North Lebanon Research Articles

Forest Sustainability in North Lebanon: A Challenging Complexity in a Changing Environment

Forests sustainability is a challenging task in a complex socioeconomic context. North Lebanon is a critical zone harboring forests of key ecological value and is one of the most deprived regions in Lebanon with high poverty rates, where forests are heavily impacted by unsustainable anthropogenic practices. In the global frame of climate change scenarios, this paper tests a multistakeholder, multidisciplinary approach for forest management, combining a joint participatory methodology with stakeholders along with field ecological surveys in the upper Akkar watershed (north Lebanon). A set of participatory tools including stakeholder’s analysis, problem tree, objective tree, and scenario building are tailored to reach this goal. Results exhibit that forest management is not only related to forestsper sebut also very much linked to the surrounding socioeconomic situation. Involving not only strict silviculture interventions but also a definite consideration of community needs and local economy, the adoption of a multitool, multidisciplinary, multistakeholder approach combines all possible aspects of a challenging context and unfolds complementary processes which all feed back into one target. Yet, it is a time-consuming process, which can easily drown financial and temporal resources and which can sometimes raise unrealistic expectations that are difficult to meet.

Detection of Escherichia coli O157:H7 and O104:H4 in patients with diarrhea in Northern Lebanon and characterization of fecal E.coli producing ESBL and carbapenemase genes

Background. While most strains of Escherichia coli (E. coli) are harmless, some are causing intestinal infections of varying severity. Then Shiga toxin-producing E. coli (STEC)/ enterohemorrhagic E. coli strains can be associated with fatal clinical manifestations. Of these E. coli Serotypes O157: H7 and O104: H4 were responsible for worldwide epidemics causing thousands of intestinal infections and dozens of deaths.The aim of this research is to investigate the prevalence of E. coli O157: H7Â and O104: H4 in the diarrheal stools of 242 Lebanese patients.Materials and methods. This study includes 242 E. coli strains isolatedfrom fecal specimens of patients with diarrhea between February2013 and May 2014 in the microbiology department of Nini HospitalLaboratory in Tripoli - North Lebanon. All specimens were inoculatedon sorbitol MacConkey agar. Sorbitol negative strains were investigated for detection of stx1, stx2 and eae genes using real-time PCR. All carbapenem-resistant strains and ESBL producers were investigated by PCR for presence of KPC, IMI, NMC-A, EMS, GHG, VIM, NDM, IMP,OXA-48, blaTEM, blaCTX-M, blaSHV, blaOXA, blaGES and blaPER..Results. A total of 14 sorbitol negative strains were detected. The search for stx1, stx2 and eae genes showed the presence of a single positive strain for E. coli O157: H7. Out of 242 E.coli strains, 48 (19.8%) were ESBL-positive, 4 (1.6%) were resistant to ertapenem, and all were negative for stx2 genes, The blaCTX-M gene was the most frequentamong ESBL positive strains (85%), followed by the blaTEM gene (50%). One strain had the blaNDM-1 gene, another had the blaOXA-48 gene and 2 strains were probably resistant due to impermeability.Conclusion. The results of this study demonstrate rarely presence of enterohemorrhagic E. coli, but shows the frequent presence of multidrug resistant E.coli in the intestinal flra of North Lebanese patients. Therefore, it is important to search for MDR E.coli in the intestinal flra of patients who are going to be treated with major operations or those admitted to intensive care units

Prevalence of first-step mutants among levofloxacin-susceptible isolates of Streptococcus pneumoniae in north Lebanon

Resistance of Streptococcus pneumoniae to fluoroquinolones arises by stepwise accumulation of spontaneous point mutations in the quinolone-resistance determining regions (QRDRs). Fluoroquinolones treatment of infections caused by first-step mutants (pre-resistant) can lead to the selection of resistant isolates, resulting in treatment failure. First-step mutants cannot however be reliably detected by routine resistance testing. Levofloxacin has been used as a surrogate marker to predict fluoroquinolone susceptibility in clinical laboratories. By use of a PCR followed by pyrosequencing, we examined 45 levofloxacin-susceptible pneumococcal strains [minimal inhibitory concentration (MIC) < 0·5 μg/ml] for first-step parC and parE mutations in the QRDR: 51·2% of isolates were recovered from pulmonary and nasal secretions, 22·2% from blood, 24·4% from ear and eye discharge, and 2·2% from cerebrospinal fluid. The results showed that three strains (6·6%) had first-step parC (Asp83-Asn) or parE (Asp435-Asn) mutations. This test could be useful for some high-risk patients or in national surveys.

