Normal Leaf Shape Research Articles

Sub-okra leaf shape conferred via chromosomal introgression from Gossypium barbadense L. improves photosynthetic productivity in short-season cotton (Gossypium hirsutum L.).

Leaf shape is a vital agronomic trait that affects plant and canopy architecture, yield, and other production attributes of upland cotton. Compared with normal leaves, lobed leaves have potential advantages in improving canopy structure and increasing cotton yield. A chromosomal introgression segment from Gossypium barbadense L. conferring sub-okra leaf shape to Gossypium hirsutum L. was identified on chromosome D01. To determine the effects of this transferred sub-okra leaf shape on the leaf anatomical characteristics, photosynthesis-related traits, and yield of short-season cotton, we performed a field experiment with three sets of near-isogenic lines carrying okra, sub-okra, and normal leaf shape in Lu54 (L54) and Shizao 2 (SZ2) backgrounds. Compared with normal leaves, sub-okra leaves exhibited reduced leaf thickness and smaller leaf mass per area; moreover, the deeper lobes of sub-okra leaves improved the plant canopy structure by decreasing leaf area index by 11.24%-22.84%. Similarly, the intercepted PAR rate of lines with sub-okra leaf shape was also reduced. The chlorophyll content of sub-okra leaves was lower than that of okra and normal leaf shapes; however, the net photosynthetic rate of sub-okra leaves was 8.17%-29.81% higher than that of other leaf shapes at most growth stages. Although the biomass of lines with sub-okra leaf shape was less than that of lines with normal leaves, the average first harvest yield and total yield of lines with the sub-okra leaf shape increased by 6.36% and 5.72%, respectively, compared with those with normal leaves. Thus, improvements in the canopy structure and photosynthetic and physiological characteristics contributed to optimizing the light environment, thereby increasing the yield of lines with sub-okra leaf shape. Our results suggest that the sub-okra leaf trait from G. barbadense L. may have practical applications for cultivating short-season varieties with high photosynthetic efficiency, and improving yield, which will be advantageous for short-season varieties.

The trait co-variation regulates the response of bryophytes to nitrogen deposition: A meta-analysis

The nitrogen deposition has the potential to alter the trait composition of plant communities by affecting the fitness and physiological adaptation of species, consequently exerting an influence on ecosystem processes. Despite the importance of bryophytes in nutrient and carbon dynamics across different ecosystems, there is a lack of research examining the relationship between nitrogen deposition and the co-variation of bryophyte traits. To address this gap, a meta-analysis was conducted using data from 27 independent studies to investigate potential associations between trait co-variation of bryophytes and nitrogen deposition. The results revealed that interspecific variability regulates the influence of nitrogen deposition on bryophytes by affecting trait co-variation. Multiple correspondence analysis identified six combinations of closely related traits. For example, species with unbranched main stems frequently exhibit robust leaf midribs, leading to leaf wrinkling and leaf clasping around the stem as a response to water loss. Some weft or mat species tend to obtain resources (nitrogen) through their scale hairs on the main stem. Some species with narrow leaves require leaf teeth to maintain a normal leaf shape. The subgroup analyses indicated that certain traits, including unbranched main stem, changes in leaf morphology, robust leaf midrib, main stem without scale hairs, narrow leaf, leaf margin with teeth, undeveloped apophysis, and erect capsule minimize interaction with pollutants and represent a resource strategy. Conversely, functional traits representing a resource acquisition strategy, such as branched main stem, no changes in leaf morphology, short and weak leaf midrib, main stem with scale hairs, broad leaf, leaf margin without teeth, developed apophysis, and non-erect capsule increase pollutant exposure. Overall, our results suggest that anthropogenic global change may significantly impact bryophytes due to changes in their individual physiology and colony ecological indicators caused by increased nitrogen deposition.

In Vitro plant regeneration from leaf explants of Tagetes erecta L.

