New Fungal Species Research Articles

РАЗРАБОТКА ЭКСПЕРИМЕНТАЛЬНОЙ ЛЕКАРСТВЕННОЙ ФОРМЫ ДЛЯ МЕСТНОГО ПРИМЕНЕНИЯ С ПРОТИВОГРИБКОВЫМ ДЕЙСТВИЕМ

Currently, mycoses are one of the urgent health problems. According to WHO, up to 1/3 of the world's population suffers from fungal pathologies. Currently, fungal infections are becoming increasingly difficult to treat, which is associated both with the identification of new species of fungi that were previously considered non-pathogenic, and with the development of resistance of pathogens to available medicines. The problem of mycoses is becoming more urgent due to the variety of pathways of transmission of pathogens and their high resistance in the external environment, changes in the immune response of the human body. Therefore, it is so important to expand the range and constantly improve the compositions and forms of antifungal agents. The substance of the silver salt pyrazole-3-carboxamide (SSP) synthesized in PGFA showed antifungal activity, which allowed it to be included in the experimental mild dosage form. The purpose of this study is to develop an experimental mild dosage form based on the silver salt of pyrazole–3-carboxamide for topical use in candidiasis dermatomycosis and to evaluate its antifungal activity. Materials and methods. The pharmacologically active component is the pharmaceutical substance of the silver salt N-{4-[(1,3-thiazole-2-yl)sulfamoyl]phenyl}-1-phenyl-5-(4-ethoxyphenyl)pyrazole-3-carboxamide. The antifungal activity of the compound was studied by double serial dilutions in a liquid nutrient medium in relation to reference strains of fungi of the genus Candida: Candida albicans NCTC 885-653, Candida krusei RCPGU-1472/310, Candida glabrata RCPGU-1485/47. To determine the antifungal activity of an experimental mild dosage form in relation to a typical strain of fungi of the genus Candida, a three-nesting variant of the agar diffusion method was used. Statistical processing of the results of chemical studies was carried out according to generally accepted methods using standard EXCEL computer programs. Results and discussion. As a result of the conducted research, the composition of an experimental mild dosage form based on the silver salt of pyrazole-3-carboxamide has been substantiated and developed. A technology for the manufacture of ointment has been developed to ensure the quality of the dosage form, its therapeutic activity and stability. Conclusion. Based on technological and microbiological studies, an experimental mild dosage form based on the silver salt of pyrazole-3-carboxamide has been developed with the aim of further introduction into medical practice for the local treatment of dermatomycosis after appropriate studies.

Mycoremediation of Acetaminophen by the Fungi of Dothideomycetes sp. Isolate

Resources like air, water, and land are found to be contaminated by a broad variety of pharmaceutical contaminants. The release of industrial effluents, hospital wastewater, and untreated domestic water, which contains medications, colours, pharmaceutical blisters, and heavy metals that are ecotoxic even at concentrations of nanograms to micrograms, is a significant cause of water pollution. Mycoremediation is an operative approach is to detoxify these contaminants. The fungal strain was isolated from pharma industrial wastewater. Identification of the fungi was founded on the morphological and 18s rRNA sequencingtechnique. Isolate shared 99.82 % similarity with Zasmidium cellare and Cladosporium iridis strain CBS 138.40, suggesting the new species of fungi. The strain has received Gen bank accession number of OR081620.1. The fungal strain was found to degrade 85% of acetaminophen (1000 ppm) in 10 days when grown in mineral salt medium with acetaminophen as only carbon source. Glucose was found to enhance sporulation potential but not the degradative potential of the fungi. Identification of biodegradative metabolite was done by using thin layer chromatography, high performance liquid chromatography and liquid chromatography-mass spectroscopy. Mycodegradative metabolite of 4 Aminophenol was identified as acetaminophen.

An inexpensive moist chamber culture technique for finding microbiota on live tree bark.

Traditional moist chamber cultures (MCs) prepared in aseptic laboratory environments using sterile Petri dishes are commonly used to quantify the microbiota of rough-bark tree species and woody vines. MCs are typically expensive and may be difficult to make, so a less expensive option made from easily available supplies was developed. These cost-friendly MCs were compared with standard laboratory methods to demonstrate their efficacy. Modified MCs were made using inexpensive, store-bought supplies; compared to a standard laboratory setting, the modified MCs are shown to be less expensive with a faster setup time and larger size that facilitates a variety of tree and woody vine species. MC use resulted in the discovery of new species of fungi and myxomycetes with associated locality records. We provide detailed instructions for creating modified MCs, as well as a list of myxomycete species and their associated bark characteristics, pH values, and water-holding capacity. This new, low-cost MC technique makes the study of microbiota more inclusive and accessible for those in research laboratories, classrooms, and homes, including both amateurs and professionals. MCs are easy to prepare, versatile, and applicable for many areas of botany and the biological sciences, potentially allowing exploration into unexplored areas in urban ecosystems.