Prevalence and antibiotic susceptibility of Bacteroides fragilis group isolated from stool samples in North Lebanon

Fifty one strains of the Bacteroides fragilis group were isolated from 45 fecal samples. Classical phenotypic identification showed that 16 isolates were B. thetaiotaomicron, 12 B. uniformis, 9 B. eggerthii, 7 B. vulgatus, 3 B. caccae, 2 Parabacteroides distasonis with 1 identified B. ovatus and 1 B. fragilis. The 51 strains were tested for susceptibility against 16 antimicrobial agents and the MICs for metronidazole were determined. The tests showed that imipenem, meropenem and chloramphenicol were the most effective antibiotics (98%, 98% and 92.16% of susceptibility, respectively) followed by ticarcillin/clavulanic acid, piperacillin/tazobactam, rifampin (88.24% susceptibility), moxifloxacin 86.27% and tigecycline 84.31%. Ofloxacin and cefotaxime were the least effective antibiotics with 27.45% and 0% of activity respectively. Only six of the 51 isolated strains were resistant to metronidazole with MICs = 64 mg/L (1 strain) and > 256 mg/L (5 strains).

Lebanese Dental Association North Lebanon May 30 - 31 , June 1 , 2013 Las Salinas , Anfeh , Lebanon

Lebanese Dental Association North Lebanon May 30 - 31 , June 1 , 2013 Las Salinas , Anfeh , Lebanon

Principals’ views on teachers’ professional development

This article is an account of a study that aimed to elicit the perceptions of school principals and middle managers in Lebanon on teachers’ professional development (PD) and to promote an understanding of PD that extends beyond workshops. The study was qualitative and exploratory and used online interviewing to collect data. Questions were emailed to 30 school principals in Beirut and North Lebanon. The overall intention was to extract understanding of how this professional qualification and administrative responsibility is understood and how the administration attends to it. Data were reduced through a coding strategy and emergent themes such as limited awareness of the benefits of embedded PD strategies, PD features of relevance, practicality and follow-up were identified. Other themes were the focus on the concept of workshop training as PD, the administrators’ lack of awareness of cognitive learning strategies and the importance of teacher PD to school renewal. Obstacles to PD were identified and included lack of time and funding for the workshops and teachers’ attitude toward growth and renewal. The study revealed that reflection is required to alter engrained conceptual structures. Critically, the study highlighted the issue that the school system in Lebanon is not designed to promote teachers’ continual learning initiatives.

Determination of natural and artificial radioactivity in soil at North Lebanon province

The concentrations of natural and artificial radionuclides at 57 sampling locations along the North Province of Lebanon are reported. The samples were collected from uncultivated areas in a region not previously reported. The samples were analyzed by gamma spectrometers with High Purity Germanium detectors of 30% and 40% relative efficiency. The activity concentrations of primordial naturally occurring radionuclides of 238U, 232Th, and 40K varied between 4–73 Bq kg−1, 5–50 Bq kg−1, and 57–554 Bq kg−1 respectively. The surface activity concentrations due to the presence of these radionuclides were calculated and Kriging-geostatistical method was used to plot the obtained data on the Lebanese radioactive map. The results for 238U, 232Th, and 40K ranged from 0.2 kBq m−2 to 9 kBq m−2, from 0.2 kBq m−2 to 3 kBq m−2, and from 3 kBq m−2 to 29 kBq m−2 respectively. For the anthropogenic radionuclides, the activity concentrations of 137Cs founded in soil ranged from 2 Bq kg−1 to 113 Bq kg−1, and the surface activity concentration from 0.1 kBq m−2 to 5 kBq m−2. The total absorbed gamma dose rates in air from natural and artificial radionuclides in these locations were calculated. The minimum value was 6 nGy h−1 and the highest one was 135 nGy h−1 with an average of 55 nGy h−1 in which the natural terrestrial radiation contributes in 99% and the artificial radionuclides mainly 137Cs contributes only in 1%. The total effective dose calculated varied in the range of 7 μSv y−1 and 166 μSv y−1 while the average value was 69 μSv y−1 which is below the permissible limit 1000 μSv y−1.