Regeneration of multiple shoots via callus induction and organogenesis was obtained from young leaf explants of the field grown marigold (Tagetes erecta L.). Callus induction and shoot regeneration at various frequencies were observed using different concentrations and combinations of growth regulators. Highest percentage (90%) of callus formation was observed within two weeks on MS medium supplemented with 5.0 mg/l BAP with 2.5 mg/l NAA. The maximum percentage (80%) of shoot bud formation (10±0.5/callus) was obtained from MS medium containing 1.0 mg/l BAP with 0.5 mg/l kinetin. The regenerated shoots developed highest percentages (90%) of roots on half strength MS medium supplemented with 1.0 mg/l IBA. The plantlets when transferred into potsoil 80% survived. Regenerated plants were morphologically uniform with normal leaf shape and growth pattern.
 Bangladesh J. Sci. Ind. Res.56(2), 69-74, 2021

Identification of a SiCL1 gene controlling leaf curling and capsule indehiscence in sesame via cross-population association mapping and genomic variants screening

BackgroundLeaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl1 (cl) with curly leaf and indehiscent capsule traits were performed in this study. In order to clone the cl1 gene for breeding selection, genome re-sequencing of the 130 individuals of cl1 × USA (0)-26 F2 population and a bulked segregation analysis (BSA) pool was carried out. The genome re-sequencing data of the 822 germplasm with normal leaf shape were applied.ResultsFor cl1 mutant, the adaxial/abaxial character of the parenchyma cells in the leaf blades is reduced. Results proved that the leaf curling trait is controlled by a recessive gene (Sicl1). Cross- population association of the F2 population of cl1 × USA (0)-26 indicated that the target cl locus was located on the interval C29 between C29_6522236 and C29_6918901 of SiChr. 1. Further regional genome variants screening determined the 6 candidate variants using genomic variants data of 822 natural germplasm and a BSA pool data. Of which, 5 markers C29_6717525, C29_6721553, C29_6721558, C29_6721563, and C29_6721565 existed in the same gene (C29.460). With the aid of the validation in the test F2 population of cl1 × Yuzhi 11 and natural germplasm, the integrated marker SiCLInDel1 (C29: 6721553–6721572) was determined as the target marker, and C29.460 was the target gene SiCL1 in sesame. SiCL1 is a KAN1 homolog with the full length of 6835 bp. In cl1, the 20 nucleic acids (CAGGTAGCTATGTATATGCA) of SiCLInDel1 marker were mutagenized into 6 nucleic acids (TCTTTG). The deletion led to a frameshift mutation and resulted in the earlier translation termination of the CL gene. The Sicl1 allele was shortened to 1829 bp. SiCL1 gene was expressed mainly in the tissues of stem, leaf, bud, capsule and seed.ConclusionsSiCL1 encodes a transcription repressor KAN1 protein and controls leaf curling and capsule indehiscence in sesame. The findings provided an example of high-efficient gene cloning in sesame. The SiCL1 gene and the cl1 mutant supply the opportunity to explore the development regulation of leaf and capsule, and would improve the new variety breeding with high harvest mechanization adaption in sesame.

A MICROPROPAGATION TECHNIQUE OF HEMIDESMUS INDICUS (ASCLEPIADACEAE),A VALUABLE MEDICINAL PLANT

An efficient protocol was established for in vitro clonal propagation of Hemidesmus indicus (Anantamul) belongs to the family Asclepiadaceae, a widely used medicinal plant through callus culture in using nodal segment. Yellowish nodular callus was observed from nodal segments on MS basal medium supplemented with 0.5 mg/L BAP + 0.2 mg/L NAA within four weeks of culture. Large number of shoots (11.4±0.2) and roots (8.2±0.4) were obtained when the callus was sub cultured on MS medium with 0.2 mg/L BAP. The regenerated plantlets were acclimatized by transferring them to soil. The survival rate of plantlets was found to be 90%. Regenerated plants were morphologically comparable having normal leaf shape and growth.

In vitro callus induction and regeneration of multiple shoots through callus derived from leaf and epicotyl explants in pigeon pea (Cajanus cajan L.)

