Abstract

Background: Helicobacter pylori plays an important role in the etiology and pathogenesis of gastritis and duodenitis. There are two groups of test methods to detect Helicobacter pylori infection: invasive methods and non-invasive methods. Testing for Helicobacter pylori in saliva by real-time PCR technique belongs to group of non-invasive test methods. Objectives: To determine the detection rate of Helicobacter pylori in saliva by real-time PCR technique in gastritis and duodenitis patients and to investigate some factors related to Helicobacter pylori infection detected in saliva using real-time PCR technique in gastritis and duodenitis. Materials and method: A cross-sectional descriptive study on 91 patients after convenient sampling was preliminarily diagnosed with gastritis and duodenitis with indications for endoscopy and biopsy. Biopsy specimens were used for urease and histopathology tests. Saliva is taken directly from the mouth after spitting into a dedicated bottle and conducting a real-time PCR test. Gene amplification will be performed with a PYLORI-PCR mix containing primers and for the expected target product of 203 base pairs length: 5' - AGCGCTCTCACTTCCATAGGC - 3' and 5' - TCTTCGGTTAAAAAAGCGAT - 3'. Install the program "Protocol" for the Real-time PCR machine to operate with the following cycles: 1 cycle: 950C for 5 minutes; 40 cycles: 950C for 15 seconds, 550C for 1 minute and 720C for 20 seconds. Results: The positive rate for Helicobacter pylori in saliva by realtime PCR technique, urease test and histopathology were 20.9%, 19.8% and 46.2% respectively. The detection rate of H. pylori by real-time PCR in saliva and the detection rate on urease test as well as histopathology had a statistically significant correlation. A few important factors related to Helicobacter pylori-positive patients in saliva as follows: personal history suffer from gastritis and duodenitis 40.7%, reflux esophagitis 67%, and congestive inflammation 75.8%. Conclusions: The rate of detecting Helicobacter pylori in saliva by real-time PCR technique in gastritis and duodenitis patients in Can Tho University of Medicine and Pharmacy Hospital is higher than urease test and lower than histopathology.

Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call