Non-cancerous Tissue Specimens Research Articles

Abstract LB-72: Expression of the BCL2-like 12 (BCL2L12) gene is associated with prolonged survival of breast adenocarcinoma patients.

Abstract The objective of this study was to evaluate the prognostic value of the BCL2-like 12 (BCL2L12) splice variants in breast adenocarcinoma. BCL2L12 is a member of the BCL2 family, aberrantly expressed in several human malignancies, including gastrointestinal cancer, head and neck squamous cell carcinoma, nasopharyngeal carcinoma, and chronic lymphocytic leukemia. We have recently cloned ten novel alternatively spliced variants of this apoptosis-related gene, predicted to encode multiple protein isoforms with distinct functions. Up to date, only the classical isoform has been studied. This one was shown to inhibit apoptosis by neutralizing Caspase-3 and Caspase-7 as well as p53 signaling in glioblastoma. Total RNA was isolated from 140 primary breast tumors and adjacent non-cancerous breast tissue specimens, as well as from breast cancer cell lines. After testing the RNA quality, cDNA was prepared by reverse transcription. A common forward primer and a variant-specific reverse primer were designed and used for the PCR-based expression analysis of each distinct BCL2L12 splice variant. A highly specific and sensitive real-time PCR method was also developed for the quantification of the BCL2L12 main transcript (detection limit: 10 mRNA copies / μL), followed by extensive biostatistical analysis. Calculations were made with the comparative CT (2−▵▵CT) method, using HPRT1 as endogenous control gene and the MCF-7 cell line as calibrator. BCL2L12 splice variants 1, 2, 4, 5, 10, 11, 12, and 13 were detected in breast cancer cells. Among all these mRNA isoforms, the main transcript (BCL2L12 v.1) presented the greatest alterations. This variant was significantly lower in breast adenocarcinomas than in their normal counterparts. Moreover, its expression was inversely associated with estrogen receptor (ER) status (P=0.031), tumor size (P=0.032), TNM stage (P=0.021), and presence of distant metastases (P<0.001). Kaplan-Meier survival analysis and univariate Cox regression indicated that BCL2L12 v.1 is a significant prognosticator of prolonged disease-free and overall survival (P<0.001 in both cases). Most importantly, according to the developed multivariate Cox regression models, the favorable prognostic value of BCL2L12 mRNA expression regarding disease-free survival is independent of the tumor grade, TNM stage, and patients' age (P=0.047). Our findings suggest that the expression of the main transcript (BCL2L12 splice variant 1) of the apoptosis-related BCL2L12 gene merits further investigation as a novel, candidate molecular biomarker predicting prolonged disease-free and overall survival in breast adenocarcinoma patients. Acknowledgements: This work was supported by a THALIS grant (#224), co-funded by the European Union (European Social Fund) and National Resources (NSRF 2007-2013, Operational Programme “Education and Lifelong Learning”). Citation Format: Athina Kladi-Skandali, Christos K. Kontos, Alexandros Tzovaras, Maroulio Talieri, Ioannis Missitzis, Alexandros Ardavanis, Andreas Scorilas. Expression of the BCL2-like 12 (BCL2L12) gene is associated with prolonged survival of breast adenocarcinoma patients. [abstract]. In: Proceedings of the 104th Annual Meeting of the American Association for Cancer Research; 2013 Apr 6-10; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2013;73(8 Suppl):Abstract nr LB-72. doi:10.1158/1538-7445.AM2013-LB-72

Overexpression of p-4ebp1 in Chinese gastric cancer patients and its correlation with prognosis.

We sought to reveal the status of phosphorylated 4E-binding protein 1 (p-4ebp1) expression in Chinese gastric cancer patients and its correlation with tumor prognosis. Tissue microarray blocks containing gastric cancer tissue and matched noncancerous gastric tissue specimens from 286 patients were constructed. The expression of 4E-binding protein 1 (4ebp1) and p-4ebp1 of these specimens was analyzed using immunohistochemical studies. The expression rates of 4ebp1 and p-4ebp1 in gastric cancer were 68.5% (196 of 286) and 49.7% (142 of 286) respectively. The expression of 4ebp1 was correlated with node metastasis and poor differentiation, while the expression of p-4ebp1 was correlated with tumor size, node metastasis and TNM stage. p-4ebp1 overexpression has a significant inverse correlation with median survival time. p-4ebp1 expression is correlated with later TNM stage and is a prognostic factor of survival time after surgery.

