Nicotiana Occidentalis Research Articles

Host-specific accumulation and temperature effects on the generation of dimeric viral RNA species derived from the S-RNA of members of the Tospovirus genus.

Polygonum ringspot virus (PolRSV) is a recently characterized Tospovirus reported in Italy. Northern blot analyses of PolRSV infections in Nicotiana benthamiana and tomato plants showed that a viral RNA species with nearly twice the length of the Small genomic RNA (S-RNA) accumulated abundantly in the former host, but was not detected in the latter. Additional assays confirmed that biogenesis of this novel RNA species was common to all PolRSV isolates tested and also to an isolate of Tomato spotted wilt virus (TSWV). Given its size, we hypothesized that the novel RNA species was a dimer molecule and we confirmed this hypothesis by RNA sequencing (RNAseq) analysis and reverse transcription (RT)-PCR of putative predicted dimer junction sites in RNA extracts of N. benthamiana challenged with PolRSV isolates Plg6 and Plg13/2. We also confirmed that these molecules are derived from head-to-tail dimers and often contain deletions at their junction sites. We named these novel molecules imperfect dimer RNAs (IMPD-RNAs). PolRSV IMPD-RNAs systemic accumulation in a range of host plants was restricted to N. benthamiana and Nicotiana occidentalis. Notably, IMPD-RNAs accumulation was modulated by temperature and their generation was restricted to late stages of systemic infection (12 days post-inoculation) in N. benthamiana. Differently from all other PolRSV isolates used in this study, Plg13/2 generated more IMPD-RNAs coupled with low amounts of genomic S-RNA and maintained them even at 18 °C, besides having lost the ability to infect tomato plants. This is the first characterization of S-RNA dimers for Tospovirus, and of occurrence of dimers of genomic segments at the whole organism level for Bunyaviridae.

RT-PCR Differentiation, Molecular and Pathological Characterization of Andean and Ordinary Strains of Potato virus S in Potatoes in China.

A survey of potatoes in a field in Hubei, China, for common potato viruses revealed that Potato virus S (PVS) was the most abundant virus. To unveil the strain identity of the virus, primers specific to the ordinary and/or Andean strains of PVS (i.e., PVSO and PVSA) were designed. RT-PCR using these primers successfully detected PVSO and PVSA in the samples. Sequence analysis of the amplicons confirmed the correctness of the RT-PCR assay. Two isolates, PVS HB24 and PVS HB7, representing PVSO and PVSA, respectively, were chosen for molecular and biological characterization. Both isolates contained a genome of 8,453 nt in length with six open reading frames. They shared a sequence identity of 79.5% at the complete genome sequence level. Phylogenetic analysis placed PVS HB24 and PVS HB7 to PVSO and PVSA clades, respectively. PVS HB24 induced chlorotic local lesions on the inoculated leaves but no visible symptom on the upper uninoculated leaves of Chenopodium quinoa after mechanical inoculation, whereas PVS HB7 induced both local and systemic symptoms on C. quinoa. ELISA and RT-PCR confirmed that PVS HB7 infected C. quinoa systemically whereas PVS HB24 failed to do so. Both isolates infected potato cv. Shepody and Solanum chacoense asymptomatically, but did not infect Nicotiana occidentalis and N. tobaccum cv. Samsun.

Natural variability in acyl moieties of sugar esters produced by certain tobacco and other Solanaceae species