An efficient in vitro protocol was developed for callus induction, high frequency plant regeneration through callus cultures derived from cotyledonary leaf and epicotyl explants, rooting of shoots derived from callus and establishment onto the natural conditions in two cultivars of pigeon pea; ICPL 87119 and ICPL 8863. Cotyledonary leaf and epicotyl explants were tested for callus induction across 48 different combinations and concentrations of auxins and cytokinins in MS medium, wherein, higher doses of auxins (15 mg/1 NAA) in combination with lower doses of cytokinins (0.5 mg/l kinetin) induced regenerable callus from leaf explants while lower doses of auxins (0.2 mg/1 NAA) in combination with higher doses of cytokinins (8 mg/1 kinetin) induced regenerable callus from epicotyl explants in both the genotypes. Plantlet regeneration from leaf and epicotyl derived callus was optimized at 0.05 mg/l TDZ in both genotypes. Rooting was optimized on ½ MS + 0.5 mg/1 IBA media in both genotypes. Well-rooted plants were acclimatized and established successfully into natural conditions in potting mixture-containing soil: FYM in 1:1 ratio resulting in 48.01 per cent survivability. Regenerated plants were uniform morphologically with normal leaf shape and growth. This protocol finds its significance in rapid multiplication of transgenic plants.

Development of a seedling clone with high regeneration capacity and susceptibility to Agrobacterium in apple

Agrobacterium-mediated transformation has been the preferred system for transforming apples. Although transgenic lines have been obtained form a number of genotypes, the transformation efficiency was not high. Apple is highly heterozygous genetically, so its seedling populations segregate heavily. We speculate that a genotype with high regeneration capacity and sensitive to Agrobacterium could be screened from the seedling population of apple. In order to verify this hypothesis, we developed in vitro seedling clones of apple (Malus×domestica) and compared their regeneration capacity and susceptibility to Agrobacterium tumefaciens in this study. Royal Gala, a genotype had been widely used in apple transformation, was selected as the source of seeds. First, 10 clones with higher multiplication capacity and normal leaf shape and smooth leaf surface, named GL-1 to GL-10, were screened out from 100 in vitro seedling clones. The capacity of adventitious bud regeneration from leaf segments were compared among the ten clones, and the result showed that GL-3 exhibited extremely higher adventitious regeneration capacity. GL-3 was also compared with its parent on the regeneration capacity, and the data showed that the number of buds per explant of GL-3 was 2.6 fold higher than that of Royal Gala. The susceptibility of GL-3 to Agrobacterium was compared with Royal Gala by monitoring the transient expression of GUS in leaf segments. For GL-3, the percentage of explants with large GUS-positive patches was 46.7±1.1%, which was obviously higher than that (25.1±7.2%) of Royal Gala. After the leaf segments of GL-3 were transformed with A. tumefaciens strain EHA105 carrying the AtmiR156a antisense gene, the percentage of explants with kanamycin-resistant buds reached 27.5%. In conclusion, a genotype with high regeneration capacity and sensitive to Agrobacterium was screened out from the seedling population of apple, and this strategy could be applied in other perennial woody plants.

Callus induction and plant regeneration of paederia foetida L., a widely used medicinal vine in Bangladesh

An efficient protocol was established for in vitro plant regeneration of Paederia foetada L. (Family. Rubiaceae), a widely used medicinal vine of Bangladesh through callus culture in using nodal segment. Yellowish green nodular callus was observed from nodal segments on MS basal medium supplemented with 1.5 mg/L BAP + 0.5 mg/L NAA within three weeks. Large number of shoots (14.4±1.29) were obtained when the callus was sub cultured on MS medium with 0.5 mg/L BAP. In vitro raised shoots rooted on half strength MS medium with 0.5 mg/L IBA. The survival rate of plantlets was found to be 85%. Regenerated plants were morphologically uniform having normal leaf shape and growth. Bangladesh J. Sci. Ind. Res. 47(4), 373-378, 2012 DOI: http://dx.doi.org/10.3329/bjsir.v47i4.14066

Establishment of an efficient callus induction and plant regeneration system in some wheat (Triticum aestivum L.) cultivars grown in Sudan