L-DOPA decarboxylase mRNA expression is associated with tumor stage and size in head and neck squamous cell carcinoma: a retrospective cohort study

BackgroundHead and neck squamous cell carcinoma (HNSCC) represents one of the most commonly diagnosed malignancies worldwide. The DDC gene encodes L-DOPA decarboxylase, an enzyme catalyzing the decarboxylation of L-DOPA to dopamine. We have recently shown that DDC mRNA is a significant predictor of patients’ prognosis in colorectal adenocarcinoma and prostate cancer. The aim of the current study was to analyze the DDC mRNA expression in HNSCC patients.Methods53 malignant tumors were resected from the larynx, pharynx, tongue, buccal mucosa, parotid glands, and nasal cavity, as well as from 34 adjacent non-cancerous tissues of HNSCC patients, and were homogenized. Total RNA was isolated and converted into first-strand cDNA. An ultrasensitive real-time PCR method based on the SYBR Green chemistry was used for DDC mRNA quantification in head and neck tissue specimens. Relative quantification was performed using the comparative Ct (2-ddCt) method.ResultsDDC mRNA levels were lower in squamous cell carcinomas (SCCs) of the larynx and tongue than in adjacent non-cancerous tissue specimens. Furthermore, low DDC mRNA expression was noticed in laryngeal and tongue tumors of advanced TNM stage or bigger size, compared to early-stage or smaller tumors, respectively. No statistically significant differences were observed between SCCs resected from pharynx, buccal mucosa, or nasal cavity, and their normal counterparts.ConclusionThis is the first study examining the DDC mRNA expression in HNSCC. According to our results, DDC mRNA expression may constitute a potential prognostic biomarker in tongue and/or larynx SCCs, which principally represent the overwhelming majority of HNSCC cases.

Evaluation of UDP-glucuronosyltransferase 2B17 (UGT2B17) and dihydrofolate reductase (DHFR) genes deletion and the expression level of NGX6 mRNA in breast cancer

The present study was aimed to investigate the possible association between 19-base pair (bp) deletion polymorphism of the DHFR gene (rs70991108), null genotype of UDP-glucuronosyltransferase 2B17 (UGT2B17) as well as the expression level of nasopharyngeal carcinoma-associated gene 6 (NGX6) with the risk of breast cancer. This case-control study was done on 236 patients with breast cancer and 203 cancer free women. Detection of 19-bp del of DHFR was done using bi-directional PCR allele-specific amplification and UGT2B17 genotyping was performed using multiplex PCR assay. NGX6 mRNA expression level was determined by quantitative reverse transcriptase PCR in 62 breast cancerous and 62 adjacent non-cancerous tissues. Our finding showed an association between null genotype of UGT2B17 and risk of breast cancer and the null genotype increased susceptibility to breast cancer (OR: 2.99; 95 % CI: 1.94-4.60; p < 0.0001). However, no statistically significant difference was found between breast cancer patients and cancer free normal women regarding 19-bp ins/del of DHFR (χ(2) = 0.91, p = 0.63). Real-time PCR data showed that the relative expression level of NGX6 mRNA was significantly lower in cancerous than that in non-cancerous breast tissue specimens (0.936 ± 0.042 and 1.042 ± 0.039, respectively). However, NGX6 mRNA expression was not correlated with tumors grade (p > 0.05). In conclusion, the null genotype of UGT2B17 revealed to be a risk factor for breast cancer in a sample of Iranian population. Furthermore, down-regulation of NGX6 mRNA expression in breast carcinoma confirms the growing proof regarding the tumor suppressor role of NGX6.

VEGF-C facilitates development of esophageal squamous cancer via regulating expression of CNTN-1

Objective To investigate the biological significance and mechanism of VEGF-C in e- sophageal tumor development, and correlation of CNTN-1 level with VEGF-C. Methods The expression of VEGF-C and its receptors in esophageal squamous cancer cell （ESCC） and in corresponding noncancerous esophageal tissue specimens were detected by real-time PCR. Esophageal squamous cancer cell line TE-1 was transinfected by VEGF-C overexpression and gene silencing vectors, respectively, and the relative amount of C/EBP bound to CNTN-1 promoter was determined by quantitative CHIP, to explore the possibility that VEGF-C was involved in development of esophageal cancer through mediating transcription of CNTN-1. Re- suits The mRNA levels of VEGF-C was significantly higher in ESCC than in normal esophageal tissues. VEGF-C expression was significantly increased in VEGF-C-overexpressing TE-1 cells compared to untrans- fected cells （mock）. Cells transfected with either of the VEGF-C targeting shRNA vectors, shRNA-1 and shRNA-2, showed reduced VEGF-C transcripts （P 〈 0. 01 ）. Expression levels of VEGF-C and CNTN-1 mR- NA correlated significantly with each other. The binding site of C/EBP in CNTN-1 was detected by CHIP, and the relative amount of C/EBP binding to CNTN-1 promoter was significantly increased in TE-1 after transfecting by VEGF-C overexpression vector （ P 〈 0. 05 ）. Conclusion VEGF-C and its receptor are highly expressed in esophageal cancer tissues, which may be associated with ESCC carcinogenesis and development. VEGF-C may influence on growth and migration in TE-1 cells through CNTN-1. Key words: Esophageal tumor; VEGF-C; CNTN-1

