Noninvasive Testing Methods Research Articles

The Role of Volatile Organic Compounds (VOCs) in Determining Seed Physiological Quality: A Review

Volatile organic compounds (VOCs) emitted by seeds serve as promising biomarkers for assessing seed vigor, viability, and deterioration during storage. This review synthesizes current knowledge on the types and chemical classes of VOCs released by seeds, factors affecting their emission, and methods for their collection and analysis. VOCs indicate seed aging, with increased emissions of alcohols, aldehydes, and ketones associated with deterioration processes like lipid peroxidation. Volatile organic compounds (VOCs) associated with seed deterioration include alcohols like ethanol, which can indicate fermentation, aldehydes such as hexanal, which is linked to lipid oxidation, and ketones like 2-heptanone, which can result from microbial activity and contribute to off-flavors and rancidity. The quantity and composition of VOCs correlate with the extent of seed deterioration, potentially offering a rapid, non-destructive alternative to traditional germination tests for evaluating seed quality. VOCs also mediate interactions between seeds and microorganisms, influencing germination and stress responses. Different research findings regarding volatile organic compounds (VOCs) in seeds indicate their potential as indicators of seed quality, which could lead to improved seed management strategies. By utilizing VOC profiling, farmers can make informed decisions on seed selection and treatment, ultimately enhancing crop yield and resilience in agricultural practices. While VOC analysis shows promise for integration into seed quality testing, challenges remain in standardizing protocols and identifying robust markers across different seed types, species and storage conditions. Advances in VOC research may ultimately lead to novel solutions for improving seed and crop productivity. Future research directions in VOC analysis for seed quality testing should focus on standardizing VOC profiles across diverse seed species, integrating VOC analysis with precision agriculture technologies, exploring environmental influences on VOC emissions, developing non-invasive testing methods, conducting longitudinal studies on seed storage, applying VOCs in breeding programs, and establishing links between VOC emissions and disease resistance.

Completeness of revascularization by FFRCT in stable angina: Association to adverse cardiovascular outcomes

BackgroundThe prognostic impact of complete coronary revascularization relative to non-invasive testing methods is unknown. ObjectivesTo assess the association between completeness of revascularization defined by CTA-derived fractional flow reserve (FFRCT) and cardiovascular outcomes in patients with stable angina. MethodsMulticenter 3-year follow-up study of patients with new onset stable angina and ≥ 30% stenosis by CTA. The lesion-specific FFRCT value (two cm-distal-to-stenosis) was registered in all vessels with stenosis and considered abnormal when ≤ 0.80. Patients with FFRCT ≤ 0.80 were categorized as: Completely revascularized (CR-FFRCT), all vessels with FFRCT ≤ 0.80 revascularized; incompletely revascularized (IR-FFRCT), ≥ 1 vessels with FFRCT ≤ 0.80 non-revascularized. Early revascularization (< 90 days from index CTA) categorized vessels as revascularized. The primary endpoint comprised cardiovascular death and non-fatal myocardial infarction; the secondary endpoint vessel-specific late revascularization and non-fatal myocardial infarction. ResultsAmongst 900 patients and 1759 vessels, FFRCT was ≤ 0.80 in 377 (42%) patients, 536 (30%) vessels; revascularization was performed in 244 (27%) patients, 340 (19%) vessels. Risk of the primary endpoint was higher for IR-FFRCT (15/210 [7.1%]) compared to CR-FFRCT (4/167 [2.4%]), RR: 2.98; 95% CI: 1.01–8.8, p ​= ​0.036, and to normal FFRCT (3/523 [0.6%]), RR: 12.45; 95% CI: 3.6–42.6, p ​< ​0.001. Incidence of the secondary endpoint was higher in non-revascularized vessels with FFRCT ≤ 0.80 (29/250 [12%]) compared to revascularized vessels with FFRCT ≤ 0.80 (5/286 [1.7%]), p ​= ​0.001, and to vessels with FFRCT > 0.80 (10/1223 [0.8%]), p ​< ​0.001. ConclusionIncomplete revascularization of patients with lesion-specific FFRCT ≤ 0.80 is associated to unfavorable cardiovascular outcomes compared to those with complete revascularization or FFRCT > 0.80.