Molecular phylogeny and morphology reveal two new graminicolous species, Curvularia aurantiasp. nov. and C. vidyodayana sp. nov. with new records of Curvularia spp. from Sri Lanka.

Despite being a small island, Sri Lanka is rich in fungal diversity. Most of the fungi from Sri Lanka have been identified as pathogens of vegetables, fruits, and plantation crops to date. The pleosporalean genus Curvularia (Dothideomycetes) includes phytopathogenic, saprobic, endophytic, and human/animal opportunistic pathogenic fungal species. The majority of the plant-associated Curvularia species are known from poaceous hosts. During the current study, 22 geographical locations of the country were explored and collections were made from 10 different poaceous hosts. Morphology and molecular phylogeny based on three loci, including nuclear internal transcribed spacers 1 and 2 with 5.8S nrDNA (ITS), glyceraldehyde-3-phosphate dehydrogenase (gapdh), and translation elongation factor 1-α (tef1) supported the description of two new species of fungi described herein as C. aurantia sp. nov. and C. vidyodayana sp. nov. Moreover, novel host-fungal association records for C. chiangmaiensis, C. falsilunata, C. lonarensis, C. plantarum, and C. pseudobrachyspora are updated herein. In addition, five species within the genus Curvularia, viz., C. asiatica, C. geniculata, C. lunata, C. muehlenbeckiae, and C. verruculosa represent new records of fungi from Sri Lanka. Citation: Ferdinandez HS, Manamgoda DS, Udayanga D, Munasinghe MS, Castlebury LA (2023). Molecular phylogeny and morphology reveal two new graminicolous species, Curvularia aurantia sp. nov. and C. vidyodayana sp. nov. with new records of Curvularia spp. from Sri Lanka. Fungal Systematics and Evolution 12: 219-246. doi: 10.3114/fuse.2023.12.11.

Ash Dieback in Forests and Rural Areas—History and Predictions

Ash trees are an important component of both forests and the countryside. Emerging new diseases like ash dieback poses new challenges to Fraxinus spp., which not only have to adapt to global warming but also defend themselves against new threats from pathogenic fungi and insect pests. A new species of fungus, Hymenoscyphus fraxineus, has arrived in Europe from Asia and has severely damaged shoots which alters the structure of ash tree crowns. While some older trees have survived, younger trees are dying en masse, so the only hope is that the surviving trees will produce a younger generation that may be more resistant to the new diseases. The fine roots of ash trees are also attacked by pathogenic oomycetes, and others by Armillaria spp. The current stressed condition of ash trees in Europe is exacerbated by a new threat from insects. Agrillus planipennis, emerald ash borer, migrating from the east (from near Moscow airport) towards the borders of the European Union, killing thousands of ash trees on its way. This raises the question of future prospects for ash cultivation in Europe. This article takes a closer look at the information described in the literature.

New Species of Corticioid Fungi (Basidiomycota) for Poland Found in Białowieża Primeval Forest in 2018‒2020

Eight new species of fungi (Acanthobasidium norvegicum, Amylocorticium laceratum, Hyphoderma transiens, Odonticium septocystidiatum, Phlebia cretacea, Ph. subulata, Steccherinum albidum, and Tubulicrinis calothrix) were identified for Poland after a study of collections from large forests situated in the northeast part of the country. Leptosporomyces fuscostratus was confirmed for Polish mycobiota. Main diagnostic features, natural range, substratum preferences, and taxonomic position of these species are discussed. Color images of basidiomata for 9 species, line drawings of microscopic structures for 6 species, and scanning electron microscopy images of important microstructures for 4 species are provided.

First Report of Diaporthe ambigua Associated with Dead Arm Disease on Grapevine in Chile.