Correlation between epigenetic alterations in the insulin growth factor-II gene and hepatocellular carcinoma

To investigate whether epigenetic alterations in the insulin-like growth factor-II (IGF-II) gene that cause differential transcription or expression are correlated with onset and severity of hepatocellular carcinoma (HCC). Patient-matched specimens of HCC, paracancerous, and non-cancerous tissues were collected from 40 primary liver cancer patients. Epigenetic alterations in the promoter (P3) sequence of the IGF-II gene were analyzed by methylation-specific PCR (MSP) and IGF-II transcription was measured by RT-PCR. IGF-II protein expression and clinicopathological features were assessed by immunohistochemistry and microscopic observation. The rate of IGF-II P3 methylation was significantly lower in HCC tissues (0%) than in paracancerous tissues (vs. 47.5%; x2 = 24.918, P less than 0.001) and non-cancerous tissues (vs. 100%; x2 = 80.000, P less than 0.001). IGF-II mRNA expression was significantly higher in HCC tissues (100%) than in paracancerous tissues (vs. 52.5%; x2 = 24.918, P less than 0.001) and non-cancerous tissues (vs. 0%; x2 = 80.000, P less than 0.001). IGF-II protein expression was significantly higher in HCC tissues (82.5%) than in paracancerous tissues (vs. 45.0%; x2 = 12.170, P less than 0.001) and non-cancerous tissues (vs. 0%; x2 = 56.170, P less than 0.001). IGF-II overexpression in HCC was significantly associated with degree of differentiation, extent of infiltrated serosa, size of tumor, and HBV-positive infection status. Epigenetic alterations in the IGF-II gene regulate its transcription and expression and are closely associated with HCC development and progression.

Quantitative expression analysis of the apoptosis‐related gene, BCL2L12, in head and neck squamous cell carcinoma

BCL2L12 is a recently identified gene belonging to the BCL2 family, members of which are implicated in head and neck squamous cell carcinoma (HNSCC). We have recently shown that BCL2L12 mRNA expression is an unfavorable prognostic indicator in nasopharyngeal carcinoma (NPC) and that BCL2L12 can be regarded as a novel, useful tissue biomarker for the prediction of NPC patients' short-term relapse. The aim of this study was to analyze the mRNA expression of the novel apoptosis-related gene BCL2L12 in patients with HNSCC. Total RNA was isolated from 53 malignant tumors originating in larynx, pharynx, tongue, buccal mucosa, parotid glands, and nasal cavity, as well as from 34 adjacent non-cancerous tissue specimens, resected from patients with HNSCC. A highly sensitive real-time PCR method for BCL2L12 mRNA quantification in head and neck tissues was developed using the SYBR(®) Green chemistry. After preparing cDNA by reverse transcription, relative quantification was performed using the comparative C(T) () method. BCL2L12 mRNA levels were lower in laryngeal tumors of advanced tumor, node, metastasis (TNM) stage or bigger size and in well-differentiated malignant tongue neoplasms, compared with early-stage laryngeal tumors or poorly differentiated tongue tumors. Interestingly, the BCL2L12 expression showed significant discriminatory value, distinguishing efficiently patients with tongue squamous cell carcinoma (SCC) from non-cancerous population. This is the first study examining the BCL2L12 mRNA expression in HNSCC. Our results suggest that BCL2L12 mRNA expression may serve as a potential prognostic biomarker in tongue and/or larynx SCC, which principally constitute the great majority of HNSCC cases worldwide.

