Non-inoculated Control Plants Research Articles

Occurrence of Charcoal Rot Caused by Macrophomina phaseolina on Canola in Argentina.

Canola (Brassica napus) is an important oleaginous crop in Argentina. Approximately 16,000 ha are grown commercially in the southern region of Buenos Aires Province. In 2003, typical symptoms and signs of charcoal rot were observed on canola plants in experimental plots located at the School of Agricultural Sciences, University of Buenos Aires in Buenos Aires. Average disease incidence across three 5- to 6-month-old plants (cvs. Monty, Rivette, and Trooper) was 12% (range = 7 to 17%). Affected plants appeared in patches following the rows at pod-filling stage. Symptoms included wilted foliage, premature senescence, and death of plants. Black, spherical microsclerotia 78 to 95 μm in diameter were present in vascular tissue of basal stems and taproots. The affected plants were stunted and had unfilled pods. In advanced phases of the disease, areas of silver gray-to-black discoloration were observed in the stem cortex; many plants were killed during late-grain fill, and plants could be pulled easily from the ground because basal stems were shredded. Four samples consisting of five symptomatic plants per sample were randomly collected from experimental plots. Pieces (1-cm long) taken from taproots and basal stems of diseased plants were surface sterilized with 1% NaOCl for 2 min and then placed on potato dextrose agar (PDA). Plates were incubated in the dark at 26°C for 4 days and then exposed to 12-h NUV light/12-h dark for 6 days. Five resulting isolates were identified as Macrophomina phaseolina (Tassi) Goidanich (1) based on the gray color of the colony and the presence of microsclerotia 71 to 94 μm in diameter. Two colonies developed globose pycnidia with one-celled, hyaline, and elliptic conidia. Pathogenicity tests were conducted using four inoculated and three non-inoculated control plants potted in a sterilized soil mix (soil/sand, 3:1) in a greenhouse at 25°C and 75% relative humidity with no supplemental light. Crown inoculations were carried out by placing a disk taken from an actively growing culture of M. phaseolina into wounds made with a sterile scalpel. Control plants received disks of sterile PDA. Inoculated and control plants were covered with polyethylene bags for 48 h after inoculation. Three isolates caused disease on 7-week-old canola plants (cvs. Master, Mistral, Rivette, and Trooper). Characteristic symptoms similar to the original observations developed for all three isolates within 21 days after inoculation on 80% of inoculated plants. The pathogen was successfully reisolated from diseased stem tissue in all instances. Symptoms included leaf necrosis, stunting, decay and collapse of seedlings, and plant death. Control plants remained asymptomatic. The experiment was repeated once with similar results. To our knowledge, this is the first report of the occurrence of M. phaseolina causing charcoal rot on canola in Argentina. This pathogen has been previously reported in the United States (2,3). The results demonstrate the potential importance of this pathogen in Argentina, since two commercial cultivars (Master and Mistral) were apparently susceptible to M. phaseolina. More studies are needed to determine the presence of charcoal rot in canola-growing areas of Argentina.

Dasylirion serratifolium as a New Host of Botrytis cinerea, the Causal Agent of Leaf Spots and Blight in Italy.

Sandpaper sotol (Dasylirion serratifolium Zucc.), native to Mexico, has green leaves with margins highlighted by whitish yellow prickles like a fine sandpaper. During the spring of 2004 and 2005, necrotic lesions were observed in the middle of leaf blades and near prickles on 2- to 5-year-old, container-grown sandpaper sotol plants from two nurseries in eastern Sicily (Italy). Symptoms were detected on 20 to 30% of plants and consisted of reddish lesions that developed a reddish brown stripe surrounded by a yellow halo. As lesions enlarged, the center turned yellow and expanded rapidly causing blight of young leaves. Occasionally, symptomatic tissues had masses of gray fungal conidia and/or sclerotia. Botrytis cinerea was isolated consistently from infected tissues disinfected for 1 min in 1% NaOCl and rinsed in sterile distilled water and grown on potato dextrose agar (PDA). Hyaline, ovoid conidia (average 6.4 × 9.7 μm) and conidiophores were similar to those described of B. cinerea, and 5- to 8-day-old cultures developed black sclerotia that were round or irregular in shape (average 1.55 × 1.02 mm) that is typical of gray mold (1). Koch's postulates were performed by spraying 6-week-old sandpaper sotol plants grown in 12-cm pots with a spore suspension (1 × 106 CFU per ml) obtained from 12-day-old cultures grown on PDA. Eight plants were naturally wounded by scratching leaf blades among themselves and were subsequently inoculated, while eight plants were inoculated without wounding. An equal number of noninoculated plants sprayed with sterile water served as controls. All plants were maintained in high humidity conditions (90 to 95% relative humidity) at 20 ± 2°C. Leaf spots similar to the ones observed in nurseries were evident on all naturally wounded and nonwounded plants within 2 to 3 weeks after inoculation. Noninoculated control plants were symptomless. B. cinerea was reisolated from affected tissues. The pathogen has reduced commercial value of sandpaper sotol plants and may represent a limiting factor for the cultivation of this plant in eastern Sicily. To our knowledge, this is the first report in the world of leaf spot and blight caused by B. cinerea on D. serratifolium. Reference: (1) M. B. Ellis. Dematiaceous Hyphomycetes. CAB International Mycological Institute, Kew, Surrey, England, 1971.