A unique feature of glandular trichomes of plants in the botanical family Solanaceae is that they produce sugar esters (SE), chemicals that have been shown to possess insecticidal, antifungal, and antibacterial properties. Sugar esters of tobacco (Nicotiana tabacum) provide pest resistance, and are important flavor precursors in oriental tobacco cultivars. Acyl moieties of SEs in Nicotiana spp., petunia, and tomato are shown to vary with respect to carbon length and isomer structure (2–12 carbon chain length; anteiso-, iso-, and straight-chain). Sugar esters and their acyl groups could serve as a model to explore the basis of phenotypic diversity and adaptation to natural and agricultural environments. However, information on the diversity of acyl composition among species, cultivars, and accessions is lacking. Herein, described is the analysis of SE acyl groups found in 21 accessions of Nicotiana obtusifolia (desert tobacco), six of Nicotiana occidentalis subsp. hesperis, three of Nicotiana alata, two of N. occidentalis, four modern tobacco cultivars, five petunia hybrids, and one accession each of a primitive potato (Solanum berthaultii) and tomato (Solanum pennellii). A total of 20 different acyl groups was observed that were represented differently among cultivars, species, and accessions. In Nicotiana species, acetate and iso- and anteiso-branched acids prevailed. Straight-chain groups (2–8 carbons) were prominent in petunias, while octanoic acid was prominent in N. alata and N. × sanderae. Two unexpected acyl groups, 8-methyl nonanoate and decanoate were found in N. occidentalis subsp. hesperis. Longer chain groups were found in the petunia, tomato, and potato species studied.

Apple Proliferation Phytoplasma Influences the Pattern of Plant Volatiles Emitted Depending on Pathogen Virulence

Apple proliferation (AP) and pear decline (PD) are the most severe diseases in pome fruit growing areas. AP-infected trees show typical symptoms such as witches’ broom, enlarged stipules, tasteless and dwarf fruits. PD-infected pears show a progressive weakening, reduced terminal growth, smaller fruits and die within weeks (quick decline) or years (slow decline). The diseases are caused by the cell-wall lacking bacteria Candidatus Phytoplasma mali (AP phytoplasma) and Ca. P. pyri (PD phytoplasma), respectively. In previous studies it has been shown that AP-infected apple trees emitted higher amounts of the sesquiterpene β-caryophyllene, an attractant of the insect vector Cacopsylla picta (Hemiptera: Psyllidae), thereby facilitating the dispersal of AP phytoplasma. In the present study, volatile organic compounds (VOCs) occurring in the headspace of plants infected with Ca. P. mali strains causing different severity of symptoms in apple plants were collected, analyzed and identified. Headspace samples from healthy and AP-infected model plant tobacco (Nicotiana occidentalis) and apple (Malus domestica) as well as from healthy and PD-infected pear (Pyrus communis) were investigated via thermodesorption and GC-MS analysis. Significantly higher concentrations of ethyl benzoate were produced in all phytoplasma-infected plants compared to healthy ones and an as yet unidentified sesquiterpene differed between the odor bouquets of healthy and by Ca. P. mali infected tobacco plants. Additionally, statistically significant higher amounts of both compounds were measured in the headspace of plants infected by the virulent AP strain. In apple, significantly higher concentrations of ethyl benzoate and methyl salicylate were observed for trees infected with strains of Ca. P. mali. Ethyl benzoate was also detected in the headspace of pear trees infected with Ca. P. pyri.

Host range and symptomatology of Pepino mosaic virus strains occurring in Europe

Pepino mosaic virus (PepMV) has caused great concern in the greenhouse tomato industry after it was found causing a new disease in tomato in 1999. The objective of this paper is to investigate alternative hosts and compare important biological characteristics of the three PepMV strains occurring in Europe when tested under different environmental conditions. To this end we compared the infectivity and symptom development of three, well characterized isolates belonging to three different PepMV strains, EU-tom, Ch2 and US1, by inoculating them on tomato, possible alternative host plants in the family Solanaceae and selected test plants. The inoculation experiments were done in 10 countries from south to north in Europe. The importance of alternative hosts among the solanaceous crops and the usefulness of test plants in the biological characterization of PepMV isolates are discussed. Our data for the three strains tested at 10 different European locations with both international and local cultivars showed that eggplant is an alternative host of PepMV. Sweet pepper is not an important host of PepMV, but potato can be infected when the right isolate is matched with a specific cultivar. Nicotiana occidentalis 37B is a useful indicator plant for PepMV studies, since it reacts with a different symptomatology to each one of the PepMV strains.

Transcriptomics assisted proteomic analysis of Nicotiana occidentalis infected by Candidatus Phytoplasma mali strain AT.