Expression of c-kit protein in cancer versus normal breast tissue

Aim of the studyThere are at least four main signal transduction pathways within human cells which are activated by interaction of an extracellular ligand with its corresponding receptors. One of them is activation of protein kinase. Actually, any of these proteins at any level of the signaling cascade in a human cell can undergo mutation and cause irregular cellular proliferation and finally result in cancer. C-kit is alternatively called stem cell factor receptor (SCFR) or CD117. It appears that lack of c-kit expression accompanies progression of some tumors, e.g. lung, breast, GIST. The aim of this study was to evaluate C-kit protein expression level within cancer cases.Material and methodsSixty specimens of breast cancer and 60 non-cancerous breast tissue specimens were evaluated by IHC for C-kit presentation. We used positive GIST slides as controls. Epi-info ver 6.04 (CDC, WHO) was used for analysis.ResultsC-kit was negative in all breast cancer specimens. C-kit was negative in 47 (78%) of 60 non-cancerous breast tissue specimens, but was positive in 13 (22%) of them (p < 0.0001).ConclusionsThere is a reduction in C-kit expression with malignant transformation of breast epithelium. C-kit is believed to play a role in breast carcinogenesis. However, we should follow patients with normal or benign breast tissue to indicate any correlation between C-kit presentation and breast cancer development.

Clinical significance of human kallikrein 12 gene expression in gastric cancer

To investigate whether the expression of kallikrein 12 (KLK12) is related to the development of gastric cancer (GC) and to determine the role of KLK12 in gastric cancer cells growth, invasion and migration. Between September 2007 and March 2008, 133 patients with histologically confirmed GC were recruited for the study. Expression of KLK12 was detected in samples from GC patients by quantitative real-time reverse transcription polymerase chain reaction and immunohistochemistry. The relationship between KLK12 protein expression and clinicopathological features of GC was analyzed. The difference in 5-year survival rates between the high KLK12 protein expression group and the low KLK12 expression group was compared. Additionally, the expression of KLK12 was examined in various human GC cell lines, including MKN-28, SGC-7901 and MKN-45. Small interfering RNA (siRNA) was used to inhibit KLK12 expression in MKN-45 cells. Cell clones stably transfected with KLK12 siRNA were tested for KLK12 expression by quantitative real-time reverse transcription-polymerase chain reaction and Western blotting. Furthermore, a series of functional assays were performed in this study to assess the biological features of transfected cells. Cell proliferation was assessed using the methylthiazolyltetrazoliumassay. Finally, cell migration and invasion were assessed using transwell chamber assays. Of the 133 GC patients included in the study, 126 (94.7%) showed a higher expression level of KLK12 mRNA when compared to noncancerous tissue specimens. Expression of KLK12 mRNA was significantly higher in GC tissues than in normal tissue (P < 0.001). KLK12 protein expression was detected in 96 of 133 (72.2%) GC samples with moderate or strong staining primarily in the cytoplasm. In contrast, negative immunostaining for KLK12 protein was observed in the corresponding normal gastric mucosal tissue. Overexpression of KLK12 protein was significantly associated with lymph node metastasis (P = 0.001), histological type (P < 0.001) and tumor-node-metastasis stage (P = 0.005), while no significant correlation was observed between expression of KLK12 protein and sex, age, depth of invasion, tumor size or lymphatic invasion. Furthermore, patients with high KLK12 expression had a significantly poorer 5-year survival rate than those with low KLK12 expression (P = 0.002). Expression of KLK12 mRNA was significantly higher in MKN-45 GC cells compared to normal mucosal cells or two other GC cell lines (P < 0.01). Expression of KLK12 in MKN-45 cells was downregulated after transfection with siRNA. Knockdown of KLK12 markedly decreased the proliferation of MKN-45 cells when compared with parent or mock-transfected cells (P = 0.001), especially from the 3rd to the 5th day of the assay. In migration assays, fewer KLK12 siRNA cells migrated through the chambers (22.00 ± 1.81) when compared to the parent (46.47 ± 2.42) or mock-transfected cells (45.40 ± 1.99); these differences were statistically significant (P < 0.001). However, in the invasion assay, the number of KLK12 siRNA cells that invaded the chambers was 18.40 ± 1.12, closely similar to both the parent (18.67 ± 0.98) and mock-transfected cells (18.53 ± 0.92). There was no significantly difference between the three groups in the invasion assay (P = 0.054). The KLK12 gene is markedly overexpressed in GC tissue, and its expression status may be a powerful prognostic indicator for patients with GC. KLK12 might serve as a novel diagnosis and prognosis biomarker in GC.