First Report of Root Rot of Cocoyam Caused by Pythium myriotylum in Sri Lanka

Root rot of cocoyam (Xanthosoma sagittifolium L. Schott) caused by Pythium myriotylum Drechsler is a major disease of this crop in Africa (1,2) but is unreported from other regions of the world. During September 1999, commercially grown cocoyam (cv. Ratu-kiri-ala) in Gampaha (7°05'N, 80°00'E), Sri Lanka suffered from severe root rot. Initial symptoms were water-soaked lesions at the root tips that gradually enlarged to rot the entire root system and tuber. Wilting and yellowing of leaves were observed in advanced stages of disease. A Pythium sp. was regularly isolated from the affected roots and an isolate, SC5, was identified as P. myriotylum on the basis of morphology and the internal transcribed spacer (ITS) rDNA sequence. Characteristics of isolate SC5, grown on a grass-leaf water culture (3) were main hyphae up to 8.5 μm wide, oogonia terminal or intercalary (22.5 to 33.8 μm in diameter), antheridia diclinous occasionally monoclinous, one to eight per oogonium, stalks branched, often more or less loosely enveloping the oogonium, antheridium clavate or crook-necked, making apical contact with the oogonium, breadth of antheridium 2.5 to 7.0 μm, oospores aplerotic (17.0 to 22.5 μm in diameter), oospore wall 0.8 to 2.0 μm in thickness, sporangia terminal or intercalary, filamentous, inflated lobulate, and digitate, of variable length, breadth of sporangia 7.0 to 17.5 μm, formed in water; zoospores formed at 25°C, and diameter of encysted zoospores 10.0 to 12.5 μm. Cardinal temperatures on potato carrot agar 8°C minimum, 34°C optimum, and 37°C maximum with daily radial growth rate for 34°C at 32.8 mm. The ITS rDNA sequence of the isolate matched the sequences of P. myriotylum in GenBank (Accession Nos. AB095051 and AF452156) and isolate CBS254.70 used for the species description by van der Plaats-Niterink (3). The sequence of SC5 has been deposited in GenBank, Accession No. DQ102701. Pathogenicity tests used potted cocoyam plants (20 cm high), planted in an autoclaved potting mix. Four agar disks (8 mm in diameter) of isolate SC5 grown at 25°C for 48 h on potato dextrose agar was mashed and injected at a depth of 2 to 3 cm in the soil around the roots. Inoculated plants were placed in transparent plastic bags and kept for 7 days in a growth chamber maintained at 24 to 26°C with continuous light (52 to 98 μmol m-2·s-1). The experiment was carried out twice with three replications for each test. Dark brown rotting on roots and wilting of leaves were observed in 7 days after the inoculation. P. myriotylum was reisolated from diseased tissues and found to be morphologically identical to the original isolate SC5. Noninoculated control plants remained healthy. On the basis of the symptoms, morphological and molecular characteristics and confirmation of pathogenicity, P. myriotylum is the causal agent of root rot of cocoyam. To our knowledge, this is the first report of P. myriotylum causing root rot of cocoyam in Sri Lanka.

Beneficial Role of Hydrophytes in Removing Cr(Vi) From Wastewater in Association With Chromate-Reducing Bacterial Strains Ochrobactrum Intermedium and Brevibacterium

This study deals with the use of three chromium-resistant bacterial strains (Ochrobactrum intermedium CrT-1, Brevibacterium CrT-13, and CrM-1) in conjunction with Eichornia crassipes for the removal of toxic chromium from wastewater. Bacterial strains resulted in reduced uptake of chromate into inoculated plants as compared to noninoculated control plants. In the presence of different heavy metals, chromium uptake into the plants was 28.7 and 7.15% less at an initial K 2 CrO 4 concentration of 100 and 500 μg ml−1 in comparison to a metal free chromium solution. K 2 CrO 4 uptake into the plant occurred at different pHs tested, but maximum uptake was observed at pH 5. Nevertheless, the bacterial strains caused some decrease in chromate uptake into the plants, but the combined effect of plants and bacterial strains conduce more removal of Cr(VI) from the solution.

First Report of Crown and Root Rot in Strawberry Caused by Macrophomina phaseolina in Israel.

A phenomenon of wilting in strawberry (Fragaria × ananassa Duchesne) transplants, cultivated for annual winter production, was observed on several cultivars at 14 farmers' plots in nine growing regions in Israel during September and October 2004. Typical 'charcoal rot' symptoms included necrotic root and crown rot accompanied by plant wilting and chlorosis of leaves (1). Pure cultures of Macrophomina phaseolina were isolated from affected roots and crowns of plants (1) when incubated at 25°C in the dark on potato dextrose agar (PDA) (Difco Laboratories, Sparks, MD) medium containing 250 mg/l of chloramphenicol. Dark, oblong sclerotia averaging 40 μm wide by 200 μm long were observed in the infected root tissue and in culture 7 to 10 days after isolation (2). Twenty-two single sclerotium isolates were recovered from five infected cultivars (Yuval, Herut, Tamar, Hadas, and Malach) and three representative isolates were used in two pathogenicity assays. Inoculum of M. phaseolina was produced by blending 3-week-old cultures on PDA plates (9 cm diameter) in 100 ml of sterile distilled water, filtering the suspension through eight layers of gauze, and adjusting the concentration to 105 sclerotia per ml. In the first pathogenicity assay, each of the three isolates was inoculated on five plants (cv. Malach). Plants were produced from nursery runners and potted in a soilless coconut and styrofoam (3:1 vol/vol) medium, 1 liter per pot. Each plant was inoculated by pouring 50 ml of sterile water containing 105 sclerotia per ml per pot. Plants were incubated at 30°C with 12-h day/night conditions and watered with 100 ml every 3 to 7 days. Five noninoculated control plants were included. Necrosis at the base of petioles and chlorosis of leaves, followed by initial wilting of leaves, were observed after 2 weeks on inoculated plants. Plant mortality was first recorded approximately 5 weeks after inoculation and 100% mortality was recorded 10 weeks postinoculation. In the second pathogenicity assay, the same three isolates were used to inoculate four plants each of two different cultivars (Malach and Hadas) as described previously. Identical disease symptoms, as described previously, were observed 17 days after inoculation. Initial plant mortality was observed approximately 6 weeks postinoculation. In both pathogenicity assays, M. phaseolina was readily reisolated on amended PDA from all symptomatic and dead plants, which successfully completed Koch's postulates. Noninoculated control plants remained healthy. Although M. phaseolina has been reported in other crops in Israel, to our knowledge, this is the first report of the pathogen on strawberry in our country. This study suggests that the current soil fumigation regimen for control of fungal pathogens such as M. phaseolina, utilizing alternatives to methyl bromide which is currently being phased out in Israel, may not be adequate to maintain healthy strawberry material at all production stages. A similar observation was recently reported in Florida (2). Charcoal rot of strawberry has also been recorded on strawberry in France, India, and Egypt (1).