P-565 Moving towards non – invasive euploid blastocyst prediction. Retrospective euploid blastocyst evaluation using different morphokinetics and Artificial Intelligence (AI) models

Abstract Study question Could Preimplantation Genetic Testing for Aneuploidies be replaced by an Aritificial Intelligence model which evaluates blastocysts and selects the most suitable ones for embryo transfer? Summary answer The use of AI for euploidy prediction has not been validated in a large scale and thus it should not be used to replace PGT-A. What is known already PGT-A is an invasive method that may affects blastocysts implantation potential. Both the biopsy protocol and the experience of the embryologist who performs the biopsy can influence the outcome. Efforts are made to develop non-invasive methods for PGT. Many AI systems have been developed in assisted reproduction.Time- Lapse systems have a specialized AI software, that assist in the evaluation of the embryos and the selection of the most suitable ones based on their morphokinetic characteristics. Other AI systems, such as ERICA, evaluate embryos and provide a measure of their euploidy, serving as an alternative method for non-invasive preimplantation genetic testing. Study design, size, duration The retrospective study was conducted between January 2018 and December 2020. A total of 585 blastocysts, derived from 144 women who had undergone an IVF – PGT-A cycle, were included. The embryos were cultured in a TL incubator and evaluated using KID Score D5 (Vitrolife), iDa Score (Vitrolife) and ERICA (ERICA). Participants/materials, setting, methods The study was conducted in a private IVF clinic. Embryos from women with an average age of 38 years who had a history of recurrent miscarriages and/or &amp;gt;3 failed IVF cycles were included. Biopsy was performed in all blastocysts that were cultured in TL incubators up to day 5-6. Statistical and logistic regression analysis were conducted to assess the comparison between the score of the three AI programs and the result of the biopsy. Main results and the role of chance ERICA seems uncapable to separate euploid from aneuploid embryos. T-test showed that there is no statistically significant difference between the two categories (mean_difference=0,02, p = 0,3&amp;gt;0,001), while the effect size (clinical value) of the difference was very low (0,085). This means that this program cannot replace PGT-A. According to the iDA Score, although there is a difference in scores between euploid and aneuploid embryos, their difference, according to t-test, is not statistically significant [t(581)=2,56, p = 0,01&amp;gt;0,001], while the effect size is low (0,217). According to KID Score D5, there is a statistically significant difference in scores between euploid and aneuploid embryos [t(514)=4,4, p &amp;lt; 0,001], which shows that this program could replace PGT-A in some cases. However, the effect size of the difference (0,37), as well as the determination coefficients are quite low. Finally, the KID Score D5 succeeds in discovering aneuploid embryos in a higher percentage than euploid ones. Limitations, reasons for caution Women under the age of 35 were not included in the study. Permission from the National Greek Authority of Medical Assisted Reproduction was needed from every patient to undergo PGT-A. The size of the sample might limit the conclusions. A larger study would help verify the results of the study. Wider implications of the findings AI models can be used as good indicators for embryo selection/prioritization and predict the euploid status of the embryos. Non-invasive euploid prediction models could be a very useful tool for embryologists especially in countries where law restrictions are strict against the cohort of patients that are interested in PGT-A cycles. Trial registration number Not Applicable

P.153 Utility of neurophysiology in the diagnosis of tethered cord syndrome (TCS)

Background: Tethered cord syndrome, a condition in which the spinal cord stretches as a child grows, can cause various clinical symptoms. Occult TCS (OTCS) is a condition where a child displays some or many clinical symptoms of TCS, but no radiographic abnormality confirms the presence of a tethered cord (1-4). Diagnosis of OTCS in children is invasive and multi-factorial. The current diagnostic approach involves three main factors- clinical signs and symptoms, radiographic evidence, and motor evoked potentials (MEPs) tested under general anesthesia. Transcranial magnetic stimulation (TMS) is a non-invasive testing method for OTCS. It can replace MEPs, which are conducted under general anesthesia. Methods: We will conduct a case-control series of children at our center who have undergone TMS. We will characterize the children who have TCS and suspected OTCS and detail the children’s current diagnosis methods and outcomes in a technical note. We will then compare their pre-operative and post-operative data. Results: So far, we have conducted TMS on 10 children to help diagnose occult TCS. Conclusions: This approach is a novel and effective way to improve the accuracy of diagnosis in children, potentially preventing unnecessary surgery, or detecting patients who would otherwise suffer from the condition.