Entre centralisation et appropriation locale

Les auteures s’intéressent à la centralisation de la gestion du service de l’eau potable dans le Akkar (nord du Liban) et aux nouvelles modalités d’accès qu’induit ce processus pour les populations locales. Dans cette région périphérique sévèrement touchée par la pauvreté, la faiblesse, voire l’absence, d’un réseau public avait conduit certains villages à mettre en place des offices gérés par des comités ou les municipalités. À l’occasion de la réforme du secteur de l’eau, des établissements régionaux de gestion ont été créés pour remplacer les anciennes structures locales jugées défaillantes. Guidées par une logique de reconstruction du service public et tenues d’atteindre l’autonomie financière, ces nouvelles administrations cherchent à améliorer leurs recettes en élargissant leur périmètre d’intervention, en augmentant leurs tarifs et en éliminant les solutions alternatives qui leur font concurrence. Localement, on assiste à de fortes résistances à cette reprise en main par l’État central.

Current knowledge of Coleoptera (Insecta) from the Lower Cretaceous Lebanese amber and taxonomical notes for some Mesozoic groups

This paper overviews more than 39 families of fossil Coleoptera from Lower Cretaceous Lebanese amber from nine outcrops. Lebanese amber contains the oldest representatives of the families Scydmaenidae (considered by some as a subfamily of Staphylinidae), Ptiliidae, Elodophalmidae, Clambidae, Throscidae, Lebanophytidae fam. n., Ptilodactylidae, Cantharidae, Melyridae, Dasytidae, Dermestidae, Ptinidae, Kateretidae, Erotylidae, Latridiidae, Laemophloeidae, Salpingidae, Anthicidae, Melandryidae, Aderidae, Curculionidae (Scolytinae). The families Chelonariidae and Scraptiidae are known from both Lebanese amber and Baissa, with both sites having a comparable age. The subfamilies Trechinae (Carabidae), Euaesthetinae (Staphylinidae) and Liparochrinae (Hybosoridae) first appear in the fossil record in Lebanese amber. The Coleoptera in Lebanese amber mostly belong to groups with arboreal habits (as found today in wood and tree fungi).Eochelonarium bellegen. et sp. n.,Rhizophtoma synchrotronicasp. n.,Rhizobactron marinaegen et sp. n. andAtetrameropsis subglobosagen. et sp. n. are described from Lebanese amber. A new subfamily in the family Cerophytidae is proposed forAphytocerus communisZherichin, 1977 (Aphytocerinae subfam. n.) and new genusBaissopsisgen.nov. is erected forBaissophytum amplusChang, Kirejtshuk et Ren, 2011. Also a new interpretation of the taxon “Lasiosynidae” is provided by placing it as a subfamily in the family Eulichadidae with two genera (LasiosyneTan, Ren et Shih, 2007 andBupredactylaKirejtshuk, Chang, Ren et Shih, 2010), while the other genera initially regarded as “Lasiosynidae” were tentatively transferred into Eulichadinae sensu n. (MesodascillaMartynov, 1926;TarsomegamerusZhang, 2005;BrachysyneTan et Ren, 2009;AnacapitisYan, 2009;ParelateriformiusYan et Wang, 2010 andCretasyneYan, Wang et Zhang, 2013) with the new synonymy ofTarsomegamerusandParelateriformiussyn. n. The genusMesaplusHong, 1983 described in the family Triaplidae is also transvered to Eulichadinae. The generaArtematopoditesPonomarenko, 1990;DzeregiaPonomarenko, 1985 andGlaphyropteroidesHandlirsch, 1906 proposed for species known only by separate elytra and recently included in the “family” Lasiosynidae (Yan et al., 2013) are regarded as Elateriformiaincertae sedis. The first insect from the newly discovered outcrops of Nabaa Es-Sukkar – Brissa: Caza (District) Sir Ed-Danniyeh, Mouhafazet (Governorate) Loubnan Esh-Shimali (North Lebanon) is described and the first general description of this outcrop is made.