First Report of Sclerotinia Stem Rot and Death of Osteospermum spp. Hybrid Cultivars Caused by Sclerotinia sclerotiorum in Louisiana.

Osteospermum spp. Hybrids, belong to Asteraceae, commonly called African daisy or cape daisy with over 214 named cultivars, are popular flowering plants grown as winter landscape plants in southern Louisiana. During January of 2005, plants growing in a wholesale nursery using polyethylene-film-covered greenhouses were observed with symptoms of wilt that began with tan stem lesions and progressed to stem rot, wilt, and plant death. Plants had been purchased out-of-state as rooted cuttings and transplanted to a commercial bark potting mix in 11.4-cm (4.5-in.) plastic pots. Signs of fungal infection included the presence of white cottony mycelium and black sclerotia. Disease incidence was 50% on cv. Soprano White but less than 1% among the four other cultivars being grown (Ostica Blue Eye, Ostica Pink, Lemon Symphony, and Soprano Purple). Differences in disease incidence among cultivars may have been due to differences in susceptibility since all were grown on the same greenhouse bench. Sclerotinia sclerotiorum was consistently isolated from sections of diseased stems that had been surfaced disinfested (30 to 60 s in 70% ethyl alcohol) and placed on acidified potato dextrose agar. Inoculum for pathogenicity tests consisted of mixed mycelia and sclerotia that had been grown on twice-sterilized wheat grain for 14 days. Ten flowering-age Osteospermum sp. plants of cv. Soprano White were inoculated with 1 g of inoculum placed at the base of each plant. One group of five plants was kept in a dew chamber at 22°C for 40 h after which they were removed to a greenhouse. The second group of five plants was placed in a single, plastic bag with the top left open and kept in the greenhouse. Ten noninoculated plants of the same cultivar served as controls with five kept in the dew chamber for 40 h and the other five held in a plastic bag in the greenhouse. Inoculated plants that had been held in the dew chamber developed stem lesions and rot after 2 days, wilted permanently after 5 days, and were desiccated and dead by day 7. Inoculated plants held in the bag in the greenhouse followed a similar disease development pattern but did not show wilt symptoms until 8 days after inoculation and were dead after 12 days. White cottony mycelium and black sclerotia developed on stems and at the base of all inoculated plants. S. sclerotiorum was reisolated from inoculated diseased plants. All noninoculated control plants remained disease free. An outbreak of this disease was previously reported on Osteospermum spp. planted along highways in southern California (1). To our knowledge, this is the first report of the disease in Louisiana and the first report of its occurrence in greenhouse production of Osteospermum spp. Reference: (1) H. S. Gill. Plant Dis. Rep. 59:82, 1975.

First Report of Crown and Stem Rot of Orchid (Orchis palustris) Caused by Sclerotinia minor.

Orchis palustris Jacq. is a wild orchid native to wetlands in eastern Anatolia. During June of 2003, near Erzurum, Turkey, a decline of this orchid was observed in several meadows that had been irrigated for forage production. Stems were chlorotic, wilted, and collapsed. There was a soft, watery rot at the crowns and lower stems. White mycelium and black sclerotia formed on necrotic stem and crown tissues. The fungus was isolated from sclerotia on potato dextrose agar (PDA) and identified as Sclerotinia minor Jagger on the basis of small sclerotia (0.5 to 2.5 mm long) scattered throughout the colonies (2). Pathogenicity was confirmed by inoculating stems of 8-week-old plants with mycelial plugs from 5-day-old PDA cultures and enclosing inoculated plants in transparent plastic bags for 3 days. After 2 weeks, symptoms similar to those in the field were observed, and S. minor was reisolated from inoculated plants. Noninoculated control plants remained asymptomatic. The disease was previously observed on O. laxiflora Lam. in Turkey (1), but to our knowledge, this is the first report of S. minor infecting O. palustris

Lack of mycorrhizal autoregulation and phytohormonal changes in the supernodulating soybean mutant nts1007

Autoregulatory mechanisms have been reported in the rhizobial and the mycorrhizal symbiosis. Autoregulation means that already existing nodules or an existing root colonization by an arbuscular mycorrhizal fungus systemically suppress subsequent nodule formation/root colonization in other parts of the root system. Mutants of some legumes lost their ability to autoregulate the nodule number and thus display a supernodulating phenotype. On studying the effect of pre-inoculation of one side of a split-root system with an arbuscular mycorrhizal fungus on subsequent mycorrhization in the second side of the split-root system of a wild-type soybean (Glycine max L.) cv. Bragg and its supernodulating mutant nts1007, we observed a clear suppressional effect in the wild-type, whereas further root colonization in the split-root system of the mutant nts1007 was not suppressed. These data strongly indicate that the mechanisms involved in supernodulation also affect mycorrhization and support the hypothesis that the autoregulation in the rhizobial and the mycorrhizal symbiosis is controlled in a similar manner. The accumulation patterns of the plant hormones IAA, ABA and Jasmonic acid (JA) in non-inoculated control plants and split-root systems of inoculated plants with one mycorrhizal side of the split-root system and one non-mycorrhizal side, indicate an involvement of IAA in the autoregulation of mycorrhization. Mycorrhizal colonization of soybeans also resulted in a strong induction of ABA and JA levels, but on the basis of our data the role of these two phytohormones in mycorrhizal autoregulation is questionable.