Phytoplasmas are pathogenic bacteria within the class of Mollicutes, which are associated with more than 1000 plant diseases. In this study, we applied quantitative mass spectrometry to analyse affected pathways of the model plant tobacco (Nicotiana occidentalis) upon Candidatus Phytoplasma mali strain AT infection. Using tissue obtained from leaf midribs, 1466 plant-assigned proteins were identified. For 1019 of these proteins, we could reproducibly quantify the expression changes of infected versus noninfected plants, of which 157 proteins were up- and 173 proteins were downregulated. Differential expression took place in a number of pathways, among others strong downregulation of porphyrin and chlorophyll metabolism and upregulation of alpha-linolenic acid metabolism, which was consistent with observed increased levels of jasmonic acid, a key signal molecule of plant defence. Our data shed light on the molecular networks that are involved in defence of plants against phytoplasma infection and provide a resource for further studies.

Suppression of aggressive strains of 'Candidatus phytoplasma mali' by mild strains in Catharanthus roseus and Nicotiana occidentalis and indication of similar action in apple trees.

To study antagonistic interactions of 'Candidatus Phytoplasma mali' strains, graft inoculation of Catharanthus roseus and Nicotiana occidentalis was performed with mild strains 1/93Vin and 1/93Tab as suppressors and three aggressive strains as challengers. Inoculation of the suppressors was carried out in either the cross-protection modus prior to grafting of the challengers or by co-inoculating suppressors and challengers. Monitoring using multiplex real-time polymerase chain reaction assays revealed that, in long-term cross-protection trials with C. roseus, suppressor 1/93Vin was present in all root and randomly collected stem samples over the entire observation period. In contrast, the challengers were never detected in such stem samples and rarely in the roots. Following simultaneous inoculation, the suppressor successively colonized all stem and root regions whereas detection of challenger AT steadily decreased. However, this strain remained detectable in up to 13 and 27% of stem and root samples, respectively. The cross-protection trials with N. occidentalis yielded results similar to that of the cross-protection experiments with C. roseus. Comparison of the symptomatology of infected apple trees with the presence of putatively suppressive strains indicated that suppression of severe strains also occurs in apple. Phylogenetic analysis using a variable fragment of AAA+ ATPase gene AP460 of 'Ca. P. mali' revealed that suppressors 1/93Vin and 1/93Tab, together with several other mild strains maintained in apple, cluster distantly from obviously nonsuppressive strains that were predominantly highly virulent.

Analysis of expressed genes of the bacterium 'Candidatus phytoplasma Mali' highlights key features of virulence and metabolism.

‘Candidatus Phytoplasma mali’ is a phytopathogenic bacterium of the family Acholeplasmataceae assigned to the class Mollicutes. This causative agent of the apple proliferation colonizes in Malus domestica the sieve tubes of the plant phloem resulting in a range of symptoms such as witches’- broom formation, reduced vigor and affecting size and quality of the crop. The disease is responsible for strong economical losses in Europe. Although the genome sequence of the pathogen is available, there is only limited information on expression of selected genes and metabolic key features that have not been examined on the transcriptomic or proteomic level so far. This situation is similar to many other phytoplasmas. In the work presented here, RNA-Seq and mass spectrometry shotgun techniques were applied on tissue samples from Nicotiana occidentalis infected by ‘Ca. P. mali’ strain AT providing insights into transcriptome and proteome of the pathogen. Data analysis highlights expression of 208 genes including 14 proteins located in the terminal inverted repeats of the linear chromosome. Beside a high portion of house keeping genes, the recently discussed chaperone GroES/GroEL is expressed. Furthermore, gene expression involved in formation of a type IVB and of the Sec-dependent secretion system was identified as well as the highly expressed putative pathogenicity–related SAP11-like effector protein. Metabolism of phytoplasmas depends on the uptake of spermidine/putescine, amino acids, co-factors, carbohydrates and in particular malate/citrate. The expression of these transporters was confirmed and the analysis of the carbohydrate cycle supports the suggested alternative energy-providing pathway for phytoplasmas releasing acetate and providing ATP. The phylogenetic analyses of malate dehydrogenase and acetate kinase in phytoplasmas show a closer relatedness to the Firmicutes in comparison to Mycoplasma species indicating an early divergence of the Acholeplasmataceae from the Mollicutes.