Sperm-Associated Antigen 9 Is a Novel Biomarker for Colorectal Cancer and Is Involved in Tumor Growth and Tumorigenicity

Colorectal cancer (CRC) is the second most common tumor in developed countries. The present study was undertaken to determine the expression of the sperm-associated antigen 9 gene (SPAG9) as a possible biomarker in CRC, to investigate its correlation with humoral immune response and different stages and grades in CRC patients, and to explore its possible role in colon tumorigenesis in vitro and in an in vivo mouse model. SPAG9 expression was determined by RT-PCR, in situ RNA hybridization, and immunohistochemistry. Humoral response against SPAG9 was detected by enzyme-linked immunosorbent assay and Western blotting. SPAG9 gene silencing was performed using plasmid-based small interfering RNA to study various malignant properties of colon cancer cells in vitro and in vivo. The majority of CRC patients showed SPAG9 expression and generated humoral response. There was a close relationship between SPAG9 protein expression and humoral immune response in the majority of early-stage CRC patients, indicating that anti-SPAG9 antibodies could be a novel serum biomarker for early diagnosis. The down-regulation of SPAG9 (mediated by small interfering RNA) inhibited malignant properties in in vitro and significantly suppressed tumor growth in vivo. These findings collectively suggest that SPAG9 may have a role in tumor development and early spread and thus could serve as a novel target for early detection and for cancer immunotherapy.

Frequent presence of incomplete HPV16 E7 ORFs in lung carcinomas: Memories of viral infection

Background HPV16 E6/E7 oncoproteins are critical for cervical carcinogenesis. The corresponding oncogenes are also detected in head and neck cancer, but in lung cancer their presence is strongly debated. PCR-based detection protocols amplify different target sequences. Objectives To examine the frequency of different length HPV16 E7 segments in lung carcinomas. Study design We designed four different amplification schemes for the detection of overlapping segments of the HPV16 E7 ORF, all suitable for specific HPV detection in cervical carcinoma. In two schemes, the entire E7 ORF was targeted while in the remaining schemes internal, smaller sequences were targeted. In total, 76 specimens were used; 29 lung carcinoma specimens, 16 non-cancerous lung tissue specimens from the same patients and 31 bronchial washings from different lung cancer patients. Results Amplification of the entire HPV16 E7 ORF, using two protocols, demonstrated the absence of the specific HPV16 E7 sequences (74 samples either tested negative by the first PCR protocol or false positive by the second, based on sequencing or AvaII or PvuII digestion). However, both schemes targeting smaller E7 segments revealed the frequent presence of HPV16 E7 sequences in lung carcinoma specimens (14/23 positive by either scheme). Conclusions HPV16 E7 sequences are frequently observed in lung carcinomas. Decreasing the size of PCR-target sequences increases the detection frequency, possibly indicating the presence of incomplete viral ORFs. Restriction endonuclease analysis is critical for verifying the reliability of the detection of these sequences.

The role of RACK1 as an independent prognostic indicator in human breast cancer

We have read with great interest the recent article by Cao et al. [1] in which the authors looked at the protein expression of RACK1 in human breast cancer and showed that high levels were predictive of a poor clinical outcome in vitro and in vivo. We have analyzed RACK1 mRNA expression RACK1 (primers: aaaaccatcaagctatggaa, RACK1F1actgaacctgaccg tacaacaggagacgatgataggg, RACK1Zr1) in 127 human breast cancer and in 33 non-cancerous breast tissue specimens using RT–PCR technology following RNA extraction from frozen samples. We then normalized the mRNA copy numbers for RACK1 against the epithelial marker CK19 to adjust for epithelial cellularity in the examined breast specimens. We have observed that RACK1 expression levels were higher in the normal breast tissue compared with the cancer specimens (mean levels were 136 vs. 32 in paired samples, P = 0.44) and that RACK1 mRNA levels were significantly lower in TNM3 tumours compared with TNM1 tumours (0.08 vs. 33, P = 0.04). After a median follow-up of 10 years, high levels of RACK1 mRNA expression were associated with a good clinical outcome. The mean level of expression in patients who remained disease-free was 36 compared with 2.4 in those who had systemic relapse (P = 0.042) or those who had local recurrence (mean = 3.86, P = 0.05). Furthermore, we observed significant correlations with other molecular markers of apoptosis. RACK1 is significantly correlated with DEATH-ASSOCIATED PROTEIN 3: DAP3 (r = 0.4, P \ 0.01). DAP3, is also known as MITOCHONDRIAL RIBOSOMAL PROTEIN S29; MRP S29 (Gene mapped to locus 1q21) and is known to be involved in mediating interferon-gamma (147570)-induced cell death and is a positive mediator of cell death. Dap3 may be a tumour suppressor gene subject to loss or inactivation in tumors [2]. These results have been consistent with a recent published research in which the authors showed that RACK1induced apoptosis of human colon cells by inhibiting the expression of anti-apoptotic pathways and Src activity thus leading to death of colon cancer cells [3]. Therefore, the role of RACK1 as an independent prognostic indicator in human breast cancer is still a subject of further research until new data emerge.