First Report of Rhizoctonia solani AG-4 and AG-2-2 on Lupinus angustifolius in Canada.

Narrow-leaved lupine (Lupinus angustifolius L.) is grown as a grain legume crop in Australia and Europe where it is used as feedstock in the livestock and aquaculture industries. During July 2003, a stem rot disease was observed in narrow-leaved lupine (cv. Arabella) plants in a research plot at the Crop Diversification Centre North (CDCN), Edmonton, Alberta, Canada. The disease was also found on cv. Rose at the CDCN and cv. Arabella in experimental fields near Devon, Ellerslie, and Westlock, Alberta during the late spring of 2004. Diseased plants showed dark brown-to-black stems with sunken and constricted lesions at the soil level. Young leaves became shrunken and twisted and seedlings collapsed. Rhizoctonia solani was consistently isolated from lesions on taproots and basal stems of diseased plants. Colonies of cream-colored mycelia grew close to the surface of potato dextrose agar (PDA). Most sclerotia formed inside the medium. Agar disks (1 cm in diameter) of isolates LP-11Bb, LP-24C, and LP-25C were attached to the opposite sides of basal stems (180° apart) of 1-month-old lupine seedlings (cv. Arabella). Inoculated plants were incubated for 2 days in black plastic bags under a greenhouse bench at approximately 20°C. All isolates caused brown lesions on the lower stems (extending up to 7 cm above ground level), girdling, and root rot. Plants wilted within 7 to 10 days after inoculation, and aerial mycelia appeared on the basal stems. R. solani was reisolated from the infected crown tissues using PDA to complete Koch's postulates. The isolates were paired with AG tester strains of R. solani. Isolates LP-11Bb and LP-24C were identified as AG-4 while isolate LP-25C was identified as AG-2-2. In another trial, eight isolates of R. solani (unknown AG types) were tested for virulence on L. angustifolius cv. Arabella using the inoculation method described above. All isolates were pathogenic, and disease severity that was based on a 0 to 4 scale ranged from 2.7 to 3.2. The most virulent strain was LP-24C, which caused a 77% loss in fresh weight compared with the noninoculated control plants. R. solani AG-8 is associated with Rhizoctonia disease of lupine in Australia (1) and also causes bare patch disease of wheat. To our knowledge, this is the first report of R. solani on lupine in Canada. This disease could have a significant impact on the commercial production of lupine in Alberta. Reference: (1) M. W. Sweetingham et al. Pages 466-486 in: Advances in Lupin Disease Management in Australia. Proc. Int. Lupin Conf., 8th. G. D. Hill, ed. International Lupin Association, Canterbury, New Zealand, 1999.

First Report of Powdery Mildew Caused by Golovinomyces orontii on Corn-Salad in the United States.

Corn-salad or lamb's lettuce (Valerianella locusta) is a specialty leafy green, annual vegetable that is grown commercially in California for use in salads. During the summer (June through August) of 2004, field plantings in coastal California (Monterey County) showed symptoms and signs of a powdery mildew. White, ectophytic mycelia and conidia were present on leaves and petioles. Extensively colonized leaves were slightly twisted and later developed a tan necrosis. Mycelial growth was spread out, flat, sometimes dense, and colonized both sides of the leaf. Growth was more extensive on the upper leaf surfaces. Hyphae were 5 to 7.5 μm wide with nipple-shaped appressoria. Conidiophores were straight and had foot cells that were simple, mostly curved, measured 50 to 65 × 10 to 12.5 μm, and followed by two to three cells of equal size. Conidia developed in short chains. Conidia were cylindric to doliform, measured 27.5 to 32.5 × 15 to 17.5 μm, and lacked fibrosin bodies. Conidial length-to-width ratios were usually less than or equal to 2.0. Conidia germinated at the ends (cichoracearum-type) and had germ tube lengths that ranged from short to 1.0 to 1.5 times the length of the conidium; germ tubes had swollen tips. Cleistothecia were not observed. On the basis of these characteristics, the fungus is identified as Golovinomyces (Erysiphe) orontii(Cast.) Heluta (1). To demonstrate pathogenicity, heavily colonized corn-salad leaves from commercial plantings were collected and gently pressed onto leaves of potted corn-salad plants. Plants were then maintained in a greenhouse (22 to 24°C). After 8 to 10 days, symptoms and signs of powdery mildew developed on the foliage of inoculated plants, and the pathogen morphology matched that of the originally observed pathogen. Noninoculated control plants did not develop powdery mildew. To our knowledge, this is the first report of powdery mildew of corn-salad caused by G. orontii in the United States. This corn-salad disease has been reported from a number of countries in Europe (2). Because the presence of powdery mildew on the harvested foliage made the leaves unmarketable, part of the crop could not be sold.

Occurrence of Fusarium Wilt on Canola Caused by Fusarium oxysporum f. sp. conglutinans in Argentina.