Étude préliminaire sur la prévalence de Campylobacter dans les diarrhées infantiles au nord du Liban

Campylobacter species are a major cause of human diarrhoeal disease worldwide. In Lebanon, the true prevalence of Campylobacter infections and the species distribution in childhood diarrhoea are not known. This study in 2010 investigated the prevalence of Campylobacter species and its possible etiologic role in childhood diarrhoea in north Lebanon. A total of 90 stool samples from children (aged 1 month to 10 years) presenting with diarrhoea were collected from 5 hospitals. A polymerase chain reaction technique (PCR) was used for each sample forthe amplification of all Campylobacter species followed by 5 PCR reactions for the amplification of C. jejuni, C. hyointestinalis, C. coli, C. fetus and C. upsaliensis. Of the 90 samples, 10 were positive for Campylobacterspecies (11.1%):1 for C.coli, 1 for C. jejuni, 2 for both C. jejuni and C. coli, and 6 could not be identified to the species level with the available primers. Campylobacter species is frequently associated with childhood diarrhoea in north Lebanon but Campylobacter infection may be significantly underdiagnosed because the search for Campylobacter is not part of the routine stool culture.

FIRST REPORT OF GYMNOSPORANGIUM SABINAE ON CULTIVATED PEAR IN LEBANON

Gymnosporangium sabinae (Dickson) G. Winter (syn. G. fus- cum DC.), the causal agent of European pear rust disease, can se- verely reduce yield of cultivated pear (Pyrus communis). This fun- gus, an obligate parasite that alternates between species of Junipe- rus and Pyrus to complete its lifecycle, is heteroecious and causes perennial infections on juniper and annual infections on pear (Laundon, 1975). In October 2011, leaves of cultivated pear trees of cv. Coscia, heavily attacked by a rust were collected in two or- chards located, respectively, in Baskinta [Mount Lebanon (33°56’39’’ N, 35°47’15’’ E)] and in Basloukite [north Lebanon (34°18’28’’ N, 35°58’02’’ E)]. Based on morphologic features (Parmelee, 1971; Laundon, 1975), the pathogen was identified as Gymnosporangium sabinae. On the upper side of the leaf, there were irregular, bright orange-red spots, which contained compact conglomerations of spermogonia. These structures were dark- brown to black, hemispherical, protuberant, 3-4 mm in diameter, had many receptive hyphae and produced at maturity a large number of oblong hyaline spores (spermatia) measuring 5.1- 7.2×1.2-1.8 μm. On the lower side of the leaf, there were loose conglomerations of horn-like aecia located on protruding tissue outgrowths. From these aecia, pale-brown pseudo-peridia arose as small groups of 2-4 mm-long filaments, composed of irregular- ly prolate peridial cells with inner and lateral walls extremely thickened, ornamented with cylindrical warts, which produced 24-30×23-28 μm subgloboid, ellipsoid aeciospores, with 4-5.5 mm thick orange-brown walls. Symptoms on surrounding Junipe- rus spp. were not observed. To our knowledge, this is the first re- port of G. sabinae on cultivated pear in Lebanon.

Refracted Gazes: A Woman Photographer during Mandate Lebanon

While conflicting thoughts on women’s activities and their status within their communities were debated in journals that circulated in the Middle East during the first two decades of the Twentieth Century (Baron: 1994, Booth: 2001, Slim and Dupont: 2002, Thompson: 2000), Marie al-Khazen seized every opportunity to use her camera to capture stories of her surroundings. She not only documented her travels around tourist sites in Lebanon but also sought creative experimentation with her device by staging scenes, manipulating shadows and superimposing negatives to produce different effects in her prints. Within the frames of her photographs, Bedouins and European friends, peasants and landlords, men and women, comfortably share the same space. Al-Khazen is a Lebanese photographer who lived between 1899 and 1983. Her photographs were mostly taken around the 1920s and 1930s in the North of Lebanon. Her work includes a collection of intriguing photographs portraying her family and friends living their everyday life in the village of Zgharta in the North of Lebanon. Most of al-Khazen’s photographs suggest a narrative of independent and determined Lebanese women. These photographs are charged with symbols that can be understood, today, as representative of women’s emancipation through their presence as individuals, separate from family restrictions of that time. Images in which women are depicted smoking a cigarette, driving a car, riding horses and accompanying men on their hunting trips counter the usual way in which women were portrayed in 1920s Lebanon. The photographs can be read as a space for alKhazen to articulate her vision of the New Woman or the Modern Girl as described by Tani Barlow in The Modern Girl Around the World. In this anthology, authors like Barlow point to the ways in which the modern girl “disregards the roles of dutiful

First Report of Watermelon chlorotic stunt virus in Cucurbits in Lebanon.