Biological and molecular variation of Cherry leaf roll virus isolates from Malus domestica, Ribes rubrum, Rubus idaeus, Rumex obtusifolius and Vaccinium darrowii

Cherry leaf roll virus (CLRV) isolates from Malus domestica, Ribes rubrum, Rubus idaeus, Rumex obtusifolius and Vaccinium darrowii were characterized based on nucleotide sequences of a 371 bp fragment of the 3′ untranslated region (UTR) of their genomic RNAs, symptoms in the herbaceous hosts, Chenopodium amaranticolor, Chenopodium quinoa, Nicotiana benthamiana, Nicotiana occidentalis and Nicotiana tabacum, and seed transmission in N. occidentalis. The different isolates induced a range of localized and systemic disease symptoms, of varying severity, in the herbaceous hosts. The isolates from M. domestica, R. rubrum, R. obtusifolius and V. darrowii all showed greater than 80% seed transmission in N. occidentalis, but no seed transmission was observed for the R. idaeus isolate. Based on symptoms and seed transmission, the isolates appear to be biologically distinct strains of CLRV. Phylogenetic analysis of the nucleotide sequences from the 3′ UTR, commonly used to detect CLRV, showed that four isolates from M. domestica, R. rubrum, R. idaeus and V. darrowii were almost identical but an isolate from R. obtusifolius exhibited a pairwise nucleotide difference of up to 5·4% when compared to these isolates. There was no obvious correlation between sequence differences and symptomatology.

DETECTION OF FIG MOSAIC VIRUS IN VIRULIFEROUS ERIOPHYID MITE ACERIA FICUS

Fig leaves showing typical fig mosaic symptoms on cv. Bursa siyahi (donor plant) were cut under a stereo microscope into small pieces each hosting 10 putatively viruliferous eriophyid mites (Aceria ficus Cotte) and placed directly on the top leaves of healthy Cucumis sativus, Chenopodium quinoa. C. amaranticolor, Nicotiana occidentalis, Catharanthus roseus, Fraxinus excelsior plants, and fig seedlings. Donor and test plants were analyzed by electron microscopy, RT-PCR and sequencing, whereas the mites (ErMs) underwent molecular assays using Fig mosaic virus (FMV)-specific primers. Mite-infested leaves of fig seedlings and C. roseus showed small yellowish spots after 10 days and 6 weeks, respectively, whereas no symptoms were observed in other test or control plants for three months. Electron microscopy observations showed the occurrence of double membrane bodies (DMBs) in the palisade cells of donor and mite-inoculated fig plants, but not in C. roseus. However, 302 bp RT-PCR products specific to FMV were amplified from donor and inoculated figs, C. roseus and ErMs. Nucleotide identity with the sequence of the FMV isolate in GenBank (accession No. AM941711.6) was 87%, 89% and 87% for donor plant (JQ708183), inoculated fig seedlings (JQ708184) and C. roseus (JQ408437, JQ408438), respectively. The sequences obtained from ErMs (JQ408432, JQ408436) showed 87% and 88% nucleotide identity with the reference FMV isolate, respectively. When dsRNA extracts were analyzed to confirm virus presence in inoculated periwinkles, a complex dsRNA profile was obtained, suggestive of infection by a multipartite virus or by multiple viruses. Sequence from RT-PCR amplicons of dsRNA (JX040436) showed 88% identity with those the reference FMV isolate (AM941716.1) and the donor plant (JQ708183). According to these results, Madagascar periwinkle (C. roseus) can be retained as a new experimental host for FMV and A. ficus appears to be able to transmit FMV from fig to periwinkle plants.