Canola (Brassica napus) is a developing oleaginous crop grown commercially in Argentina, primarily in the southeastern region of Buenos Aires Province. Since 2002, plants exhibiting symptoms of wilt and xylem discoloration were observed in canola plants in experimental field plots located at the University of Buenos Aires, Buenos Aires, Argentina. Average disease incidence in 5- to 6-month-old canola cultivars developed in different countries was 18% (range = 9 to 27%). Disease symptoms that included yellowing, wilting, stunting, and necrosis of leaf tissue and suppressed root development appeared in irregular-shaped patches following the rows of plants. The first symptom observed was leaf yellowing followed by an irregular, brown necrosis of the leaf margins. Lesions coalesced to form large necrotic areas that led to severe defoliation beginning with the lower leaves. As the disease developed, a pale brown discoloration girdled the stems that progressed from the basal tissues to the apex. Affected plants were stunted and had small pods with no seeds. Diseased plants eventually collapsed and died. From June to July 2003, six samples consisting of five affected plants per sample were randomly collected from experimental field plots. Pieces (1 cm long) of disease basal stem tissue were thoroughly washed, surface sterilized in 1% sodium hypochlorite for 1 min, rinsed in sterile distilled water, blotted dry on sterile Whatman's filter paper, and incubated on potato dextrose agar in the dark at 26°C for 10 days. Ten resulting colonies were examined microscopically and identified as Fusarium oxysporum Schlechtend.:Fr. f. sp. conglutinans (Wollenweb.) W.C. Snyder & H.N.Hans. (3). Pathogenicity tests for three single-spore isolates of the fungus were performed on 6-week-old canola plants of cvs. Impulse, Master, Mistral, Monty, Rivette, and Trooper. Koch's postulates were completed for each isolate by dipping the roots of seedlings in a conidial suspension (2 times; 105 conidia per ml) for 15 min. Plants were repotted in a sterilized soil mix (soil/sand, 2:1). The experiment, which included five inoculated plants and three noninoculated (roots dipped in sterile distilled water) control plants for each cultivar, was conducted in a greenhouse at 23 to 25°C and 75% relative humidity with no supplemental light. Characteristic symptoms, identical to the original observations, developed within 14 days after inoculation on 100% of the inoculated plants for all three isolates. The pathogen was successfully reisolated from internal diseased stem tissue in all instances. Symptoms included stunted seedlings, leaf necrosis, and external stem discoloration. None of the control plants developed disease. The experiment was repeated once with similar results. F. oxysporum f. sp. conglutinans, which has been reported to cause disease in canola in Canada (1) and the United States (2), represents a serious threat to the main canola cultivars grown in Argentina. To our knowledge, this is the first report of canola wilt incited by F. oxysporum f. sp. conglutinans in Argentina.

First Outbreak of Blackleg Caused by Phoma lingam in Commercial Canola Fields in Argentina.

Canola (Brassica napus) was introduced as an alternative crop to wheat in Argentina. During 2004, typical symptoms of foliar blackleg disease were observed on canola plants in commercial and experimental fields in southern Buenos Aires Province. Average disease incidence was 32% on 2- to 4-month-old plants of canola cvs. Impulse, Master, Mistral, and Teddy. The range of incidence on these cultivars was 21 to 43%. Foliar symptoms were randomly distributed at seedling, rosette, and flowering stages. Symptoms included necrosis and chlorosis of the affected leaf tissue and defoliation. Foliar leaf spots were circular to irregularly oval, 5 to 12 mm in diameter, pale brown in the center, and grayish green at the margin. Small, black pycnidia formed in the center of the adaxial surface of diseased foliage. Under favorable temperature and moisture conditions, lesions enlarged and coalesced. Older lesions appeared chlorotic and desiccated with shredded tissue at the center. A severe defoliation of the lower leaves was observed. As the disease developed, basal stem cankers formed on these plants, although disease incidence in this phase was low. Pieces (0.5 cm long) were taken from leaves and stems of diseased plants, dipped in 70% ethanol, surface sterilized with NaOCl (1%) for 2 min, and rinsed in sterile water. Each segment was blotted dry and placed on potato dextrose agar (PDA). Plates were incubated in the dark at 26°C for 4 days, and then plates were incubated under 12 h of NUV light and 12-h dark for 7 days. Four fungal isolates were obtained. The fungi were examined microscopically and confirmed as Phoma lingam (Tode:Fr.) Desmaz. (Leptosphaeria maculans (Desmaz.) Ces. & De Not) (3,4). P. lingam was the only fungus isolated from the infected tissue. The teleomorph stage was not observed. Koch's postulates were completed for two isolates by spray-inoculating foliage of 3-week-old canola plants of cvs. Impulse, Master, Mistral, and Teddy with a conidial suspension (1 × 106 conidia per ml). The experiment, which included four inoculated plants per isolate and two noninoculated control plants for each cultivar, was performed in a greenhouse at 22 to 24°C and maintained at 75% relative humidity with no supplemental light. Inoculated and control plants were covered with polyethylene bags for 48 h after inoculation. Plants developed small, pale brown lesions on leaves within 11 days for both isolates, and the pathogen was reisolated. Control plants, inoculated only with sterile distilled water, remained symptomless. The experiment was repeated once with similar results. Blackleg is the most important fungal disease affecting canola with a worldwide distribution (1,2). In 1995, the disease was first observed on canola in Argentina in northern Buenos Aires Province, but only in experimental field plots with a low disease incidence. Since that time, it has not been found in other areas where canola is produced. The results emphasize the importance of this pathogen in Argentina, since at the current time most commercial cultivars were susceptible to P. lingam. To our knowledge, this is the first report of an outbreak of P. lingam infection in commercial crops in the main canola-production region in Argentina.

First Report of a Leaf Spot and Stem Canker Caused by Myrothecium roridum on Watermelon in the United States.