In August 2009 in the Marjyoun region in South Lebanon, severe yellowing symptoms on melon (Cucumis melo) and pronounced dwarfing and mosaics on watermelon (Citrullus lanatus) led to significant yield losses. Watermelon chlorotic stunt virus (WmCSV), genus Begomovirus, family Geminiviridae, was suspected. Symptomatic samples were collected close to the end of the growing season from several fields. The small scale CTAB protocol was followed for nucleic acid extraction. Samples were tested by PCR for WmCSV and Squash leaf curl virus (SLCV) using specific primers for SLCV (2) and newly designed WmCSV specific primers: (WMAR1: 5' TTTTCCGACACGATGAGTGAT 3'; WMAF3: 5' ACTGGACTTAGCGCTTTGTAT 3'; amplicon size 1,061 bp). Of 39 symptomatic samples, 90% were infected with WmCSV, 13/14 (93%) melon samples and 22/25 (88%) watermelon samples, while 64% were infected with SLCV, indicating a high incidence of mixed infections. In November 2009, no cucurbits were found in Marjyoun since farmers refrained from planting late crops after devastating losses in the previous year. Therefore, 92 samples were collected from other southern regions and 114 samples from northern regions. All squash samples had leaf curl symptoms, while 75 to 85% of cucumber and melon had yellowing symptoms. No WmCSV was detected in North Lebanon, even though 100% of squash samples and 79% of other cucurbit samples were positive for SLCV. However, in South Lebanon, WmCSV was detected 9/20 (45%) in melon, 12/32 (38%) in cucumber (Cucumis sativus), and 6/40 (15%) in squash; while the incidence of SLCV was high particularly on squash (39/40, 98%) and cucumber (30/32, 94%) followed by melon (7/20, 35%). The survey was repeated in 2010, and the previous year's results were confirmed: no WmCSV was detected in North Lebanon, while 39/40 (98%) melon samples tested in November were positive for SLCV. In southern Lebanon, WmCSV was not detected in melon or watermelon samples collected in June; however, in November it was detected in 11/23 (48%) squash and 9/33 (27%) melon. WmCSV genome was amplified by rolling circle amplification (RCA) using the TempliPhi Amplification Kit (GE Healthcare) The RCA product was sequenced using mostly locally designed primers, and the sequences were submitted to GenBank: WmCSV DNA A: HM368371.1; WmCSV DNA B: HM368372. Phylogenetic analysis showed that WmCSV DNA A was most closely related to isolates from Israel (EF201809.1) and Jordan (EU561237.1), sharing 99% nt identities with both isolates; WmCSV DNA B was found to be most closely related to an isolate from Israel (EF201810.1), with 98% nt identity. WmCSV was first detected in Yemen (4) but was detected quite recently in Israel and Jordan (1). Within a short period, Lebanon experienced the introduction of two new whitefly transmitted begomoviruses. WmCSV seems so far to be restricted only to South Lebanon, while SLCV is widespread. The synergistic interaction between a mixed infection by SLCV and WmCSV in melon resulted in significant symptom enhancement, plant shortening, and up to 54% yield reduction in summer (3). Hence, the development of resistant varieties coupled with the implementation of adapted integrated pest management strategies would be essential for successful production of cucurbit crops.

First Report of Squash leaf curl virus in Cucurbits in Lebanon.

