants were investigated. A total of 1,22,593 genes were assembled, of which 1,630 genes were differentially expressed. Among DEGs, 1,622 were upregulated and eight were downregulated that were further annotated with GO, KEGG, KOG, PFAM, SwissProt, and Nr databases. The expression levels of DEGs in the three KEGG pathways, namely endocytosis, PEX protein synthesis, and endoplasmic reticulum stress response to viral protein synthesis were observed. Interestingly, it was found that the yellow leaf virus could induce the formation of autophagosomes by LC3, promoted by ER stress, and may be related to the replication of viral RNA. We tested 63 DEGs in this research. The qRT-PCR results showed that two were downregulated and 45 were upregulated in response to the ScYLV infection. This study will not only offer an overall comprehension of sugarcane responses to ScYLV infection at the gene expression level but also increase the chances to block the transmission of ScYLV for use in further molecular biology techniques and will aid in increasing the resistance of plants against ScYLV.

Transcriptome Analysis and Identification of a Female-Specific SSR Marker in Pistacia chinensis Based on Illumina Paired-End RNA Sequencing.

Pistacia chinensis Bunge (P. chinensis), a dioecious plant species, has been widely found in China. The female P. chinensis plants are more important than male plants in agricultural production, as their seeds can serve as an ideal feedstock for biodiesel. However, the sex of P. chinensis plants is hard to distinguish during the seedling stage due to the scarcity of available transcriptomic and genomic information. In this work, Illumina paired-end RNA sequencing assay was conducted to unravel the transcriptomic profiles of female and male P. chinensis flower buds. In total, 50,925,088 and 51,470,578 clean reads were obtained from the female and male cDNA libraries, respectively. After quality checks and de novo assembly, a total of 83,370 unigenes with a mean length of 1.3 kb were screened. Overall, 64,539 unigenes (77.48%) could be matched in at least one of the NR, NT, Swiss-Prot, COG, KEGG, and GO databases, 71 of which were putatively related to the floral development of P. chinensis. Additionally, 21,662 simple sequence repeat (SSR) motifs were identified in 17,028 unigenes of P. chinensis, and the mononucleotide motif was the most dominant type of repeats (52.59%) in P. chinensis, followed by dinucleotide (22.29%), trinucleotide (20.15%). The most abundant repeats were AG/CT (13.97%), followed by AAC/GTT (6.75%) and AT/TA (6.10%). Based on these SSR, 983 EST-SSR primers were designed, 151 of which were randomly chosen for validation. Of these validated EST-SSR markers, 25 SSR markers were found to be polymorphic between male and female plants. One SSR marker, namelyPCSSR55, displayed excellent specificity in female plants, which could clearly distinguish between male and female P. chinensis. Altogether, our findings not only reveal that the EST-SSR marker is extremely effective in distinguishing between male and female P. chinensis but also provide a solid framework for sex determination of plant seedlings.

The Brassicaceae genome resource (TBGR): A comprehensive genome platform for Brassicaceae plants.

The Brassicaceae is an important plant family. We built a user-friendly, web-based, comparative, and functional genomic database, The Brassicaceae Genome Resource (TBGR, http://www.tbgr.org.cn), based on 82 released genomes from 27 Brassicaceae species. The TBGR database contains a large number of important functional genes, including 4,096 glucosinolate genes, 6,625 auxin genes, 13,805 flowering genes, 36,632 resistance genes, 1,939 anthocyanin genes, and 1,231 m6A genes. A total of 1,174,049 specific guide sequences for clustered regularly interspaced short palindromic repeats and 5,856,479 transposable elements were detected in Brassicaceae. TBGR also provides information on synteny, duplication, and orthologs for 27 Brassicaceae species. The TBGR database contains 1,183,851 gene annotations obtained using the TrEMBL, Swiss-Prot, Nr, GO, and Pfam databases. The BLAST, Synteny, Primer Design, Seq_fetch, and JBrowse tools are provided to help users perform comparative genomic analyses. All the genome assemblies, gene models, annotations, and bioinformatics results can be easily downloaded from the TBGR database. We plan to improve and continuously update the database with newly assembled genomes and comparative genomic studies. We expect the TBGR database to become a key resource for the study of the Brassicaceae.

Chromosome-scale genome assembly of an important medicinal plant honeysuckle

Lonicera japonica (honeysuckle) is one of the most important medicinal plants and widely utilized in traditional Chinese medicine. At present, there are many varieties of honeysuckle used in cultivation, among which Sijihua variety are widely cultivated due to its wide adaptability, stress resistance, early flowering and high yield. In this study, we assembled the genome of Sijihua, which was approximately 886.04 Mb in size with a scaffold N50 of 79.5 Mb. 93.28% of the total assembled sequences were anchored to 9 pseudo-chromosomes by using PacBio long reads and Hi-C sequencing data. We predicted 39,320 protein-coding genes and 92.87% of them could be annotated in NR, GO, KOG, KEGG and other databases. In addition, we identified 644 tRNAs, 2,156 rRNAs, 109 miRNAs and 5,502 pseudogenes from the genome. The chromosome-scale genome of Sijihua will be a significant resource for understanding the genetic basis of high stress-resistance, which will facilitate further study of the genetic diversity and accelerate the genetic improvement and breeding of L. japonica.

Regulatory Networks of Flowering Genes in Angelica sinensis during Vernalization.