Myrothecium roridum Tode:Fr, pathogenic to a number of cucurbit species, causes fruit rots, cankers on crowns and stems, and leaf spots. Hosts include cantaloupe and honeydew (Cucurbita melo) and cucumber (Cucumis sativus) (1,3). In June 2004, following a period of heavy rainfall, numerous round-to-oblong, brown lesions with concentric rings were observed on leaves of watermelon (Citrullus lanatus) cv. Desert King at the Blackshank Farm in Tifton, GA. Disease was localized in the field and severity was low (<5% of leaf area affected). No symptoms were observed on fruit. Sections of tissue were removed from the margin between healthy and diseased tissue and plated on acidified, 25% potato dextrose agar (aPDA). A small plug of agar and mycelium were removed from colonies that emerged from lesions and were transferred to aPDA. Isolated colonies were characterized by a white, floccose mycelium with concentric, dark green-to-black rings of sporodochia bearing viscid masses of conidia. Conidia were cylindrical with rounded ends and measured 6 to 8 × 1.5 to 2.5 μm. The features of the fungus were consistent with the description of Myrothecium roridum (1,2). Pathogenicity tests were conducted in a temperature-controlled greenhouse. Twenty-five watermelon plants (cv. Desert King) were inoculated with a conidial suspension of M. roridum (5 × 105 conidia per ml) plus 0.1% vol/vol Tween 20. Inoculum was applied on leaves and stems until runoff with a hand-held mister, and plants were placed in a dew chamber for 72 h. Ten plants were sprayed with sterile, distilled water to serve as controls. Inoculated and noninoculated control plants were removed from the dew chamber and maintained at 25 to 28°C. Symptoms appeared 8 days after inoculation and were characterized by round, dark lesions with concentric rings; noninoculated plants were symptomless. Sections of symptomatic tissue were plated, and M. roridum was reisolated. Although M. roridum is a common pathogen of melons and cucumber, to our knowledge, this is the first field report of a leaf spot caused by M. roridum on watermelon in the United States. No further occurrences of the disease on watermelon have been observed in Georgia since the initial discovery of M. roridum in 2004; however, losses could be potentially severe if widespread infection of fruit were to occur.

First Report of Gray Leaf Spot Caused by Alternaria brassicae on Canola in Argentina

Canola (Brassica napus) is a developing oleaginous crop grown commercially in Argentina. During 2003, typical symptoms of a foliar disease were observed on canola plants in experimental field plots in Buenos Aires. Average disease incidence across 14 6-month-old canola cultivars was 27% (range 12 to 42%). Climatic conditions in Buenos Aires during August 2003 included moderate temperatures and periods with high humidity, which were apparently favorable for disease development. Symptoms were observed on leaves, stems, and pods. Leaf symptoms were randomly distributed on the adaxial surfaces and consisted of zonate lesions of alternating light gray and dark brown areas that were 6 to 10 mm in diameter. Remaining leaf tissue was chlorotic and affected leaves abscised. Stem infections appeared as irregular and elongated black lesions, 0.7 to 1.2 cm long. Pods lesions were circular, 6 to 8 mm in diameter, gray in the center, and surrounded by a diffuse dark brown margin. The disease developed progressively from the lower leaves to the pods, resulting in premature senescence of the tissues, chlorosis, and defoliation. Conidiophores bearing conidia colonized the lesions as a dark gray growth of spore masses. Segments (0.5 cm long) taken from leaves, stems, and pods of diseased plants were dipped in 70% ethanol, surface sterilized with NaOCl (1%) for 2 min, and rinsed in sterile water. Each segment was blotted dry and placed on potato dextrose agar. Plates were incubated in the dark at 25°C for 2 to 3 days, followed by incubation under NUV light and a 12-h light/dark photoperiod for 6 to 8 days. Six fungal isolates were obtained. Fungal colonies were pale gray with dark concentric rings. Conidia were yellow to pale brown, ellipsoid to ovoid, produced singly or in short chains, with 8 to 10 transverse septa and 2 to 6 longitudinal septa. The spore body measured 13 to 22 × 68 to 135 µm with a beak cell 42 to 101 µm long. On the basis of conidial and cultural characteristics, the fungus was identified as Alternaria brassicae (Berk.) Sacc (1). Koch's postulates were completed for three isolates by spray-inoculating foliage of 6-week-old canola plants of cvs. Caviar, Dunkeld, Eclipse, Impulse, Mistral, and Sponsor with a conidial suspension (1 × 105 conidia per ml). The experiment, which included four inoculated plants and two noninoculated control plants for each cultivar per isolate, was conducted in the greenhouse at 22 to 24°C and maintained at 75% relative humidity with no supplemental light. Inoculated and control plants were covered with polyethylene bags for 48 h after inoculation. Within 12 days, inoculated plants developed small, brown lesions on leaves and stems for all three isolates; the pathogen was successfully reisolated in all instances. Control plants, inoculated only with sterile distilled water, remained symptomless. The experiment was repeated with similar results. The results suggest that A. brassicae may be a threat to the main cultivars being grown in Argentina. To our knowledge, this is the first report of A. brassicae causing gray leaf spot of canola in Argentina. Reference: (1) J. Joly. Le genre Alternaria. Recherches Physiologiques, Biologiques, et Systématiques. Paul Lechevalier, ed. Paris, France, 1964.