Development of a full-length infectious clone of sunflower chlorotic mottle virus (SuCMoV)

A full-length cDNA clone (p35SuCMoV) of the sunflower chlorotic mottle virus common strain (SuCMoV-C) genomic RNA was constructed. Three cDNA fragments covering the whole genome of SuCMoV-C were cloned between a cauliflower mosaic virus 35S promoter and a nopaline synthase terminator. Mechanical inoculation of sunflower and Nicotiana occidentalis seedlings with p35SuCMoV DNA led to systemic infection. Symptoms induced by p35SuCMoV were similar to those caused by the wild-type SuCMoV-C but appeared four days later. Infection was confirmed by a western blot test, electron microscopy, RT-PCR and inoculation of progeny virions to sunflower seedlings. This is the first report about the construction of a biologically active, full-length cDNA copy of the SuCMoV-C RNA genome.

First Report of Bacilliform Badnavirus‐like Virus Particles in Red Clover

AbstractA virus detected in symptomatic Trifolium pratense L. plants in the Czech Republic had bacilliform virions which in thin sections occurred solely in phloem tissues and measured 220–500 nm by 30–31.5 nm. The virus was mechanically transmitted to Nicotiana occidentalis Wheeler, accession 37B. The partial nucleotide sequence (540 bp; accession number JX069965) with similarity to open reading frame III of the badnavirus genome was amplified from total genomic DNA, extracted from the plants. The new sequence had 74.4% nucleotide identity to that of Ananas comosus endogenous virus in the polyprotein gene covering reverse transcriptase. The results suggest that the Czech isolate from clover should be regarded as a new member of the genus Badnavirus, for which the name Red clover bacilliform virus is suggested. This is the first report of a tentative member of Badnavirus genus occurring in forage crops.

Genes in S and T Subgenomes Are Responsible for Hybrid Lethality in Interspecific Hybrids between Nicotiana tabacum and Nicotiana occidentalis

BackgroundMany species of Nicotiana section Suaveolentes produce inviable F1 hybrids after crossing with Nicotiana tabacum (genome constitution SSTT), a phenomenon that is often called hybrid lethality. Through crosses with monosomic lines of N. tabacum lacking a Q chromosome, we previously determined that hybrid lethality is caused by interaction between gene(s) on the Q chromosome belonging to the S subgenome of N. tabacum and gene(s) in Suaveolentes species. Here, we examined if hybrid seedlings from the cross N. occidentalis (section Suaveolentes)×N. tabacum are inviable despite a lack of the Q chromosome.Methodology/Principal FindingsHybrid lethality in the cross of N. occidentalis×N. tabacum was characterized by shoots with fading color. This symptom differed from what has been previously observed in lethal crosses between many species in section Suaveolentes and N. tabacum. In crosses of monosomic N. tabacum plants lacking the Q chromosome with N. occidentalis, hybrid lethality was observed in hybrid seedlings either lacking or possessing the Q chromosome. N. occidentalis was then crossed with two progenitors of N. tabacum, N. sylvestris (SS) and N. tomentosiformis (TT), to reveal which subgenome of N. tabacum contains gene(s) responsible for hybrid lethality. Hybrid seedlings from the crosses N. occidentalis×N. tomentosiformis and N. occidentalis×N. sylvestris were inviable.Conclusions/SignificanceAlthough the specific symptoms of hybrid lethality in the cross N. occidentalis×N. tabacum were similar to those appearing in hybrids from the cross N. occidentalis×N. tomentosiformis, genes in both the S and T subgenomes of N. tabacum appear responsible for hybrid lethality in crosses with N. occidentalis.

First Report of Cherry leaf roll virus in Hydrangea macrophylla.