Microvascular Evaluation Diabetic Foot Patients with Near Infrared Spectroscopy

Peripheral Arterial Disease (PAP) requires good evaluation to reduce amputation rate. The aim of this study is to assess non-invasive detection methods in evaluating microvascular conditions in PAP. The potential use of Near Infrared Spectroscopy (NIRS) in identifying disorders in patients with PAP, either with or without DM, was also assessed. A systematic literature search was conducted through PUBMED until October 2023. Based on the literature review, it can be concluded that the use of NIRS in evaluating microvascular status in PAP is a non-invasive testing method that has expanded its role. Evaluation with NIRS provides metrics such as recovery time, deoxygenation, oxygen consumption (VO2), tissue oxygen saturation (StO2), total haemoglobin (HbT), and oxyhemoglobin area under the curve (O2 HbAUC). NIRS also has the potential to assist multidisciplinary teams in treating high-risk patients, especially in diabetic patients whose symptoms are compensated by peripheral neuropathy. This study shows that NIRS can be used as a useful tool in evaluating microvascular status in PAP, by providing important information that can be used to optimise patient care and prevent more serious complications. It is concluded that NIRS can be used as a tool to evaluate the effectiveness of treatment and prevent worsening of the condition of patients with PAP in diabetic foot.

The usefulness of shear wave elastography in evaluating erectile dysfunction severity before and after prostaglandin E1 test.

Prostaglandin E1 intracavernous injection test is an established method for diagnosing erectile dysfunction. However, the evaluation is non-objective and often influenced by the evaluator's subjectivity. Herein, we measured and objectively evaluated shear wave elastography results of the corpus cavernosum before and after injection in 16 patients who underwent prostaglandin E1 testing. The response score of prostaglandin E1 tests were "1" in 2 cases, "2" in 2 cases, and "3" in 12 cases. The average transmission velocity before the injection and at the time of maximum erection after the injection were 2.21 m/s and 1.57 m/s, respectively. Transmission velocity decreased during erection in 14 of 16 cases (87.5%). The overall rate of change in transmission velocity due to injection was -26.7% and was significantly different between the poor (responses 1 and 2: -16.1%) and good erection (response 3: -30.2%) groups. To the best of our knowledge, this is the first attempt to evaluate erectile phenomenon using percutaneous ultrasonic elastography in Japan. Rate of change in shear wave transmission velocity due to prostaglandin E1 injection in the corpus cavernosum penis was associated with the degree of erection. Therefore, the rate of change in shear wave transmission velocity in the corpus cavernosum penis could be used as an objective index of erectile phenomenon. Percutaneous ultrasonic elastography is a non-invasive and useful test method for diagnosing erectile dysfunction, determining the therapeutic effect, and predicting prognosis.

Роль корекції ендотеліальної дисфункції в комплексній профілактиці гіпертензивних ускладнень вагітності