Host and non‐host pathogens elicit different jasmonate/ethylene responses in Arabidopsis

Arabidopsis does not support the growth and asexual reproduction of the barley pathogen, Blumeria graminis f. sp. hordei Bgh). A majority of germlings fail to penetrate the epidermal cell wall and papillae. To gain additional insight into this interaction, we determined whether the salicylic acid (SA) or jasmonate (JA)/ethylene (ET) defence pathways played a role in blocking barley powdery mildew infections. Only the eds1 mutant and NahG transgenics supported a modest increase in penetration success by the barley powdery mildew. We also compared the global gene expression patterns of Arabidopsis inoculated with the non-host barley powdery mildew to those inoculated with a virulent, host powdery mildew, Erysiphe cichoracearum. Genes repressed by inoculations with non-host and host powdery mildews relative to non-inoculated control plants accounted for two-thirds of the differentially expressed genes. A majority of these genes encoded components of photosynthesis and general metabolism. Consistent with this observation, Arabidopsis growth was inhibited following inoculation with Bgh, suggesting a shift in resource allocation from growth to defence. A number of defence-associated genes were induced during both interactions. These genes likely are components of basal defence responses, which do not effectively block host powdery mildew infections. In addition, genes encoding defensins, anti-microbial peptides whose expression is under the control of the JA/ET signalling pathway, were induced exclusively by non-host pathogens. Ectopic activation of JA/ET signalling protected Arabidopsis against two biotrophic host pathogens. Taken together, these data suggest that biotrophic host pathogens must either suppress or fail to elicit the JA/ET signal transduction pathway.

First Report of Powdery Mildew Caused by Erysiphe heraclei on Chervil in California.

Chervil (Anthriscus cerefolium) is a culinary herb in the Apiaceae family that is grown commercially in California. In 2003 and 2004, shade house plantings of chervil in central coastal California exhibited symptoms and signs of a powdery mildew disease. White, epiphytic mycelia and conidia were present on petioles and leaves. Severely affected leaflets became slightly twisted and bent. Mycelium was amphigenous and effused or in patches. Hyphae measured 5.0 to 7.5 μm in diameter and had lobed appressoria. Conidiophores were straight and had cylindric foot cells measuring 25.0 to 37.5 × 7.5 to 10.0 μm, followed by a longer cell and one to two shorter cells. Conidia formed singly, were cylindric, and measured (37.5-) 40.0 to 50.0 (-52.5) × 15.0 to 17.5 μm. Conidia lacked fibrosin bodies and germinated at the ends with either a very short or a long germ tube forming a lobed appressorium (Polygoni type). No cleistothecia were observed. On the basis of these characteristics, the fungus was identified as Erysiphe heraclei (1). To confirm pathogenicity, severely colonized chervil leaves from a commercial nursery were gently pressed onto leaves of potted chervil plants. Plants were then maintained in a greenhouse (22 to 24°C). After 10 to 12 days, signs of powdery mildew developed on the foliage of inoculated plants, and the pathogen morphology matched that of the originally observed pathogen. Noninoculated control plants did not develop powdery mildew. To investigate the host range of this chervil isolate, parsley (Petroselinum crispum) and celery (Apium graveolens) plants were inoculated in the same way as described. However, after more than 3 weeks, no powdery mildew developed on these two Apiaceae plants. Control chervil plants again developed the disease. To our knowledge, this is the first report of powdery mildew of chervil caused by E. heraclei in California. Disease impact was severe, and in some cases, chervil crops were not harvested. The inability of the chervil isolate to infect two other Apiaceae plants that are listed as hosts of E. heraclei indicates that this pathogen may consist of strains having different host ranges. Reference: (1) U. Braun. Nova Hedwigia 89:1, 1987.

First Report of Canola Powdery Mildew Caused by Erysiphe polygoni in Argentina.

Canola (Brassica napus) is a developing oleaginous crop grown commercially in the Buenos Aires and Santa Fe provinces of Argentina. During the autumn of 2003, typical signs of powdery mildew were observed on canola plants in experimental field plots in Buenos Aires. Average disease incidence was 42% on 3- to 6-month-old canola cultivars developed in the following countries: Argentina (Eclipse, Impulse Master, Mistral, and Nolza); Australia (Oscar and Rainbow); Canada (Sentry); France (Cadillac, Camberra, and Capitol); and Sweden (Maskot, Sponsor, and Wildcat). The range of incidence on these cultivars was 35 to 93%. Other cultivars exhibited an apparent high level of resistance or escaped disease. These included: Charlton (Argentina); 46CO3, Dunkeld, Insignia, Mystic, Monty, Outback, Rivette, and Surpass 400 (Australia), and Caviar (France). Climatic conditions in Buenos Aires, especially rainfall, from March to May 2003 were apparently favorable for powdery mildew development. On susceptible cultivars, fungal growth was observed on leaves, stems, and pods that resulted in premature senescence of the tissues. The mycelium, with multilobed hausthoria, was white to gray, dense or fine, and in patches or covering the entire adaxial leaf surfaces. Appressoria were lobed and conidiophores were straight. Foot cells were cylindrical, straight, measured 35 to 42 × 7 to 10 μm, and were followed by two cells. Conidia were produced singly, cylindrical to ovoid, and measured 36 to 40 × 18 to 20 μm. The conidial length-to-width ratio was 2.0. No fibrosin bodies were observed in the conidia and conidia germinated at the ends. Cleistothecia were not observed. On the basis of mycelial, conidial, and hausthoria characteristics observed on six leaves for each affected cultivar, the fungus was identified as Erysiphe polygoni DC (1). Pathogenicity was confirmed on 5-week-old canola plants of cvs. Eclipse, Impulse, Master, Mistral, and Maskot by gently pressing (1 min) one adaxial infected leaf with abundant sporulation onto one adaxial healthy leaf. The experiment, which included five inoculated plants and three noninoculated control plants for each cultivar, was conducted in a greenhouse at 22 to 24°C and maintained at 75% relative humidity with no supplemental light. Inoculated and control plants were covered with polyethylene bags for 48 h after inoculation. Powdery mildew developed on all inoculated plants of all cultivars after 12 to14 days. The control plants did not develop disease. The experiment was repeated with similar results. E. polygoni has a worldwide distribution (2); however, the results suggest that this fungus may be a threat to the main cultivars being grown in Argentina (Eclipse, Impulse, Master, Mistral, and Nolza), since high levels of disease incidence, as much as 70%, were observed. Under propitious environments, this pathogen could cause severe yield losses in commercially grown canola in Argentina. To our knowledge, this is the first report of canola powdery mildew caused by E. polygoni in Argentina.