Grapevine (Vitis vinifera L.) is one of the most important fruit crops in Chile based on economic value. Phaeomoniella chlamydospora and Botryosphaeriaceae species have been reported as the major causal agents associated with dieback symptoms in Chile commercial vineyards (Díaz and Latorre 2014; Besoain, 2018; Larach et al. 2020). Recently Eutypa lata has been reported attacking Chilean vineyards with dieback symptoms (Lolas et al. 2020). In this study, two commercial cv. Cabernet Sauvignon vineyards, located in O'Higgins Region of Chile, showing dead cordons, dead spur with a grayish color, canker, and vascular necrosis were sampled in fall 2018, with a high incidence of symptoms was observed. Four symptomatic wood samples were analyzed from these vineyards. Pieces of wood (<1 cm2) were taken from the advance zone of the canker lesions, disinfected with 70% ethanol, rinsed in sterile distilled water, dried, and transferred to two media in Petri plates, potato dextrose agar acidified with 0.5 ml of 96% lactic acid (APDA) and malt extract agar, and incubated for at least seven days at 24°C in darkness. From mycelium obtained from monosporic culture, two isolates were selected and morphologically identified as Diaporthe sp. To induce sporulation, these two isolates were grown in APDA under near-ultraviolet light (λ = 320 nm) at room temperature. After 30 days, the development of pycnidia was observed. Both Diaporthe sp. isolate presented alpha-conidia ellipsoidal with an obtuse apex, biguttulate (n=30) of 6.7 µm ± 0.33 µm x 3.3 µm ± 0.32 µm. No Beta-conidia or perhitecia were observed. DNA was extracted from the monosporic mycelium. The ribosomal internal transcribed spacer (ITS), β-tubulin (BT) gene, and elongation factor (EF) gene were amplified using ITS4/ITS5, Bt2a/Bt2b, and EF1-728F/EF1-986R primer pairs, respectively. PCR products were sequenced and identified as Diaporthe ambigua Nitschke (PUCV2140 and PUCV2141), showing 100% sequence identity with ITS MH864620.1, 99.8% with BT MG281142.1, and 100% with EF KC343738.1 sequences from D. ambigua. Sequences were deposited in GenBank (ITS: accession numbers MW301136, MW301137; BT: MW323445, MW323446 and EF: MW308305, MW308306). Two pathogenicity tests were performed with strains PUCV2140 and PUCV2141 using 2-year-old V.vinifera cv. Cabernet Sauvignon. In each test, three plants were used per isolate, considering one plant as an experimental unit. In the first test, a 5 mm mycelial plug from a 6-day-old APDA culture was inoculated using an oblique cut made in the bark with a sterile scalpel and done at the middle of the trunk. In the second test, the trial was done under the same described conditions previously, but in this case, one-year-old semi-lignified shoots were inoculated between two internodes, using mycelial plugs, one shoot for each plant. Injured plants but treated with sterile APDA plugs were used as controls. Plants were placed in natural conditions, and after three months from inoculations, plants showed a cortical canker and brown vascular lesions. Non-inoculated plants remained asymptomatic. The lengths of the cankers were 22.0 ± 1.8 mm and 10.5 ± 0.6 mm, after inoculations of the trunk and cane, respectively. The vascular lesions were 37.0 ± 3.3 and 18.0 ± 2.0 mm, in trunk and cane inoculations, respectively. D. ambigua was re-isolated and reidentified morphologically from the inoculated symptomatic plants, confirming Koch's postulate. Also, the plants inoculated on the trunk showed premature leaf drop. To our knowledge, this is the first report of D. ambigua associated with dieback affecting grapevines in Chile. Previous D. ambigua was reported causing fruit rots (Auger et al. 2013; Díaz et al. 2017) and cordon dieback in kiwifruit (Díaz and Latorre, 2018), and stem canker and dieback in blueberry (Elfar et al. 2013) in Chile. This study reports a new species of fungi for Chile associated with the dead arm in vineyards. D. ambigua is a pathogen in essential crops in our country. Therefore, it is important to study its prevalence in the future.