Expression of EBF3 in hepatocellular carcinoma and the effect of EBF3 overexpression on HepG2 cell proliferation

Objective To investigate the expression and clinical significance of early B-cell factor 3 (EBF3) mRNA and protein in hepatocellular carcinoma(HCC) and the effect of EBF3 overexpression on HepG2 cell proliferation. Methods The expression levels of EBF3 mRNA in 20 pairs surgical specimens of HCC and their distant noncancerous tissues were detected by fluorescence quantitative real-time polymerase chain reaction(FQ-RT-PCR). Western blot was used to detect the expression levels of EBF3 protein in 5 pairs surgical specimens of HCC and distant noncancerous tissues. The fusion protein EBF3-EGFP was ex-pressed in HepG2 cells by transfection of pEGFP/EBF3 into the synchronized HepG2 cells using lipo-fectAMINE 2000 regent. Expression of EBF3-EGFP fusion protein was observed under the inverted fluores-cence microscope. S-phase fraction(SPF) and proliferating index(PI) were analyzed with flow cytometry (FCM). Results The ratio of EBF3 mRNA to β2 mRNA in HCC tissues was significantly higher than that in distant liver non-cancerous tissues(0.55 ±0.12 versus 0. 22 ± 0.23, t = 5.69, P < 0.001 ). EBF3 protein in nuclear extracts of HCC tissues was about 4 fold that in distant non-cancerous tissues (26.35 ±14.06 versus 7.86 ± 8.47, t = 2.52, P = 0.036). Fluorescence microscopy revealed that 24 h after trans-fection of pEGFP/EBF3 into hepatoma HepG2, the fluorescence of EBF3-EGFP fusion protein was mainly observed in the nucleus. After transfection for 24 h and 48 h, SPF and PI were markedly increased in HepG2 cells transfected by pEGFP/EBF3 as compared with that in pEGFP-N1 transfeeted cells. Conclusion The expression of EBF3 at both mRNA and protein levels was up-regulated in HCC tissues. EBF3 promotes HepG2 cells proliferation through DNA replication, effect of EBF3 in ttCC needs to be further investigated. Key words: Early B-cell factor 3 ; Liver neoplasm; FQ-RT-PCR; Western blot; Proliferation

Expression of guanylyl cyclase-c and caudal type homeobox transcription factor 2 in human gastric cancer and precursor lesions

To investigate the expression of guanylyl cyclase-C (GC-C) and caudal type homeobox transcription factor 2 (CDX2) in human gastric mucosa at different stages and the significance thereof. An Immunofluorescence method was used to detect the expression of GC-C and CDX-2 in 23 specimens of gastric carcinoma and matching noncancerous tissues. Western blotting was used to detect the protein expression of GC-C and CDX2 in the gastric carcinoma tissues and matching noncancerous tissues too. The GC-C and CDX2 expression rates were 39.1% and 39.1% respectively in the intestinal metaplasia specimens, 55.6% and 55.6% respectively in the dysplasia specimens, and 56.7 % and 60.0% in the gastric carcinoma specimens, all significantly higher than those in the normal mucosa specimens (all P = 0.000) without significant differences in the expression of GC-C and CDX-2 among the 3 pathological groups. The GC-C and CDX-2 expression was positively correlated with Lauren classification, The expression levels of GC-C and CDX-2 were significantly higher in the intestinal-type than in the diffuse-type gastric carcinoma (P < 0.05). The GC-C expression was positively correlated with the expression of CDX-2 in intestinal metaplasia and gastric carcinoma. Ectopic expression of GC-C and CDX2 in human gastric mucosa may play an important role in the carcinogenesis of intestinal-type gastric carcinoma. Detection of GC-C and CDX2 helps diagnose gastric carcinoma and precursor lesions.