Hydrangea is a popular, summer flowering, ornamental shrub that is native to south and east Asia and North and South America, which is now cultivated throughout the world. Currently, 13 viruses belonging to eight genera have been reported in Hydrangea spp. (1). In April 2011, virus-like disease symptoms, including severe leaf deformation and chlorosis, were observed on two Hydrangea macrophylla 'Sumiko' plants from Australia being held in quarantine in New Zealand. Systemic symptoms of veinal necrosis, necrotic halo spots, and severe leaf deformation were observed on Nicotiana occidentalis '37B' 7 days after inoculation with sap from the symptomatic hydrangea plants. Upon reinoculation with sap of symptomatic leaves from N. occidentalis, necrotic ringspots and tip necrosis, typical of nepovirus infection, were observed on leaves of N. tobacum and Chenopodium quinoa, respectively. Transmission electron microscopy of negatively stained sap from symptomatic leaves of N. occidentalis revealed the presence of isometric particles ~28 nm in diameter. Total nucleic acid was extracted from the symptomatic leaves of N. occidentalis with an InviMag Plant DNA Mini Kit (Invitek GmbH, Berlin, Germany) and a KingFisher mL workstation (Thermo Scientific, Waltham, MA). Reverse transcription (RT)-PCR using the reverse primer of Werner et al. (2) and a forward primer, 5'-CGGTGGAGATGCCGGTCCTA-3' (this study), specific to the 3'-untranslated region (3'-UTR) of Cherry leaf roll virus(CLRV) produced an amplicon of ~1,150 bp from N. occidentalis. A consensus sequence of 1,140 bp generated from four clones of the PCR product (GenBank Accession No. JN418885) was 99 and 98% identical at the nucleotide level to a CLRV isolate from Rumex AGBC (GenBank No. AB168099) and Chinese chives (GenBank No. AB168098), respectively. N. occidentalis also tested positive for CLRV using polyclonal antiserum in a double antibody sandwich-ELISA (BIOREBA, Reinach, Switzerland). The presence of CLRV in the original samples and N. occidentalis was confirmed by direct sequencing of the 380-bp amplicons obtained by immunocapture RT-PCR using CLRV-specific primers (2) and the same antiserum. BLASTn analysis of these amplicons (data not submitted to GenBank) also showed 99% nucleotide identity to a New Zealand isolate from a Rubus sp. (GenBank No. AJ877162). The hydrangea plants were released from quarantine because the same strain of CLRV had previously been reported in New Zealand. To our knowledge, this is the first report of CLRV in hydrangea. CLRV is a seed and pollenborne nepovirus and can be transmitted mechanically and by grafting. Since hydrangeas are mainly vegetatively propagated and are less commonly grown from seeds, the natural spread of CLRV will depend on the movement of infected propagation material. It is unknown whether this virus causes reduction in flower quality in hydrangea as reported in other hosts but any impact on flower quality may be of economic significance in commercial nurseries.

The 3'-proximal part of the Plum pox virus P1 gene determinates the symptom expression in two herbaceous host plants.

Three major strains of the Plum pox virus (PPV) are the most important in Europe: PPV-D, PPV-M, and PPV-Rec. By combining the genomes of two different strains of PPV (PPV-D with PPV-Rec; PPV-D with PPV-M), 20 inter-strain chimeric infectious clones (CICPPV) were constructed. Biological properties of CICPPV were tested by inoculating them on different herbaceous host species susceptible to PPV. Four of the seven species tested, exhibited visible symptoms. In Nicotiana benthamiana all CICPPV induced systemic mosaic and leaf malformation. Pisum sativum showed a broad range of symptom severity (systemic chlorotic and necrotic lesions) but neither qualitative nor quantitative aspects of symptomatology were related to a single PPV genome locus. Nicotiana occidentalis and Nicandra physaloides proved to be suitable for symptom-based differentiation. Depending on the virus strain/chimera, N. occidentalis showed two types of symptoms: mild systemic chlorotic spots or local necrotic lesions/systemic vein necroses. N. physaloides reacted to the PPV infection either symptomless or by local necrotic lesions. Our results demonstrated that the P1/HC-pro region of the PPV genome appears to be the determinant of the symptom manifestation in these host plants. In silico analysis mapped it to the 3'-proximal part of the P1 gene.

Detection and characterisation of two novel vitiviruses infecting Actinidia

Two co-infecting novel vitiviruses from Actinidia chinensis were identified from mechanically inoculated Nicotiana occidentalis. Both virus genomes were sequenced and share 64% nucleotide identity. Their overall structure is typical of vitiviruses, with five open reading frames (ORFs) and a polyadenylated 3' end. Open reading frame 4 (ORF4) encodes the coat protein, the most conserved gene of the vitiviruses, in which they share 75% amino acid identity, 61-68% with grapevine virus B, 55-59% with grapevine virus A, and 37-42% with grapevine virus E. Based on the molecular criteria for species demarcation in the family Betaflexiviridae, these are two novel viruses, tentatively named Actinidia virus A and Actinidia virus B.