Characterization of fungal biodiversity and communities associated with the reef macroalga Sargassum ilicifolium reveals fungal community differentiation according to geographic locality and algal structure

Marine environments abound with opportunities to discover new species of fungi even in relatively well-studied ecosystems such as coral reefs. Here, we investigated the fungal communities associated with the canopy forming macroalga Sargassum ilicifolium(Turner) C. Argardh (1820) in Singapore. We collected eight S. ilicifolium thalli from each of eight island locations and separated them into three structures—leaves, holdfast and vesicles. Amplicon sequencing of the fungal internal transcribed spacer 1 (ITS1) and subsequent analyses revealed weak but significant differences in fungal community composition from different structures. Fungal communities were also significantly different among sampling localities, even over relatively small spatial scales (≤ 12 km). Unsurprisingly, all structures from all localities were dominated by unclassified fungi. Our findings demonstrate the potential of marine environments to act as reservoirs of undocumented biodiversity that harbour many novel fungal taxa. These unclassified fungi highlight the need to look beyond terrestrial ecosystems in well-studied regions of the world, and to fully characterize fungal biodiversity in hotspots such as Southeast Asia for better understanding the roles they play in promoting and maintaining life on our planet.

Isolasi dan Karakterisasi Fungi Selulolitik dari Tanah Gambut Cagar Biosfer Giam Siak Kecil-Bukit Batu, Riau

Fungi is primary microorganism which produced cellulase enzyme. Cellulase was catalyzed cellulose from plants or organic waste in enzymatic reaction to be glucose, cellobiose and short polysaccharide. Cellulolytic fungi were isolated from Giam Siak Kecil-Bukit Batu (GSKBB) biosphere reserve. GSKBB is a natural peat swamp forest, with a peat bed reaching up to 9.2 m. Peat swamp forest is a potential source for new species of fungi which produced cellulase in low pH and very good activity because peat swamp forest had been many cellulose and acid pH. Fungi strain was assigned as RH01 at Aspergillus for genus based on microscopy analysis. Index cellulolytic of RH01 was 2.31 and cellulase activity had values of 0.0125 U/mL.

Origin of Cave Fungi.

Karst caves are obviously characterized by darkness, constantly low temperature, high humidity, and oligotrophy. Previous studies revealed that Karst caves have a high and specific bio-diversity. A large number of troglobiont animals had been discovered and their evolution and speciation have been well investigated. However, the origin and evolution of cave fungi remain unknown. In a previous study, we have identified 20 new species, which accounted for 49% of the total number of new species of fungi ever described from caves. In this study, we inferred the divergence times of these 20 new species and compared to the cave formation geologic age. The fossil-calibrated molecular clock showed that the divergence times of these 20 suspected troglobitic fungi are between late Miocene (7.2 Mya for Metapochonia variabilis) and late Jurassic (158 Mya for Gymnoascus exasperates). While based on the historical geological movement and the paleoclimate of Guizhou, it has been estimated that the development of caves in this area was later than middle Pliocene (3.5–4 Mya). It is therefore concluded that the new species described from these caves are unlikely troglobitic fungi but travelers from other environments. The geographic history of caves appeared to be too short for fungal speciation.

Fungi from Admiralty Bay (King George Island, Antarctica) Soils and Marine Sediments.

Extreme environments such as the Antarctic can lead to the discovery of new microbial taxa, as well as to new microbial-derived natural products. Considering that little is known yet about the diversity and the genetic resources present in these habitats, the main objective of this study was to evaluate the fungal communities from extreme environments collected at Aldmiralty Bay (Antarctica). A total of 891 and 226 isolates was obtained from soil and marine sediment samples, respectively. The most abundant isolates from soil samples were representatives of the genera Leucosporidium, Pseudogymnoascus, and a non-identified Ascomycota NIA6. Metschnikowia sp. was the most abundant taxon from marine samples, followed by isolates from the genera Penicillium and Pseudogymnoascus. Many of the genera were exclusive in marine sediment or terrestrial samples. However, representatives of eight genera were found in both types of samples. Data from non-metric multidimensional scaling showed that each sampling site is unique in their physical-chemical composition and fungal community. Biotechnological potential in relation to enzymatic production at low/moderate temperatures was also investigated. Ligninolytic enzymes were produced by few isolates from root-associated soil. Among the fungi isolated from marine sediments, 16 yeasts and nine fungi showed lipase activity and three yeasts and six filamentous fungi protease activity. The present study permitted increasing our knowledge on the diversity of fungi that inhabit the Antarctic, finding genera that have never been reported in this environment before and discovering putative new species of fungi.