Purpose - to study the effect of correction of endothelial dysfunction by the introduction of L-arginine in the comprehensive prevention of the development of severe hypertensive disorders in pregnant women. Materials and methods. The division into groups was carried out indiscriminately following the prescribed bath. 27 women reached the 1st group, who, in addition to basic prevention of preeclampsia (small doses of aspirin for 12 days, calcium supplement 1000 mg per dose for 16 years), took Tivortin until conception and p. It's an hour of urgency; up to the 2nd group - 54 women who did not receive basic prevention of preeclampsia. The control group (3) consisted of 16 healthy women with physiological changes in vagusity. Participants of the 1st group, during the hour of stay in the hospital, took L-arginine internally (iv) (4 g) + 2 teaspoons 2 times (4 g) per os per dose 40 minutes before admission, then 3 teaspoons spoons 2 times (6 g per dose). The average intensity of the droplets became 6. The function of the endothelium was evaluated according to the universally recognized non-invasive cuff test method, which is based on the principle of ultrasound assessment of the change in the diameter of the brachial artery in response to the restoration of blood flow in it after short-term compression of the upper limb with a cuff. Physical condition and endurance were assessed using the generally accepted 6-minute walk method. The quality of life in pregnant women who had experienced severe preeclampsia in the past was assessed in stages - according to the health-related quality of life (HRQoL) scale and the scale created by the World Health Organization (WHOQOL-BREF). Results. Arterial hypertension and preeclampsia are based on changes in endothelium-dependent vasodilatation. A positive effect on the function of the endothelium significantly improves indicators of physical well-being and quality of life. When conducting a test with a 6-minute walk in the Group 1, better indicators were found than in the Group 2 (respectively, 409±23 m vs. 381±32 m, p&lt;0.05), this indicator in the control group was 473±32 m (p&lt;0.05 according to the Groups 1 and 2). However, this indicator significantly improved in pregnant women of the Group 1 after intravenous administration of L-arginine: 441±12 m (p&lt;0.05 compared to the indicator before intravenous administration). According to the assessment of the quality of life of pregnant women of the studied groups, it should be noted that the quality of life indicators in all domains are significantly lower in women of the Group 1, which is associated with significantly worse anamnesis data of such women, significant concern about the results of the next pregnancy. When evaluating indicators of endothelium-dependent and endothelium-independent vasodilatation, it was found that in the group of women who received L-arginine preconceptionally, in the 1st trimester, the indicator before intravenous IV administration was 5.09±0.44, and after - 8.21±0.24, which indicates a significant improvement in endothelium-dependent vasodilation indicators (by 49.1%) 28-32 weeks, there are also no births of children with a body weight of less than 1500 g. Conclusions. In the group of high-risk pregnant women, the use of L-arginine in the complex prevention of preeclampsia allows to reduce the risks of early severe preeclampsia, to reduce the medication burden of two- and three-component hypotensive therapy. An increase in physical endurance, quality of life, and improvement in pregnancy outcomes are due to a positive effect on the function of the endothelium through the optimization of endothelium-dependent vasodilatation associated with the provision of the L-arginine substrate for the full synthesis of nitric oxide. The research was carried out in accordance with the principles of the Helsinki Declaration. The study protocol was approved by the Local Ethics Committee of the participating institution. The informed consent of the patient was obtained for conducting the studies. No conflict of interests was declared by the authors.

Exploring salivary lipid profile changes in COVID-19 patients: Insights from mass spectrometry analysis

The most common COVID-19 testing relies on the use of nasopharyngeal swabs. However, this sampling step is very uncomfortable and is one of the biggest challenges regarding population testing. In the present study, the use of saliva as an alternative sample for COVID-19 diagnosis was investigated. Therefore, high-resolution mass spectrometry analysis and chemometric approaches were applied to salivary lipid extracts. Two data organizations were used: classical MS data and pseudo-MS image datasets. The latter transformed MS data into pseudo-images, simplifying data interpretation. Classification models achieved high accuracy, with pseudo-MS image data performing exceptionally well. PLS-DA with OPSDA successfully separated COVID-19 and healthy groups, serving as a potential diagnostic tool. The most important lipids for COVID-19 classification were elucidated and include sphingolipids, ceramides, phospholipids, and glycerolipids. These lipids play a crucial role in viral replication and the inflammatory response. While pseudo-MS image data excelled in classification, it lacked the ability to annotate important variables, which was performed using classical MS data. These findings have the potential to improve clinical diagnosis using rapid, non-invasive testing methods and accurate high-volume results.