Characterization of Cherry leafroll virus in Sweet Cherry in Washington State.

A visual survey in 1998 of a commercial block of 594 sweet cherry trees (Prunus avium) in Yakima County, WA, revealed three trees of cv. Bing growing on Mazzard rootstock that exhibited a progressive decline characterized by a premature drop of yellowed leaves prior to fruit maturity and small, late ripening cherries that were unsuitable for the fresh market. Many young branches of these trees died during the winter, resulting in a sparse, open canopy depleted of fruiting shoots. The budded variety of a fourth tree had died, allowing the F12/1 rootstock to grow leaves that showed intense line patterns. Prunus necrotic ringspot virus or Prune dwarf virus are common ilarviruses of cherry trees but were only detected by ELISA (Agdia, Elkhart, IN) in two of the Bing trees. A virus was readily transmitted mechanically from young leaves of each of the two ilarvirus-negative trees to Chenopodium quinoa and Nicotiana occidentalis strain '37B', which within 5 days, developed systemic mottle and necrotic flecking, respectively. Gel analysis of double-stranded RNA (dsRNA) isolated from C. quinoa revealed two abundant bands of approximately 6.5 and 8.0 kbp. The C. quinoa plants and the four symptomatic orchard trees were free of Arabis mosaic virus, Blueberry leaf mottle virus, Peach rosette mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tobacco ringspot virus, Tomato black ring virus, and Tomato ringspot virus when tested by ELISA. However, C. quinoa leaf extracts reacted positively in gel double diffusion assays with antiserum prepared to the cherry isolate of Cherry leafroll virus (CLRV) (2). A CLRV-specific primer (3) was used for first strand synthesis followed by self-primed second strand synthesis to generate cDNAs from the dsRNA. A consensus sequence of 1,094 bp generated from three clones of the 3'-untranslated region (3'-UTR) of CLRV (GenBank Accession No. GU362644) was 98% identical to the 3'-UTR of CLRV isolates from European white birch (GenBank Accession Nos. 87239819 and 87239633) and 96% identical to European CLRV isolates from sweet cherry (GenBank Accession Nos. 87239639 and 8729640) (1). Reverse transcription (RT)-PCR using primers specific for the 3'-UTR (CGACCGTGTAACGGCAACAG, modified from Werner et al. [3] and CACTGCTTGAGTCCGACACT, this study), amplified the expected 344-bp fragment from the original four symptomatic trees and two additional symptomatic trees in the same orchard. Seventy-two nonsymptomatic trees were negative by the RT-PCR for CLRV. In 1999, CLRV was detected by RT-PCR in six of eight samples and seven of eight samples from declining trees in two additional orchards located 2.5 km and 23.3 km from the original site, respectively. Sequences of the 344-bp amplicons from these sites were 99.7% identical to those obtained from the first site. To our knowledge, this is the first report of the natural occurrence of CLRV in sweet cherry in the United States. Unlike other nepoviruses, CLRV appears not to be nematode transmitted; however, since this virus can be seed and pollen borne in some natural and experimental systems, its presence in independent orchards of a major production region raises concern about its long term impact on sweet cherry production.

Identification and Partial Characterization of Viral Agent of Lettuce Big Vein in Tehran Province