A procedure for callus induction and plant regeneration was developed for wheat ( Triticum aestivum ) cultivars grown in Sudan. Mature embryos of cultivar Khaleefa removed from surface sterilized seeds were used as explants. For callus induction, explants were cultured on Murashige and Skoog medium (MS) supplemented with different levels (1.5 to 4.0 mg/l) of 2,4-dichlorophenoxy acetic acid (2,4-D), indole-3- butyric acid (IBA) and indole-3- acetic acid (IAA). After 4 weeks of culture, the highest callus fresh weight (0.05 ± 0.01 g) was obtained on MS medium supplemented with 2.0 mg/L of 2,4-D. For shoot regeneration, the developed calli were transferred to MS medium without growth regulators or with different levels (0.1 to 3.0 mg/l) of 5-phenylcarbamoylamino-1,2,3-thiadiazole (thidiazuron) (TDZ), benzyladenine (BA) and kinetin (KN) alone or in combination with 2.0 mg/L of 2,4-D. After 6 weeks of culture, the best result for regeneration percentage (40%) was obtained on MS medium without growth regulators. Callus derived shoots were rooted most effectively in half-strength MS medium without or with different levels of IBA. To determine the genotypic effect, the developed procedure was used to evaluate the regeneration ability of other 5 Sudanese wheat cultivars. Significant differences were observed between genotypes for plant regeneration ability, indicating that these criteria are genotype dependent. The acclimatized regenerated plants were morphologically uniform with normal leaf shape and growth pattern under greenhouse conditions. Key words : Triticum aestivum , callus induction, regeneration, 2,4-dichlorophenoxyacetic acid (2,4-D), genotypes.

Inheritance of leaf shape in the cultivated chickpea (Cicer arietinum L.)

The cultivated chickpea (Cicer arietinum L.) possess mainly three leaf shapes, and multipinnate leaf shape has shown lower leaf miner damage (Liriomyza cicerina Rond.). Therefore, the study of the inheritance of leaf shape in cultivated chickpea has priority. For this purpose, ICC 6119 (multipinnate leaf) was crossed with Sierra (simple leaf) and ICC 4958 (normal leaves). In F1 generation, all filials had normal leaves since normal leaf shape was dominant over both multipinnate and simple leaves. In F2 generation, segregating progenies of the former crosses produced 109 normal leaves and 37 simple leaves, while the later crosses produced three shapes of leaves; 59 normal leaves, 18 multipinnate leaves and 27 simple leaves. The results suggested that the former and the later crosses were found to fit 12:4 and 9:3:4 patterns, respectively. It was concluded that leaf characteristics could be easily transferred from donor to receptor chickpea genotypes since leaf shape in the cultivated chickpea was governed by three factors.

Adventitious shoot formation in decapitated dicotyledonous seedlings starts with regeneration of abnormal leaves from cells not located in a shoot apical meristem

Regeneration of new shoots in plant tissue culture is often associated with appearance of abnormally shaped leaves. We used the adventitious shoot regeneration response induced by decapitation (removal of all preformed shoot apical meristems, leaving a single cotyledon) of greenhouse-grown cotyledon-stage seedlings to test the hypothesis that such abnormal leaf formation is a normal regeneration progression following wounding and is not conditioned by tissue culture. To understand why shoot regeneration starts with defective organogenesis, the regeneration response was characterized by morphology and scanning electron and light microscopy in decapitated cotyledon-stage Cucurbita pepo seedlings. Several leaf primordia were observed to regenerate prior to differentiation of a de novo shoot apical meristem from dividing cells on the wound surface. Early regenerating primordia have a greatly distorted structure with dramatically altered dorsoventrality. Aberrant leaf morphogenesis in C. pepo gradually disappears as leaves eventually originate from a de novo adventitious shoot apical meristem, recovering normal phyllotaxis. Similarly, following comparable decapitation of seedlings from a number of families (Chenopodiaceae, Compositae, Convolvulaceae, Cucurbitaceae, Cruciferae, Fabaceae, Malvaceae, Papaveraceae, and Solanaceae) of several dicotyledonous clades (Ranunculales, Caryophyllales, Asterids, and Rosids), stems are regenerated bearing abnormal leaves; the normal leaf shape is gradually recovered. Some of the transient leaf developmental defects observed are similar to responses to mutations in leaf shape or shoot apical meristem function. Many species temporarily express this leaf development pathway, which is manifest in exceptional circumstances such as during recovery from excision of all preformed shoot meristems of a seedling.