The Suitability of Stool Antigen Testing in the Detection of Helicobacter pylori in a Regional and Rural Area of Australia

Background. Helicobacter pylori is considered the most widespread bacterial pathogen worldwide. Successful eradication protocols are well established, highlighting the importance of appropriate infection detection. Noninvasive testing (NIT) methods are commonly used to detect infection, with test selection dependent on access and previous infection. This study examined trends in NIT by age group and test selection for eradication screening as well as examining H. pylori area prevalence by socioeconomic status (SES) in the Illawarra Shoalhaven and surrounding region. Materials and Methods. This retrospective cohort quantitative study is based on 20,998 NIT including stool antigen test (SAT), urea breath test (UBT), or H. pylori serology via Southern.IML Pathology between 2018 and 2020. Test percentage positives per and total test percentages within age groups were calculated for each NIT. Positive sample postcode data was assigned to socioeconomic percentiles. Total test utilisation and prevalence were calculated and depicted as geospatial representations. Results. Overall: 58.5% UBT, 31% serology, and 10.5% SAT were performed, with 14.7% positive for any NIT. Highest percent positive age group: SAT 80-89yo (18.6%), UBT 0-9yo (20.8%), and serology 90–99yo (32.6%). Test majority per age group: SAT 0-9yo (67.4%), UBT 10-89yo (59.4%), and serology 90-99yo (48.3%). A trend was seen between increasing infection prevalence and increasing socioeconomic disadvantage ( p = 0.161 , R 2 = 0.0361 ). Prevalence rates visually correlated with total test utilisation. Conclusions. SAT was underutilised compared to UBT or serology. Serology was inappropriately used in older age groups, and the result validity was questioned following confirmed infection. SAT is a viable alternative for use in these settings. No significant correlation was seen between lower SES areas and higher H. pylori infection prevalence, but low-test utilisation suggests likely prevalence underestimation within the studied area and may indicate reduced accessibility to healthcare.

RESEARCH ON THE DETECTION OF HELICOBACTER PYLORI IN SALIVA OF GASTRITIS AND DUODENITIS PATIENTS BY REAL-TIME PCR TECHNIQUE

Background: Helicobacter pylori plays an important role in the etiology and pathogenesis of gastritis and duodenitis. There are two groups of test methods to detect Helicobacter pylori infection: invasive methods and non-invasive methods. Testing for Helicobacter pylori in saliva by real-time PCR technique belongs to group of non-invasive test methods. Objectives: To determine the detection rate of Helicobacter pylori in saliva by real-time PCR technique in gastritis and duodenitis patients and to investigate some factors related to Helicobacter pylori infection detected in saliva using real-time PCR technique in gastritis and duodenitis. Materials and method: A cross-sectional descriptive study on 91 patients after convenient sampling was preliminarily diagnosed with gastritis and duodenitis with indications for endoscopy and biopsy. Biopsy specimens were used for urease and histopathology tests. Saliva is taken directly from the mouth after spitting into a dedicated bottle and conducting a real-time PCR test. Gene amplification will be performed with a PYLORI-PCR mix containing primers and for the expected target product of 203 base pairs length: 5' - AGCGCTCTCACTTCCATAGGC - 3' and 5' - TCTTCGGTTAAAAAAGCGAT - 3'. Install the program "Protocol" for the Real-time PCR machine to operate with the following cycles: 1 cycle: 950C for 5 minutes; 40 cycles: 950C for 15 seconds, 550C for 1 minute and 720C for 20 seconds. Results: The positive rate for Helicobacter pylori in saliva by realtime PCR technique, urease test and histopathology were 20.9%, 19.8% and 46.2% respectively. The detection rate of H. pylori by real-time PCR in saliva and the detection rate on urease test as well as histopathology had a statistically significant correlation. A few important factors related to Helicobacter pylori-positive patients in saliva as follows: personal history suffer from gastritis and duodenitis 40.7%, reflux esophagitis 67%, and congestive inflammation 75.8%. Conclusions: The rate of detecting Helicobacter pylori in saliva by real-time PCR technique in gastritis and duodenitis patients in Can Tho University of Medicine and Pharmacy Hospital is higher than urease test and lower than histopathology.