Specific Gene-Expression Profiles of Noncancerous Liver Tissue Predict the Risk for Multicentric Occurrence of Hepatocellular Carcinoma in Hepatitis C Virus–Positive Patients

Hepatitis C virus (HCV) infection produces chronic hepatitis, cirrhosis, and, ultimately, hepatocellular carcinoma (HCC). A molecular analysis of the damaged liver tissues infected with HCV may identify specific gene-expression profiles associated with a risk for liver carcinogenesis. Forty patients with HCV-positive HCC were classified into two groups: single nodular HCC group (n = 28) and multicentric HCC group (n = 12). Using a complementary DNA microarray, we compared the gene-expression patterns of the noncancerous liver tissue specimens between the two groups. We also identified the differentially expressed genes related to multicentric recurrence in the liver remnant. We then evaluated whether a specific gene-expression profile can accurately estimate the risk for multicentric hepatocarcinogenesis. We selected the 230 differentially expressed genes in the multicentric HCC group. A hierarchical clustering analysis identified a cluster that might be closely associated with the multicentric occurrence of HCC. On the basis of the gene-expression profiling of the 36 genes commonly associated with both multicentric HCC and multicentric recurrence, we created a scoring system to estimate the risk for multicentric hepatocarcinogenesis. The prediction score of patients in the multicentric HCC group with multicentric recurrence (19.9 +/- 9.2) was significantly higher (P < .05) than that in the single nodular HCC group without multicentric recurrence (-1.8 +/- 12.7). Specific gene-expression signatures in noncancerous liver tissue may help to accurately predict the risk for developing HCC.

Expression and prognostic value of tuberous sclerosis complex 2 gene product tuberin in human pancreatic cancer

Tuberous sclerosis complex (TSC) is an autosomal dominant disorder caused by mutation of either of 2 tumor suppressor genes, TSC1 or TSC2, which encode hamartin and tuberin, respectively. Several studies have shown that tuberin functions independently of hamartin and inhibits signaling pathways via the mammalian target of rapamycin, a critical regulator of cell proliferation. Recent studies have revealed that the signaling pathways regulating the mammalian target of rapamycin such as Akt and S6K1 are frequently activated in pancreatic cancer. We hypothesized that tuberin might be involved in the proliferation and survival of pancreatic cancer cells. We immunohistochemically examined the expression of tuberin in 42 pancreatic cancerous and noncancerous pancreatic tissue specimens using an antituberin antibody. The correlations between tuberin expression and various clinicopathologic features, including survival, were evaluated. Reverse transcriptase-polymerase chain reaction was performed to evaluate the level of tuberin expression in paired samples of pancreatic cancer and noncancerous tissue. Twenty-four of the 42 pancreatic cancer samples (57%) were negative for tuberin expression. The patients with tuberin-negative tumors had a significantly higher incidence of pT3 or pT4 disease (primary tumor extent by the TNM classification) than those with tuberin-positive tumors (P = .024). Female patients had a significantly higher incidence of tuberin-positive tumors than male patients (P = .014). The survival rate of the tuberin-positive group tended to be better than that of the tuberin-negative group, but there was no significant difference (P = .4). Expression of TSC2 in cancer tissue was lower than in the corresponding noncancerous tissue for 7 of the 9 samples examined. This study demonstrates that reduced expression of tuberin might be involved in the progression of pancreatic cancer. Accordingly, tuberin may provide a new therapeutic target in patients with this type of cancer.

P16 Promoter Hypermethylation in Human Hepatocellular Carcinoma with or without Hepatitis Virus Infection

Background: Epigenetic alteration through methylation is one of the most important steps in carcinogenesis. However, the relation between hepatitis virus infection and epigenetic alterations is poorly understood. Methods: Sixteen patients without hepatitis B virus (HBV) and hepatitis C virus (HCV) and 35 patients with HBV or HCV who underwent liver resection for hepatocellular carcinoma (HCC) were studied. Mutation of p53 was detected by direct sequencing. Methylation status of p16 was evaluated in tumor and noncancerous liver tissues by methylation-specific polymerase chain reaction. Results: In HCC without HBV and HCV, p53 mutations were detected in 5 (31%) of 16 HCCs. Methylation of p16 promoter was detected in 2 (25%) of 8 moderately differentiated HCCs, 6 (75%) of 8 poorly differentiated HCCs, and none of 16 noncancerous tissue specimens. In HCC with HBV or HCV, p53 mutations were detected in 8 (23%) of 35 HCCs. Methylation of p16 promoter was detected in 2 (100%) of 2 well-differentiated HCCs, 13 (76%) of 17 moderately differentiated HCCs, 12 (75%) of 16 poorly differentiated HCCs, and 9 (26%) of 35 noncancerous liver tissue specimens. Conclusions: Our results suggest that hepatitis viruses might induce methylation of p16 promoter in liver with chronic inflammation, before appearance of HCC.