Effect of plant growth regulators on callus induction and plant regeneration in tuber segment culture of potato ( Solanum tuberosum L. ) cultivar Diamant

The present study was conducted to investigate the effects of different concentrations and combinations of growth regulators on callus induction and plant regeneration of potato (Solanum tuberosum L.) cultivar Diamant. The tuber segments were used as explants and cultured on Murashige and Skoog (MS) medium supplemented with different concentrations of
-naphthalene acetic acid (NAA), 2,4-Dichlorophenoxy acetic acid (2,4-D), benzyl adenine (BA) and thidiazeron (TDZ) alone and 2,4-D in combinations with BA for callus induction. The best degree for callus formation (6.0) was obtained on MS medium supplemented with 2,4-D alone at 3.0 mg/l or 2,4-D in combination with BA both at 2.0 mg/l. MS media supplemented with different levels of BA and TDZ were employed for shoot regeneration. MS medium containing 5.0 mg/l TDZ was the best for days to shoot initiation, the highest percentage of callus with shoot (81%) and highest number of shoot per callus (3.4). Callus derived shoots were rooted most effectively in half-strength MS medium containing 0.5 mg/l IBA. The success of plant tissue culture for in vitro culture of potato was encouraged by acclimatization of the plantlets in the greenhouse conditions. Regenerated plants were morphologically uniform with normal leaf shape and growth pattern.

Okra ve Normal Yapraklı Pamuklarda (Gossypium hirsutum L.) Bazı Fizyo-Morfolojik Oluşumların Verim ile Olan ilişkileri

Pamukta yaprağın şekli, büyüklülüğü, sayısı ve alanı bitkinin fotosentetik faaliyetlerini ve dolayısıyla verimliliğini etkileyen faktörlerdendir. Çalışmada, okra ve normal olmak üzere iki farklı yaprak şekline sahip dört pamuk (Gossypium hirsutum L.) çeşidinde yaprak sayısı, ortalama tek yaprak alanı, yaprak alanı indeksi, yaprak klorofil miktarı, bitki boyu ve kütlü pamuk verimi özellikleri incelenmiştir. Okra ve normal yapraklı çeşitlerde, incelenen özelliklerin kütlü pamuk verimi ile olan ilişkileri, korelasyon analizleri yapılarak belirlenmiştir. Normal yapraklı çeşitler, ortalama tek yaprak alanı, yaprak alan indeksi, bitki boyu, meyve dalı sayısı ve kütlü verimi yönünden daha iyi sonuçlar vermişlerdir. En yüksek yaprak klorofil değeri, 50.54 ile Maraş 92 çeşidinden en düşük ise 46.44 ile Dicle 2000 çeşidinden elde edilmiştir. Kütlü pamuk verimi yönünden Maraş 92 pamuk çeşidi, 509.93 kg.da-1 ile en yüksek değere, Siokra % okra yapraklı pamuk çeşidi ise 365.56 kg.da-1 ile en düşük değere sahip olmuştur. İncelenen özellikler arası ilişkilerde ise, pamuk kütlü verimi ile yaprak sayısı arasında olumsuz ve önemli; yaprak alanı indeksi ile olumlu ancak önemsiz ilişkiler saptanmıştır.

SOMACLONAL VARIATION: A TOOL FOR THE IMPROVEMENT OF CAVENDISH BANANA CULTIVARS

SOMACLONAL VARIATION: A TOOL FOR THE IMPROVEMENT OF CAVENDISH BANANA CULTIVARS

The Arabidopsis LATERAL ORGAN BOUNDARIES-domain gene ASYMMETRIC LEAVES2 functions in the repression of KNOX gene expression and in adaxial-abaxial patterning.

The normal development of lateral organs of the shoot requires the simultaneous repression of meristem-specific genes and the activation of organ-specific genes. ASYMMETRIC LEAVES2 (AS2) is required for the development of normal leaf shape and for the repression of KNOX genes in the leaf. AS2 is a member of the recently identified, plant-specific LATERAL ORGAN BOUNDARIES (LOB)-domain gene family. Expression of AS2 at high levels resulted in repression of the KNOX homeobox genes BREVIPEDICELLUS, KNAT2, and KNAT6 but not of the related SHOOT MERISTEMLESS gene. Overexpression of AS2 also led to a perturbation of normal adaxial-abaxial asymmetry in lateral organs, resulting in the replacement of abaxial cell types with adaxial cell types. These results indicate that AS2 is sufficient to induce adaxial cell fate and repress KNOX gene expression.