Thermoacoustic phased-array radiators – Theory, characteristics, and applications

Standard non-invasive acoustic non-destructive testing (NDT) methods like testing in contact or using immersion tank arrangements are limited since the probes need to be in direct contact with the test piece or using a fluid as coupling media. Air-coupled ultrasonic testing avoids these limitations and enables new testing methods. Two up-and-coming transducer technologies are recognized as promising: transducers using ferroelectrets and transmitters based on the thermoacoustic principle. Thermoacoustic radiators based on thin-film technology offer a resonant-free generation of ultrasound. The resonance-free operation enables the wideband generation of acoustics waves and promises advantages for existing NDT methods. Using specially shaped substrates and electrodes enables the fabrication of planar and focused thermoacoustic radiators. This contribution presents the latest results of our ongoing research regarding thermoacoustic radiators, which is the thermoacoustic phased-array. Phased-array transducers offer the on-the-fly change of the steering angle and the position of the focal point without moving or modifying the transducer itself. Combining both technologies, thermoacoustic emitter and the phasedarray principle broaden the spectrum of classical NDT applications and modern approaches like the excitation of guided waves or structural health monitoring. In detail, we modelled the sound field of a self-fabricated thermoacoustic phased-array radiator, characterised the emitter elementwise and tested several application scenarios (e.g., transmission, beam steering, focusing and the excitation of guided waves).

Correlation Between Smoking and Il-1 Level and Arterial Stiffness as Measured By Cavi in the Young Adult Population Without other Cardiovascular Risk Factors.

Background: Recent studies have shown that arterial stiffness is a strong predictor of cardiovascular events and all-cause mortality, with CAVI (Cardio-Ankle Vascular Index) as a non-invasive arterial stiffness testing method in daily practice. Objective: This study was conducted to examine the relationship between smoking -as a risk factor for arterial stiffness- and CAVI values, as well as levels of IL-1β (Interleukin 1β) as a cytokine that plays a role in the pathophysiology of arterial stiffness. Methods: Eighty-four participants, including smokers and non-smokers without other cardiovascular risk factors, were included in the study. Demographic data, medical history, and smoking behavior were taken using a questionnaire, then IL-1β and CAVI levels were examined Results: The mean level of IL-1β in smoking subjects was significantly higher (15.09 ± 0.48) than in non-smoking subjects (5.53 ± 0.79; p=0.001). CAVI values in smoking subjects were also significantly higher (8.0 ± 0.06) than in non-smoking subjects (6.9 ± 0.02; p=0.001). Further analysis showed a strong positive correlation between smoking and IL-1β levels (r=+0.776; p=0.001) and CAVI values (r=+0.759; p=0.001). Conclusion: This study shows that smoking significantly correlates with IL-1β levels and CAVI values. The greater number of cigarettes used per day and the longer duration of smoking, there was a positive correlation between IL-1β levels and arterial stiffness as measured by CAVI.

Non-destructive detection of disintegrant levels in compressed oral solid dosage forms

Quality issues related to compressed oral solid dosage (OSD) forms, such as tablets, arise during the design, development, and production stages, despite established processes and robust production tools. One of the primary quality concerns is the disintegration properties and drug release profile of immediate-release OSD products, which depend on their micro-texture and micro-viscoelastic properties at the grain level. These properties are influenced by the composition of the formulation, particularly the disintegrant level in the tablet matrix and the porosity of the matrix. In this study, a novel, rapid, non-destructive ultrasonic characterization technique was proposed to correlate the sensitivity of propagating elastic wave speeds, physical/mechanical properties, and the dispersion profile of the OSD material with the disintegrant level (% w/w) in the formulation and the compression force applied during tableting. The proposed characterization framework involves transmitting pressure (longitudinal) and shear (transverse) waves through the OSDs to calculate the speed of sound, which in turn provides information on the apparent Young's and shear moduli. In addition, the attenuation profile of the propagating wave is obtained through dispersion analysis. To investigate the impact of disintegrants and compression force on ultrasonic wave propagation in OSDs, we incorporated seven levels of a frequently used disintegrant. In each formulation, OSDs are compacted in five compaction forces. The sensitivity of wave speeds, physical/mechanical properties, and attenuation profile was observed with each disintegrant and compression force level. The utilization of ultrasonic techniques may present a viable solution for rapid, non-destructive, non-invasive, and cost-effective testing methods required in continuous manufacturing (CM) and real-time release testing (RTRT), and its practical utility in pharmaceutical manufacturing is also discussed.