Identification and Characterization of Fusarium proliferatum, a New Species of Fungi that Cause Fungal Keratitis

Fusarium proliferatum (F. proliferatum) is known as a pathogen of corn and other crops, but its role in fungal keratitis has not been well investigated. Among 877 Fusarium isolates, we identified 155 (17.7%) stains as F. proliferatum according to their morphological features and partial DNA sequencing of translation elongation factor-1alpha (EF-1alpha ) in this study. In vitro antifungal susceptibility tests showed that the F. proliferatum strains were sensitive to natamycin and vorionazole but resistant to amphotericin B, fluconazol, ketoconazole and itaconazole. Most of the F. proliferatum-positive keratitis patients (44/155,28.4%) were aged 51–60 years old. The main cause of infection was injury by a plant (51/155, 32.9%). A combination of 1% amphotericin B and 3% ketoconazole cured 45.2% (14/31) and a combination of 0.5% natamycin and 0.5% voriconazole cured 59.1% (13/22) of F. proliferatum-positive patients. The date suggests that F. proliferatum identified through EF-1ɑ DNA sequencing is an important new species that causes fungal keratitis. Based on antifungal susceptibility, treatment with a combination of 0.5% natamycin and 0.5% voriconazole improves the therapeutic efficacy in F. prolifertum-positive patients.

Pilaira australis sp. nov. (Mucorales, Mucoromycota) isolated from emu faeces in Australia

Pilaira australis, a new species of fungus in the coprophilous genus Pilaira, was isolated from emu (Dromaius novaehollandiae) faeces and is described. Morphologically, the species resembles other species in the genus, particularly P. moreaui, except differs in its unique combination of sporangiophore height and sporangiospore length. Molecular phylogenetic analysis indicates that P. australis is distinct from other species in the genus with two regions, the internal transcribed spacers (ITS) and a fragment of the pyrG gene, showing 91% and 90% identity to the nearest species, respectively. Ultrastructure features and carbon utilisation were determined for P. australis, and may provide characteristics for species identification in this genus.

Discussion on related problems of model species of fungus： Paecilomyces hepialid

Paecilomyces hepiali is a new species of fungus isolated from a field collection of Ophiocordyceps sinensis from Baima snow mountain, Diqing Tibetan Autonomous Prefecture, Yunnan Province by the Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences. The specimen was identified and named as Paecilomyces hepiali by Qing-Tao Chen, the professor of the Institute of Microbiology, Chinese Academy of Sciences (Paecilomyces hepiali) (2008), who identified a dried culture of living strain 82-2 as the holotype. Until now, the holotype (the voucher specimen) was deposited in the Herbarium of the Institute of Chinese Materia Medica (HICMM), China Academy of Chinese Medical Sciences, Beijing. The P. hepiali neotype designated by the paper "Neotypification of P. hepiali (Hypocreales)" published in TAXON 64 (1) by Yao Yi-Jian et al. in February 2015 is untenable.

Fungal colonization of the rooting system of the early land plantAsteroxylon mackieifrom the 407-Myr-old Rhynie Chert (Scotland, UK)

Associations between plants and fungi were an important and varied feature of early terrestrial ecosystems, but in most instances their biological functions remain poorly understood. We document a new species of fungus colonizing the rooting system of the early lycopod Asteroxylon mackiei, based on exceptionally well-preserved fossils from the Rhynie Chert. We investigated historical petrographic thin sections using standard optical microscopy and confocal laser scanning microscopy. Palaeozoosporites renaultii gen. nov., sp. nov. colonized the inner cortex of the plant rooting system. The fungus had an aseptate thallus with isotomous or sympodial branching. The mycelium bore distinctive porate, globose to elongated structures that we interpret as zoosporangia and resting sporangia. Doubts remain over the precise systematic affinity of P. renaultii, which closely resembles chytrids. Whereas most of the Rhynie Chert plants developed symbiotic associations of the mycorrhizal type, it seems that this was not the case for Asteroxylon mackiei, which possessed the most evolved rooting system among the Rhynie Chert plants. We argue that the new root-borne fungus was probably parasitic. © 2015 The Linnean Society of London, Botanical Journal of the Linnean Society, 2015, 179, 201–213.