Resistance to whitefly ( Bemisia tabaci) in cotton ( Gossypium hirsutum) in the Sudan

Over the past 10–15 years, the cotton whitefly ( Bemisia tabaci Genn.) has caused severe damage to cotton in many tropical countries. Effects of three leaf-hair densities (LHD) (high, moderate and low) and three leaf shapes (LS) (normal, okra and super okra) on whitefly numbers were examined in the Sudan in 1982. Resistance was conferred by low LHD and okra or super okra LS, with significant reductions in numbers of whitefly adults per leaf and adults, scales and pupae per unit area. Adults per leaf were lowest on the most resistant line, ORS-13 (exotic Gossypium hirsutum cv., low LHD/okra LS) throughout the season. Pupal parasitism was significantly higher on this line than on a hairy plant of normal leaf shape. Honeydew causing stickiness of lint was reduced to acceptable levels on resistant lines. Leaf shape influenced the microclimate, in that relative humidity was lower and temperature was slightly higher in the canopy of Sudac-K than in Barac (67)B. Fewer whiteflies on Sudac-K may be due to a more adverse microclimate for whitefly and improved host-searching conditions for adult parasites. A breeding programme in the Sudan should be maintained for selection of field-resistant varieties.

Effect of Leaf Shape on Response of Cotton to Plant Population, N Rate, and Irrigation1

AbstractLeaves varying in shape have been identified in cotton, and it has been conjectured that leaf shape affects growth and other quantitative characters in Upland cotton, Gossypium hirsutum L.The objective of these studies was to evaluate okra and normal leaf shape on boll rot, yield, earliness, boll size, and fiber properties. Near isogenic lines of okra and normal leaf shape cotton was evaluated at three plant populations (21,780, 32,670, and 65,338 plants/ha) and three N rates (100, 134, and 168 kg/ha) on an Appling coarse sandy loam (Typic Hapludults; clayey, kaolinitic, thermic family) soil over a 3‐year period 1971‐73. In 1972 irrigation treatments were also included.No significant interactions were found between leaf characters, plant populations, N rates, and irrigation. Okra leaf shape increased earliness, boll size, and micronaire and decreased seed cotton loss due to boll rot. With increasing plant populations, lint yield and earliness tended to increase and boll size decreased. Higher boll rot loss was observed at higher levels of N. Irrigated cotton produced significantly greater lint yield, boll size, and fiber length and increased earliness.

Callus Induction and High Frequency Regeneration of Plantlets of Scoparia dulcis L., a Perennial Medicinal Herb, Through Auxiliary Shoot Proliferation

Green compact nodular callus was observed within three weeks from nodal segments of a perennial medicinal herb Scoparia dulcis L. on MS basal medium supplemented with 1.5 mg/l BAP + 0.2 mg/I NAA. The callus produced large number of shoots when subcultured on MS with 0.5 mg/l BAP + 0.1 mg/l NAA. In vitro raised shoots rooted on half strength of MS with 1.0 mg/l IBA + 1.0 mg/l NAA. For acclimatization and transplantation, the plantlets in the rooting culture tubes were kept in normal room temperature for seven days before transplanting in pots where plantlets were reared for three weeks. The survival rate of plantlets was found to be 85%. Regenerated plants were morphologically uniform having normal leaf shape and growth. Key words: Scoparia dulcis, Medicinal plant, Shoot proliferation, Acclimatization D.O.I. 10.3329/ptcb.v18i1.3268 Plant Tissue Cult. & Biotech. 18(1): 75-83, 2008 (June)

Progressive Mutations Induced in Gossypium hirsutum by Radiations

Mutations which are progressive have been produced in cotton (Gossypium hirsutum) by x-ray treatment of the dry seeds. These mutations consist of: 1. A mutation from forked leaf shape to normal leaf shape. This was induced in two different lines of cotton, viz., a. An F1 which was heterozygous, Nn. b. A homozygous forked leaf line, nn. 2. A mutation from virescent yellow leaf and plant color to normal green leaf and plant color. The mutation rate in each case was less than one per cent. Evidence is also presented for reversible mutations in cotton. There are indications that a mutation has been induced from normal leaf to forked leaf, the reverse of the mutation from forked leaf to normal leaf. The induced mutation from virescent yellow to green is the reversal of the mutation from green to virescent yellow which had previously occurred in nature.