Investigate the Possibility of Using Phosphorescence in Clinical Oncology as an Early Prognostic Test in Detecting Brain Carcinogenesis

Phosphorescence is considered one of the non-invasive glioblastoma testing methods based on studying molecular energy and the metabolism of L-tryptophan (Trp) through KP, which provides essential information on regulating immunity and neuronal function. This study aimed to conduct a feasibility study using phosphorescence in clinical oncology as an early prognostic test in detecting Glioblastoma. This study was conducted on 1039 patients who were operated on with follow-up between January 1, 2014, and December 1, 2022, and retrospectively evaluated in participating institutions in Ukraine (the Department of Oncology, Radiation Therapy, Oncosurgery, and Palliative Care at the Kharkiv National Medical University). Method of protein phosphorescence detection included two steps. During the first step, of luminol-dependent phosphorescence intensity in serum was carried out after its activation by the light source, according to the spectrofluorimeter method, as follows. At a temperature of 30 °C, serum drops were dried for 20 min to form a solid film. After that, we put the quartz plate with dried serum in a phosphoroscope of luminescent complex and measured the intensity. With the help of Max-Flux Diffraction Optic Parallel Beam Graded Multilayer Monochromator (Rigaku Americas Corporation) following spectral lines as 297, 313, 334, 365, 404, and 434 nm were distinguished and absorbed by serum film in the form of light quantum. The monochromator exit split width was 0.5 mm. Considering the limitations of each of the non-invasive tools currently available, phosphorescence-based diagnostic methods are ideally integrated into the NIGT platform: a non-invasive approach for visualizing a tumor and its main tumor characteristics in the spatial and temporal order. Because trp is present in virtually every cell in the body, these fluorescent and phosphorescent fingerprints can be used to detect cancer in many different organs. Using phosphorescence, it is possible to create predictive models for GBM in both primary and secondary diagnostics. This will assist clinicians in selecting the appropriate treatment option, monitoring treatment, and adapting to the era of patient-centered precision medicine.

Research progress on minimally invasive and non-invasive blood glucose detection methods

Blood glucose monitoring has become the weakest point in the overall management of diabetes in China. Long-term monitoring of blood glucose levels in diabetic patients has become an important means of controlling the development of diabetes and its complications, so that technological innovations in blood glucose testing methods have far-reaching implications for accurate blood glucose testing. This article discusses the basic principles of minimally invasive and non-invasive blood glucose testing assays, including urine glucose assays, tear assays, methods of extravasation of tissue fluid, and optical detection methods, etc., focuses on the advantages of minimally invasive and non-invasive blood glucose testing methods and the latest relevant results, and summarizes the current problems of various testing methods and prospects for future development trends.

A theoretical base for non-invasive prenatal paternity testing

There is an increasing demand for prenatal paternity testing in the forensic applications, which identify biological fathers before the birth of children. Currently, one of the most effective and safe Non-Invasive Prenatal Paternity Testing (NIPPT) methods is high-throughput Next-Generation Sequencing (NGS)-based SNP genotyping of cell-free DNA in maternal peripheral blood. To the best of our knowledge, nearly all methods being used in such applications are based on traditional postnatal paternity tests and/or statistical models of conventional polymorphism sites. These methods have shown unsatisfactory performance due to the uncertainty of fetal genotype. In this study, we propose a cutting-edge methodology called the Prenatal paternity Test Analysis System (PTAS) for cell-free fetal DNA-based NIPPT using NGS-based SNP genotyping. With the implementation of our proposed PTAS methodology, 63 out of 64 early-pregnancy (i.e., less than seven weeks) samples can be precisely identified to determine paternity, except for one sample that does not meet quality control requirements. Although the fetal fraction of the non-identified sample is extremely low (0.51%), its paternity can still be detected by our proposed PTAS methodology through unique molecular identifier tagging. Paternity of the total 313 samples for mid-to-late pregnancy (i.e., more than seven weeks) can be accurately identified. Extensive experiments indicate that our methodology makes a significant breakthrough in the NIPPT theory and will bring substantial benefits to forensic applications.