During the second squash cropping season, which coincides with high whitefly populations, a high incidence of plants with severe leaf curl symptoms was observed. Many farmers reported yield losses ranging from 70 to 80%. Surveys were conducted over five cropping seasons (2008 to 2010) and covered the coastal areas of Lebanon. A total of 675 samples were collected, including cucumber (Cucumis sativus), squash (Cucurbita sp.), melon (Cucumis melo), and watermelon (Citrullus lanatus). All squash samples had leaf curl symptoms, whereas 75 to 85% of cucumber, melon, and watermelon samples showed yellowing symptoms. The remaining 15 to 25% were asymptomatic. Total nucleic acids were extracted according to a small-scale CTAB protocol (4). PCR assays were initially conducted using the universal degenerate primers PAL1v1978 and PAR1c496, designed to detect DNA-A of several begomoviruses (3). Following sequencing of 22 randomly selected amplicons, BLASTN analysis showed that 19 samples were infected with Squash leaf curl virus (SLCV). SLCV specific primers: (SqA1R: 5'AGCTGTATCTTGGGCAACAGA3' and SqA2F: 5'TATCTCCCATCTTGGCAAGG3'; amplicon size: 601 bp) were used for detection in the 675 samples. SLCV was detected in 223/249 (89%), 83/145 (57%), 129/229 (56%), and 25/52 (48%) of squash, cucumber, melon, and watermelon samples, respectively. The SLCV genome from a symptomatic squash plant collected from Akkar, North Lebanon, was amplified by rolling circle amplification (RCA) using the TempliPhi Amplification Kit (GE Healthcare). The product was used for biolistic inoculation of squash and cucumber as described (2). Severe leaf curl symptoms were observed on 7/10 of the squash seedlings (cv. Camelia F1) within 2 weeks of inoculation. However, no symptoms were observed on cucumber (cv. Beit alpha) 1 month after inoculation, even though 6/11 (54%) of the plants were positive for SLCV in PCR assays. Several primer sets were used for sequencing the full SLCV genome using the RCA product as template. The sequences were submitted to GenBank under accession numbers HM368373 and HM368374 (SLCV DNA A and B, respectively). Phylogenetic analysis showed that SLCV DNA A was most closely related to SLCV isolates from Egypt (DQ285019) and Israel (HQ184436) with 99% nucleotide identity; SLCV DNA B was most closely related to the same SLCV isolate from Israel (HQ184437) with 99% nucleotide identity. SLCV was first observed on squash in California in 1977, but was introduced during the last decade to the Mediterranean region (1) and currently is widespread all over Lebanon, posing a great threat to squash production.

GyrA and parC mutations in quinolone-resistant clinical isolates of Pseudomonas aeruginosa from Nini Hospital in north Lebanon

The problem of Pseudomonas aeruginosa resistance to fluoroquinolones is of growing concern in hospitals. The major mechanism of the resistance of this bacterium to fluoroquinolones is the modification of type II topoisomerases (DNA gyrase and topoisomerase IV). In this study, we examined, using the technique of DNA pyrosequencing, mutations in the quinolone resistance-determining regions of the gyrA and parC genes of 38 clinical isolates of P. aeruginosa that were non-susceptible to at least one of the three fluoroquinolones tested. The most common origin of the isolates was sputum (44.7 %), followed by wounds (11 %), urine (5 %), and ear discharge (5 %). Serotypes O:11 (21 %), O:2 (18.4 %), and O:6 (7.8 %), were the most predominant. Among these 38 isolates, 11 were susceptible, 22 were resistant, and 5 were intermediate-resistant to ciprofloxacin. We found that 19 (50 %) of these strains had a mutation in the gyrA gene (Thr 83 Ile), one of them presented a new mutation (His 80 Arg), 8 (21.05 %) strains had an additional mutation in the parC gene (Ser 80 Leu), and one of these strains had two new mutations not previously reported (Gln 84 Asp, Ala 85 Gly). The ciprofloxacin-sensitive strains had no mutations in the sequence area examined. We found that 81.8 % of the isolates that were resistant to ciprofloxacin had a mutation in the gyrA gene. Some of these resistant strains also had a mutation in the parC gene. The results of this study suggest that pyrosequencing is a reliable technique for the determination of the antibiotic resistance pattern of a given bacterial strain.

Toxic and essential elements in Lebanese cheese

Concentrations of 20 minor, trace and ultratrace elements relevant to human health (Ag, Al, As, Cd, Co, Cr, Cu, Fe, Hg, Li, Mn, Mo, Ni, Pb, Sb, Se, Si, Sn, V) were determined in four different varieties of the most consumed cheese in Lebanon (Halloumi, Double Crème, Baladi, Labneh) sampled at five different provinces (Grand Beirut, South of Lebanon, North of Lebanon, Mount of Lebanon and Beka’a) during the wet and dry seasons. The analyses were carried out by double focussing sector field inductively coupled plasma–mass spectrometry (ICP-MS) in order to avoid errors due to polyatomic interferences. Levels of toxic elements (As, Cd, Pb) were generally below the WHO permissible levels in dairy products. Concentrations of most elements were considerably affected by the type of cheese, the geographical site and the season of sampling.