Angelica sinensis is a low-temperature and long-day perennial herb that has been widely used for cardio-cerebrovascular diseases in recent years. In commercial cultivation, up to 40% of flowering decreases the officinal yield of roots and accumulation of bioactive compounds. Although the regulatory mechanism of flowering genes during the photoperiod has been revealed, the networks during vernalization have not been mapped. Here, transcriptomics profiles of A. sinensis with uncompleted (T1), completed (T2) and avoided vernalization (T3) were performed using RNA-seq, and genes expression was validated with qRT-PCR. A total of 61,241 isoforms were annotated on KEGG, KOG, Nr and Swiss-Prot databases; 4212 and 5301 differentially expressed genes (DEGs) were observed; and 151 and 155 genes involved in flowering were dug out at T2 vs. T1 and T3 vs. T1, respectively. According to functional annotation, 104 co-expressed genes were classified into six categories: FLC expression (22; e.g., VILs, FCA and FLK), sucrose metabolism (12; e.g., TPSs, SUS3 and SPSs), hormone response (18; e.g., GID1B, RAP2s and IAAs), circadian clock (2; i.e., ELF3 and COR27), downstream floral integrators and meristem identity (15; e.g., SOC1, AGL65 and SPLs) and cold response (35; e.g., PYLs, ERFs and CORs). The expression levels of candidate genes were almost consistent with FPKM values and changes in sugar and hormone contents. Based on their functions, four pathways that regulate flowering during vernalization were mapped, including the vernalization pathway, the autonomic pathway, the age pathway and the GA (hormone) pathway. This transcriptomic analysis provides new insights into the gene-regulatory networks of flowering in A. sinensis.

De novo transcriptome analysis of industrially important agarophyte Gracilaria dura (Rhodophyta: Gracilariacae) revealed differential expression of genes in gametophyte and sporophyte life-phases

Gracilaria dura is the species of choice for commercial aquaculture and quality agarose production. The previous studies have confirmed that the differences in functional traits as well as agar characteristics among life-history stages can be utilised for commercial gains. To enhance our understanding regarding phase differentiation at molecular level, transcriptome analysis was undertaken among tetrasporophyte and female gametophyte collected from the Veraval, Gujarat, India. De novo assembly constructed using an Illumina sequencing platform, yielded 92,645 unigenes in female gametophyte and 146,275 in tetrasporophyte. The similarity search revealed 29.22% and 37.97% unigenes shared homology in non-redundant (Nr) database respectively. Functional annotation with the Kyoto Encyclopedia of Genes and Genomes database assigned unigenes to 23 pathways, majority of them were allocated to carbohydrate metabolism. From significant differentially expressed genes between these life-phases KHN09340.1 and WP_005180746.1 on validation were found 1.2-fold up-regulated and 1.6-fold down-regulated respectively in tetrasporophyte. Further, few differentially expressed genes e.g. IMPDH, LecRK, SAT provide evidence of disparity between life-history phase in stress tolerance, survival and growth, evidence critical for cultivar development. Moreover, a total of 1577 and 3396 simple sequence repeat (SSR) loci were identified in tetrasporophyte and female gametophyte phase respectively. The polymorphism diversity assessed for 5 SSR loci using heterozygosity index, polymorphic information content and marker index, ranged from 0.68–0.72, 0.18–0.193 and 0.036–0.071 respectively. To the best of our knowledge, this is the first data set for G. dura transcriptome that will facilitate understanding of differences in the isomorphic life phases and further studies of the novel mechanisms in red algae.

Transcriptomic Analysis of Cadmium Stressed Tamarix hispida Revealed Novel Transcripts and the Importance of Abscisic Acid Network.

Cadmium (Cd) pollution is widely detected in soil and has been recognized as a major environmental problem. Tamarix hispida is a woody halophyte, which can form natural forest on the desert and soil with 0.5 to 1% salt content, making it an ideal plant for the research on response to abiotic stresses. However, no systematic study has investigated the molecular mechanism of Cd tolerance in T. hispida. In the study, RNA-seq technique was applied to analyze the transcriptomic changes in T. hispida treated with 150 μmol L–1 CdCl2 for 24, 48, and 72 h compared with control. In total, 72,764 unigenes exhibited similar sequences in the Non-redundant nucleic acid database (NR database), while 36.3% of all these unigenes may be new transcripts. In addition, 6,778, 8,282, and 8,601 DEGs were detected at 24, 48, and 72 h, respectively. Functional annotation analysis indicated that many genes may be involved in Cd stress response, including ion bonding, signal transduction, stress sensing, hormone responses and ROS metabolism. A ThUGT gene from the abscisic acid (ABA) signaling pathway can enhance Cd resistance ability of T. hispida by regulating the production of ROS under Cd stress and inhibit absorption of Cd. The new transcriptome resources and data that we present in this study for T. hispida may facilitate investigation of molecular mechanisms governing Cd resistance.

Comparative Transcriptome Analysis of Anthocyanin Biosynthesis in Pansy (Viola × wittrockiana Gams.)

Pansy (Viola × wittrockiana Gams.) is an important and attractive ornamental plant with a wide variety of flower colors. To date, the molecular genetic understanding of its colorful petal pigment patterns remains largely unknown. In this study, we analyzed the bicolor petals of “Mengdie” in cytological, physiological, and transcriptomic aspects. Results showed that the difference of flower colors was mainly determined by the pigment distribution in the epidermal cells. Pigment analysis indicated that anthocyanins had strong correlations with color parameters, which acted as the main factor in flower coloration. Comparative transcriptome analysis found a total of 43,908 unigenes with the mean length of 682 bp. There were 24,323, 16,668, 8507, and 7680 unigenes annotated in the Nr, Swiss-Prot, KOG, and KEGG databases, respectively. Differential expression genes (DEGs) showed that the expression of anthocyanin late biosynthesis genes (LBGs), VwF3′H, VwF3′5′H, and VwUFGT, would be likely to play a major role in the color formation of pansy. The expression patterns of selected DEGs were verified by qRT-PCR. This study contributes an excellent insight into molecular mechanism of pigment biosynthesis and provides some useful information for flower color modification in pansy.