Gingival Crevicular Fluid-An Eos of Biomarkers

GCF is a serum transudate or inflammatory exudate that is derived from the periodontal tissues and can be collected at the orifice or from within the gingival crevice.(1) The potential diagnostic importance of gingival fluid was recognized more than 60 years ago and serious investigation of the dynamics of GCF production did not begin until the late 1950s with the reports of Brill and co-workers.(2,3) The fluid component of GCF derives primarily from microvascular leakage. Additions to the fluid volume are made from the intercellular fluid and cellular cytoplasm. The gingival tissue is constantly subjected to mechanical and bacterial aggregation.Resistance to these actions is provided by saliva, sulcular fluid, epithelial surface keratinisation and initial stages of inflammation.(4) The origin,composition and clinical significance of gingival crevicular fluid have significantly helped us in understanding the pathogenesis of periodontal disease.The need to find a non-invasive test method in periodontitis drew attention to the sulcus fluid that is produced in small quantities even in a completely healthy periodontium, and its composition is near similar to that of blood plasma.

Non-invasive prenatal paternity testing using mini-STR-based next-generation sequencing: a pilot study

Abstract Objectives To assess the efficacy of a mini-STR-based next-generation sequencing (NGS) method for non-invasive prenatal paternity testing (NIPPT). Methods Plasma DNA from 28 pregnant women was extracted and cell-free foetal DNA (cffDNA) genotyping was performed at 23 mini-STR loci using the Illumina NextSeq 500 system. For each mini-STR locus, the cffDNA genotype was validated by determining infant DNA genotype. The mini-STR loci with high concordance rates were selected for the comparison of STR genotyping results between cffDNA and biological father DNA or random male DNA for each family. Results The biological relationship was identified between alleged fathers and infants in all 28 families using the capillary electrophoresis (CE) method. Moreover, the concordance rates of STR genotypes D5S818, D19S253, and D21S1270 were less than 50% in 23 autosomal STR loci. The STR genotype matching probability was calculated using 20 STR loci with more than 60% concordance rate. There was a significant difference in the STR genotype matching probability between cffDNA and the DNA from the biological father (75–100%) or from random males (25–70%) (p&lt;0.0001). Conclusions Our study demonstrated that mini-STR can be used for NGS-based NIPPT. Furthermore, this method can be used for crime control purposes using the STR data available from the national forensic DNA databases.

Research on multi-parameter fusion non-invasive blood glucose detection method based on machine learning.

Traditional blood glucose testing methods have several disadvantages, such as high pain and poor acquisition continuity. In response to these shortcomings, we propose a multi-parameter fusion non-invasive blood glucose detection method that combines machine learning and photoplethysmography (PPG) signal feature parameter analysis. This method uses the signal validity check process based on the correlation operation to test and calculate PPG data. It, then, respectively applies the bootstrap aggregation algorithm and the random forests algorithm to establish two non-invasive blood glucose detection models that comprehensively predict blood glucose data. Experimental comparative analysis showed that the accuracy of the detection model based on the random forests algorithm is superior. The correlation coefficient of the obtained blood glucose prediction set is 0.972, the mean square error is 0.257, and the relative error is less than ± 20%. Relative error in blood glucose prediction meets the national standards in China. Meanwhile, the results of the Clarke Error Grid Analysis indicate that the non-invasive blood glucose testing method proposed in this study meets clinical accuracy requirements.

Near infrared spectroscopy in peripheral artery disease and the diabetic foot: A systematic review.

With the need for tools that assess microvascular status in diabetic foot disease (DFD) being clear, near infrared spectroscopy (NIRS) is a putative method for noninvasive testing of the diabetic foot. The use of NIRS in patients with peripheral arterial disease (PAD) has extended to its role in studying the pathophysiology of DFD. NIRS generates metrics such as recovery time, deoxygenation, oxygen consumption (VO2 ), tissue oxygen saturation (StO2 ), total haemoglobin (HbT), and oxyhaemoglobin area under the curve (O2 HbAUC ). NIRS may potentially help the multidisciplinary team stratify limbs as high-risk, especially in diabetic patients with symptoms masked by peripheral neuropathy. NIRS may be useful for assessing treatment effectiveness and preventing deterioration of patients with PAD.