An elusive ectomycorrhizal fungus reveals itself: a new species of Geopora (Pyronemataceae) associated with Pinus edulis

Species of the genus Geopora are important ectomycorrhizal associates that can dominate the communities of some plant taxa, such as pinyon pine (Pinus edulis), a widespread tree of the western United States. Several members of the genus Geopora are known only from ectomycorrhizal root tips and thus have not been described formally. The sporocarps of some Geopora species occur infrequently because they depend on wet years for sporulation. In addition, Geopora sporocarps can be small and may be hypogeous at some developmental stage, limiting the opportunities for describing their morphology. Using molecular and morphological data, we have described a new species of fungus, Geopora pinyonensis, which produced ascocarps after unusually high precipitation at a northern Arizona site in summer 2012. Based on analysis of the ITS and nuLSU regions of the rDNA, G pinyonensis is a new species of Geopora. It has small sporocarps and ascospores relative to other members of the genus; however, these morphological features overlap with other species. Using rDNA data from sporocarps and ectomycorrhizal root tips, we show that the sporocarps correspond to an abundant species of ectomycorrhizal fungus associated with pinyon pines that is increasing in abundance in drought-affected landscapes and may promote drought tolerance.

MycoCosm portal: gearing up for 1000 fungal genomes

MycoCosm is a fungal genomics portal (http://jgi.doe.gov/fungi), developed by the US Department of Energy Joint Genome Institute to support integration, analysis and dissemination of fungal genome sequences and other ‘omics’ data by providing interactive web-based tools. MycoCosm also promotes and facilitates user community participation through the nomination of new species of fungi for sequencing, and the annotation and analysis of resulting data. By efficiently filling gaps in the Fungal Tree of Life, MycoCosm will help address important problems associated with energy and the environment, taking advantage of growing fungal genomics resources.

Three new black mildews from Kerala, India

The new species of fungi, Asterina mananthavadiensis and Meliola ficigena infected the leaves of Argyreia sp. and Ficus sp., respectively, have been described and illustrated in detail. The teleomorph of Asterostomula has been discovered and has been accommodated in a novel species of the genus Prillieuxina.

Light Sensing in Aspergillus fumigatus Highlights the Case for Establishing New Models for Fungal Photobiology

ABSTRACTMicrobes inhabit diverse environmental locations, and many species need to shift their physiology between different niches. To do this effectively requires the accurate sensing of and response to the environment. For pathogens, exposure to light is one major change between a free-living saprophyte lifestyle and causation of disease within the host. However, how light may act as a signal to influence pathogenesis, on the side of either the host or the pathogen, is poorly understood. Research during the last 2 decades has uncovered aspects about the machinery for light sensing in a small number of fungi. Now, Fuller et al. have initiated studies into the role that light and two photosensor homologs play in the behavior of the ubiquitous fungal pathogen Aspergillus fumigatus [K. K. Fuller, C. S. Ringelberg, J. J. Loros, and J. C. Dunlap, mBio 4(2):e00142-13, 2013, doi:10.1128/mBio.00142-13]. Light represses the germination of A. fumigatus spores and enhances resistance to ultraviolet light, oxidative stresses, and cell wall perturbations. The phenotypes of the strains with mutations in the LreA and FphA homologs revealed that these sensors control some, but not all, responses to light. Furthermore, interactions occur between blue and red light signaling pathways, as has been described for a related saprophytic species, Aspergillus nidulans. Genome-wide transcript analyses found that about 2.6% of genes increase or decrease their transcript levels in response to light. This use of A. fumigatus establishes common elements between model filamentous species and pathogenic species, underscoring the benefits of extending photobiology to new species of fungi.

Detection and quantification of Aspergillus westerdijkiae in coffee beans based on selective amplification of β-tubulin gene by using real-time PCR

Aspergillus westerdijkiae is a new species of fungus that was recently dismembered from Aspergillus ochraceus taxon. Most isolates of A. westerdijkiae are able to produce large amounts of a mycotoxin called ochratoxin A (OA). OA has been found in food and beverages, such as coffee. A. westerdijkiae is very similar to A. ochraceus, and several isolates previously identified as A. ochraceus are now identified as A. westerdijkiae. By using sequences of the β-tubulin gene, we analyzed several isolates from Brazilian coffee bean samples, previously identified as A. ochraceus, to compare with those of A. westerdijkiae. In fact, most (84%) were identified as A. westerdijkiae. Since this species consistently produces large amounts of OA, we developed a specific primer-pair for detecting and quantifying it in coffee beans by using real-time PCR. The primers Bt2Aw-F 5′TGATACCTTGGCGCTTGTGACG and Bt2Aw-R 5′CGGAAGCCTAAAAAATGAAGAG provided an amplicon of 347 bp in all A. westerdijkiae isolates, and no cross-reaction was observed using DNA from A. ochraceus. The sensitivity of real-time PCR was more than 100 times higher than the cfu technique.