CD44 variant exon 6 expressions in colon cancer assessed by quantitative analysis using real time reverse transcriptase-polymerase chain reaction

CD44 is a family of transmembrane glycoproteins that serve as a major receptor for hyaluronate and the splice variants play a very important role in tumor progression and metastasis. We examined the relationship between cancer progression and mRNA levels of CD44 variant exon 6 (CD44v6) in specimens of colon cancer at different diagnostic stages from 31 patients using real time RT-PCR analysis. Increased mRNA levels of CD44v6 were observed in 82% of the specimens in comparison with those in the corresponding non-cancerous tissue specimens. A statistically significant correlation between the CD44v6 expression and the cancerous state was found in most specimens at all Dukes stages. None of the other parameters were related to the expression in the cancerous specimens. Quantitative real time RT-PCR analysis showed that there was no correlation of CD44v6 expression with tumor progression, although CD44v6 is upregulated in transformation. Thus, CD44v6 expression may be a clinically useful indicator of colon cancer.

Expression of COX-2 in Stomach Cancers and Its Relation to Their Biological Features

Background/Aim: Cyclooxygenase-2 (COX-2) is one of the key isoenzymes in the production of prostaglandins, and is believed to be involved in carcinogenesis. This study was conducted to examine the role of COX-2 in the development and biological behavior of stomach cancer. Methods: Expression of COX-2 at the mRNA and protein levels was analyzed using RT-PCR and immunoblotting assay in 50 cancerous and corresponding non-cancerous tissue specimens. Also, COX-2 expression was detected by an immunohistochemical method in 55 paraffin-embedded gastric adenocarcinoma tissues. Results: Of the 50 carcinoma tissue samples analyzed, 38 (76.0%) had overexpression of COX-2 as compared to the paired non-cancerous specimens. The overexpression of COX-2 (91.7%) was more prevalent in tumors with sizes of >5 cm than those (61.5%) of ≤5 cm (p < 0.05). COX-2 overexpression was higher in tumors with >6 metastatic nodes compared to those with ≤6 metastatic nodes (100.0 vs. 61.3%, p < 0.01). The rate of COX-2 overexpression in non-signet ring cell carcinoma was significantly higher compared with signet ring cell carcinoma (84.1 vs. 16.7%, p < 0.05). The rate of COX-2 overexpression (86.8 or 90.9%) in patients with a cancer invasion depth of pT3 + pT4 or with stage III + IV was significantly higher than that (41.7 or 47.1%) in patients with pT1 + pT2 or with stage I + II (both p < 0.01). Furthermore, consistent with the results at the protein and mRNA levels, immunohistochemical stain indicated that COX-2 protein was overexpressed in 39 of 55 (70.9%) carcinomas, and the 5-year survival rate (25.6%) for patients with COX-2 overexpression seemed better than that (50.0%) of patients without overexpression, though the difference was not significant (p < 0.05). Conclusion: Our results indicate that COX-2 may play a role in the development of gastric cancer and its overexpression is associated with lymphatic metastasis, tumor invasion and differentiation of gastric carcinoma.

Receptor for hyaluronan-mediated motility and CD44 expressions in colon cancer assessed by quantitative analysis using real-time reverse transcriptase-polymerase chain reaction.

Receptor for hyaluronan (HA)‐mediated motility (RHAMM) is a receptor for HA‐mediated motility and its expression is correlated with malignancy of ras‐transformed cells in that binding of HA to this receptor activates their migratory ability. CD44, a cell surface receptor for HA is also implicated in metastatic behavior of some cancer cells. In this study we examined the relationships of cancer progression with mRNA levels of RHAMM, CD44 (all forms), and exon 6 of CD44 using the real‐time reverse transcriptase‐polymerase chain reaction method in specimens of colon cancers at different diagnostic stages from 30 patients. Increased mRNA levels of RHAMM were observed in 29 specimens (97%), CD44s (all forms) in 21 specimens (70%), and its exon 6 in 19 specimens (63%) in comparison with those in the corresponding noncancerous tissue specimens. A statistically significant correlation between RHAMM expression and cancerous specimens at any of Dukes' stages A, B, and C was found, and the overexpression of CD44 mRNAs was confirmed in specimens at Dukes' stage C. Thus, our present study for the first time suggests that RHAMM expression may be a clinically useful indicator of colon cancer.