First Report of Strawberry latent ringspot virus in Strawberry in the United States and Canada.

Strawberries in southern California have shown decline symptoms during the last 2 years. More than 70% of plants tested in California were infected with two newly identified criniviruses that infect strawberry (Strawberry pallidosis and Beet pseudo-yellows). Strawberry cultivars are usually symptomless when infected with one virus, and testing for other strawberry viruses is performed to identify any other viruses that may be involved in the symptomatology. Primers SLRSV F (5' CCTCTCCAACC-TGCTAGACT 3') and SLRSV R (5' AAGCGCATGAAGGTGTAACT 3') that amplify a 497-bp fragment of RNA 2 of Strawberry latent ringspot virus (SLRSV) were developed and utilized for reverse transcription-polymerase chain reaction (RT-PCR) detection. SLRSV belongs to the family Sequiviridae and is transmitted by nematodes of the genus Xiphinema. The virus has a broad host range (4) and is usually symptomless in strawberries. Strawberry plants from commercial fields in California, Oregon, Washington, and British Columbia, Canada were tested. SLRSV was identified in 17% of plants tested from California and 4% of plants tested from British Columbia, while all samples from Oregon and Washington tested negative. The fragment amplified (GenBank Accession No. AY461735, isolate from British Columbia, Canada) shares 84% nucleotide and 94% amino acid sequence identity with the previously published sequence of SLRSV from strawberry (GenBank Accession No. X77466) (3). The virus was transmitted mechanically from strawberry samples from Canada to Chenopodium quinoa, and the infected C. quinoa plants tested positive for SLRSV with RT-PCR, while no amplicons were obtained from noninoculated control plants. To our knowledge, this is the first report of SLRSV in strawberry in North America, although it has been previously reported in a single cherry tree in Ontario, Canada (1) and in an imported seed lot of parsley in California (2). The number of plants that tested positive as well as the geographic distribution of the virus indicates that the virus is widespread in California, but further testing is needed to identify its distribution in other states.

Efeitos da inoculação micorrízica e da adubação fosfatada em mudas de Vochysia maxima Ducke

Para verificar os efeitos da inoculação micorrízica e da adubação fosfatada em mudas de Vochysia maxima (quaruba), foi realizado um experimento em casa de vegetação. Testaram-se nove espécies de fungos micorrízicos arbusculares (FMAs): Gigaspora sp., Acaulospora appendicula, Scutellospora heterogama, Acaulospora sp., Scutellospora sp., Gigaspora margarita, Glomus mosseae, Scutellospora gilmorei e Entrophospora colombiana. A inoculação foi feita pela deposição de solos inóculos de FMAs debaixo da radícula das plântulas, durante a repicagem para copos de plástico de 200 ml, contendo Latossolo Amarelo álico fumigado e não-fumigado. Três meses depois, as mudas foram transferidas para vasos de plástico, contendo 2 kg do mesmo solo, com ou sem a incorporação de fósforo (90 mg/dm³ de solo), na forma de superfosfato simples. O estado nutricional e o crescimento das plantas foram avaliados 12 meses depois da inoculação. As mudas desenvolveram pouco sem aplicação de fósforo, tanto no solo fumigado quanto no solo não-fumigado, mesmo inoculando fungos micorrízicos. Com a aplicação de fósforo, um aumento de 76% em produção de matéria seca foi obtido com a inoculação de Glomus mosseae e Gigaspora sp. no solo fumigado e não-fumigado, respectivamente. Essas duas espécies promoveram também a maior quantidade acumulada de fósforo na parte aérea da planta, sendo 71% pelo Glomus mosseae no solo fumigado e 96% pelo Gigaspora sp. no solo não-fumigado, em relação às mudas não-inoculadas, evidenciando alta exigência de quaruba em fósforo. A inoculação e a adubação fosfatada beneficiaram o crescimento e a absorção de P das plantas, mesmo no solo não-fumigado.

Greenhouse Cucumber Cultivars Differ in Susceptibility to Fusarium Root and Stem Rot

Eighteen cucumber (Cucumis sativus L.) cultivars (long English type) were screened for their susceptibility to fusarium root and stem rot caused by Fusarium oxysporum Schlechtend.: Fr. f.sp. radicis-cucumerinum D.J. Vakalounakis using seedlings at the third true-leaf stage. Roots were trimmed and dipped into a spore suspension (105 spores/mL) of the pathogen and the plants were re-potted. A disease severity index (DSI) was used to assess disease responses 4 or 8 weeks later based on plant mortality and the height of surviving plants compared to the noninoculated controls. `Sienna', `Amazing' and `Dominica' were most susceptible to infection and the resulting DSI values were significantly (P ≤ 0.05) higher compared to noninoculated control plants. The cultivars `Korinda', `Euphoria' and `Aviance' displayed significantly lower DSI values which were not significantly different from noninoculated control plants. The remaining 12 cultivars displayed DSI values which were intermediate between the above two classes of responses. The results from this study indicate there is the potential to identify and develop cultivars and breeding lines of greenhouse cucumbers with enhanced resistance to fusarium root and stem rot.