Prevalence of glucose-6-phosphate dehydrogenase deficiency among neonates at a tertiary care centre in Lebanon

In this study we aimed to determine the prevalence of glucose-6-phosphate dehydrogenase (G6PD) deficiency in a Lebanese population and the clinical outcomes and associated adverse events encountered amongst affected patients. Newborn screening in a tertiary care centre in North Lebanon showed a prevalence of 2.1% (62 out of 3009), significantly higher in males than females, and in Muslims than Christians. Among 45 infants followed for a median of 2.2 years from birth, 12 (27%) were admitted to hospital for severe haemolytic crises, despite a programme of early family education and close follow-up. A nationwide newborn screening program to identify afflicted individuals, and to augment vigilance about this disease, should be considered in countries where the disorder is prevalent.

Concentrations of toxic and essential elements in Lebanese bread

Concentrations of 20 minor, trace, and ultratrace elements relevant to human health (Ag, Al, As, Cd, Co, Cr, Cu, Fe, Hg, Li, Mn, Mo, Ni, Pb, Sb, Se, Si, Sn, V, and Zn) were determined in three varieties of Lebanese bread (white and brown double loaf bread, Saj bread) sampled at five geographical regions (Grand Beirut, South of Lebanon, North of Lebanon, Mount of Lebanon, and Beka’a) during the wet and dry seasons. The analyses were carried out by double-focusing sector-field inductively coupled plasma-mass spectrometry (DF-SF-ICP-MS). The data were discussed in terms of nutritional elements supplied by type of bread, the risk of contamination by toxic elements (As, Cd, Pb) owing to the manufacturing process, and variations related to geographic distribution and seasonal sampling.

Towards the establishment of a natural park in Eastern Mediterranean forests in Mount Makmel: Botanical assessment and communities participation practices

Recognized as a meeting point for a variety of Mediterranean ecosystems, the Akkar-Dunniyeh area is an acknowledged hub for a large number of Eastern Mediterranean flora and a shelter for remnants of old growth forests and plant formations. The area is among the national hotspots requiring urgent protection, resulting in the Council of Development and Reconstruction (CDR) designating it a national park in 2004. Located on the foothills of Mount Makmel in North Lebanon, the area’s highest peaks have a high percentage of endemism. Anthropogenic activities have altered its vegetation cover, scarring the archetypal Mediterranean landscape. This study was part of an internationally funded development project. Designed as a stepping-stone to ensure the incorporation of various land resources conservation values, past land uses, and management types, the study aimed at adapting conservation practices of biodiversity and strategies to include in the existing social dynamics and cultural identities of the local communities. The results augmented the park’s importance since this area showed to shelter more than 400 plant species and more than 21 endemics with different conservation statuses, representing 6.75% of the total endemics found in Lebanon. Indices of high diversity were observed, ranging from an average of 19 to 49 species/ 400-m2. Gamma diversity registered high values. Beta diversity values and forests age structure revealed range differences in species richness between the various sub-regions. Indices of similarity ranged from 1.2% to 28.5%. The vocational map on habitat conservation and management, and land use plans revealed a shared vision between local governances, local communities, practitioners, and scientists. The map defined five zone categories for land conservation and management : (1) Conservation and adaptive management, (2) Remediation, (3) Agro-sylvo-pastoral, (4) Farming, and (5) Urban Development. These groupings include a set of management practices for each of the proposed categories.

Prioritising coastal zone management issues through fuzzy cognitive mapping approach

Effective public participation is an essential component of Integrated Coastal Zone Management implementation. To promote such participation, a shared understanding of stakeholders' objectives has to be built to ultimately result in common coastal management strategies. The application of quantitative and semi-quantitative methods involving tools such as Fuzzy Cognitive Mapping is presently proposed for reaching such understanding. In this paper we apply the Fuzzy Cognitive Mapping tool to elucidate the objectives and priorities of North Lebanon's coastal productive sectors, and to formalize their coastal zone perceptions and knowledge. Then, we investigate the potential of Fuzzy Cognitive Mapping as tool for support coastal zone management. Five round table discussions were organized; one for the municipalities of the area and one for each of the main coastal productive sectors (tourism, industry, fisheries, agriculture), where the participants drew cognitive maps depicting their views. The analysis of the cognitive maps showed a large number of factors perceived as affecting the current situation of the North Lebanon coastal zone that were classified into five major categories: governance, infrastructure, environment, intersectoral interactions and sectoral initiatives. Furthermore, common problems, expectations and management objectives for all sectors were exposed. Within this context, Fuzzy Cognitive Mapping proved to be an essential tool for revealing stakeholder knowledge and perception and understanding complex relationships.