Background and Aims: The causal agents of viral lettuce big vein disease are two viruse, Lettuce big vein associated virus (Varicosavirus) and Mirafiori lettuce virus (Ophiovirus). These viruses have coat proteins of similar size but have different morphologies and serologically unrelated.The purpose of this study was to distinguish and detect LBVaV and MiLV in lettuce fields in Tehran Province. Patients and Methods: A total 344 samples with mosaic and big vein, head stunt, leaf deformation and motteling symptoms were collected from lettuce fields in Tehran Province.Using DAS – ELISA and specific antiserum for MiLV (DSMZ, AS-0798) and RTPCR for LBVaV. Positive samples in ELISA and RT-PCR were inoculated on index plants,including Chenopodium quinoa, Chenopodium amaranticolor, Lactuca sativa and Nicotiana occidentalis p1. Results: The results of ELISA and RT-PCR about MiLV showed that, virus is transmitted on C.quinoa and produced chlorotic local lesion but about LBVaV, RT-PCR showed that C.quinoa and C.amaranticolor were infected and the virus caused chlorotic local lesion. Extraction of total RNA with three methods using RNAWIZ buffer, Guanidium isothiosianat buffer and Qiagen kit showed that exteraction with RNeasy plant minikit (Qiagen company) is better for RT-PCR. RT-PCR with LBVaV and MiLV specific primer pairs (were designed with Navaro et al. 2004) were performed and the fragment length were amplified for LBVaV and MiLV respectively 296bp and 469bp. The sequence nucleotides of CP of LBVaV was determined and had high similarity with other isolates in gene bank. Conclusion: This is the first report of occurrence of these viral diseases in lettuce in Iran (Tehran Province).

Replication of Grapevine leafroll-associated virus-7 (GLRaV-7) by Cuscuta Species and Its Transmission to Herbaceous Plants.

Grapevine leafroll-associated virus-7 (GLRaV-7) was transmitted from an Albanian grapevine accession to Tetragonia expansa by the parasitic dodder Cuscuta reflexa and to Nicotiana occidentalis by Cuscuta europea. Cuscuta campestris was infected by GLRaV-7 but could not transfer the virus to an experimental host. Transmission of the virus was verified by reverse transcription-polymerase chain reaction (RT-PCR) from total nucleic acid (TNA) and double-stranded RNA (dsRNA) extracts from all five plant species. DsRNA extractions separated on agarose gels showed strong visible bands corresponding to high-molecular-weight virus genome and to subgenomic RNA. GLRaV-7 was maintained in C. reflexa, C. campestris, T. expansa, and N. occidentalis for more than 4 years. Infected T. expansa and the Cuscuta species remained symptomless while N. occidentalis showed severe symptoms leading to stunting and decline of the plants. Quantitative PCR showed great differences in the titer of GLRaV-7 between the tissues of its natural and experimental host plants. This is the first report on a virus of the Closteroviridae that was successfully transmitted to an herbaceous plant by dodder. Virus replication could be demonstrated in Cuscuta. Both the new experimental hosts of GLRaV-7 and Cuscuta allowed extraction of dsRNA for further characterization of the viral genome, which previously required grapevine scraping of phloem. This is time-consuming and does not always lead to satisfactory results. These alternative hosts of GLRaV-7 facilitate nucleic acid extractions and could be used as model plants for etiological studies.

Complementation analysis of triple gene block of Potato virus S (PVS) revealed its capability to support systemic infection and aphid transmissibility of recombinant Potato virus X

Triple gene block (TGB) sequences derived from isolates of ordinary Potato virus S (PVS-O) and Chenopodium-systemic (PVS-CS) were analyzed. Although the TGB sequences did not reveal any specific difference within the 7K protein, some specific differences within the 25K and 12K ORFs were found. In order to investigate a possible functional divergence of PVS-O and PVS-CS TGB variants, these genes were propagated in chimeric Potato virus X (PVX). Both PVS TGB variants partly complemented PVX TGB in Nicotiana benthamiana. The recombinant viruses multiplied to lower titer than the wild-type PVX in N. benthamiana showed attenuated symptoms. Whereas the recombinant PVX variants were also propagated systemically in Nicotiana glutinosa, Celosia argentea, Nicotiana occidentalis and chimeric PVX bearing TGB from PVS-O in Solanum lycopersicum, neither were propagated systemically in Chenopodium quinoa nor in Nicotiana tabacum cv. Samsun nn and the PVX-resistant Solanum tuberosum cv. Szignal. The potential for recombinant viruses to be transmitted by the aphid Myzus persicae was investigated. Aphid transmission in the recombinant virus was obtained by replacing PVX TGB by TGB from the PVS-CS isolate. These results show the potential function of Carlavirus TGB in aphid transmissibility and underlines the possible biological risks from certain recombinant virus variants.