Neurovirulent Virus Research Articles

Polyglutamine Repeats in Viruses.

This review explores the presence and functions of polyglutamine (polyQ) in viral proteins. In mammals, mutations in polyQ segments (and CAG repeats at the nucleotide level) have been linked to neural disorders and ataxias. PolyQ regions in normal human proteins have documented functional roles, in transcription factors and, more recently, in regulating autophagy. Despite the high frequency of polyQ repeats in eukaryotic genomes, little attention has been given to the presence or possible role of polyQ sequences in virus genomes. A survey described here revealed that polyQ repeats occur rarely in RNA viruses, suggesting that they have detrimental effects on virus replication at the nucleotide or protein level. However, there have been sporadic reports of polyQ segments in potyviruses and in reptilian nidoviruses (among the largest RNA viruses known). Conserved polyQ segments are found in the regulatory control proteins of many DNA viruses. Variable length polyQ tracts are found in proteins that contribute to transmissibility (cowpox A-type inclusion protein (ATI)) and control of latency (herpes viruses). New longer-read sequencing methods, using original biological samples, should reveal more details on the presence and functional role of polyQ in viruses, as well as the nucleotide regions that encode them. Given the known toxic effects of polyQ repeats, the role of these segments in neurovirulent and tumorigenic viruses should be further explored.Electronic supplementary materialThe online version of this article (10.1007/s12035-018-1269-4) contains supplementary material, which is available to authorized users.

Mutation of I176R in the E coding region weakens Japanese encephalitis virus neurovirulence, but not its growth rate in BHK-21 cells.

Previously, we isolated the Japanese encephalitis virus (JEV) strain SCYA201201. In this study, we passed the SCYA201201 strain in Syrian baby hamster kidney (BHK-21) cells 120 times to obtain the SCYA201201-0901 strain, which exhibited an attenuated phenotype in mice. Comparison of SCYA201201-0901 amino acid sequences with those of other JEV strains revealed a single mutation, I176R, in the E coding region. Using reverse genetic technology, we provide evidence that this single E-I176R mutation does not affect virus growth in BHK-21 cells but significantly decreases JEV neurovirulence in mice. This study provides critical information for understanding the molecular mechanism of JEV attenuation.

Restricted Infection and Cytokine Expression in Primary Murine Astrocytes Induced by the H5N1 Influenza Virus

Central nervous system (CNS) dysfunction caused by infection with neurovirulent viruses is of interest, and may play an important role in many neurodegenerative diseases. Since neuronal functions are believed to be partly regulated by cytokines produced by astrocytes, neuroinflammation and neurodegeneration caused by H5N1 influenza virus infection could be due to abnormal cytokine production of those infected astrocytes. In the present study, cytokine responses of murine astrocytes following H5N1 virus infection were investigated. Primary astrocytes from neonatal outbred ICR mice were isolated and used to investigate cytopathology upon infection with the H5N1 virus (A/Chicken/Thailand/CUK2/04). Thereafter, cell lysates at 6, 24, 48, and 72 hours-post infection (hpi) were collected and subjected to quantification of cytokine gene expression, including TNF-α, IL-1β, IL-2, IL-6 and IL-12β, by quantitative RT-PCR. The results revealed that infection with the H5N1 virus in primary murine astrocytes was restricted, and resulted in abortive virus infection. However, this abortive infection in the astrocytes was found to result in significant upregulation of IL-1β mRNA expression at 72 hpi compared with the mock-infected group, while the mRNA expression of IL-2 and IL-12β was observed to have undergone significant down-regulation at 6-72 hpi and 24-48 hpi, respectively. The results of the present study could support the role of astrocytes in neuroinflammation and neurodegeneration.

Interferon regulated gene (IRG) expression-signature in a mouse model of chikungunya virus neurovirulence

Interferon regulated genes (IRGs) are critical in controlling virus infections. Here, we analyzed the expression profile of IRGs in the brain tissue in a mouse model of chikungunya virus (CHIKV) neurovirulence. Neurovirulence is one of the newer complications identified in disease caused by re-emerging strains of CHIKV, an alphavirus with positive-strand RNA in the Togaviridae family. In microarray analysis, we identified significant upregulation of 269 genes, out of which a predominant percentage (76%) was IRGs. The highly modulated IRGs included Ifit1, Ifi44, Ddx60, Usp18, Stat1, Rtp4, Mnda, Gbp3, Gbp4, Gbp7, Oasl2, Oas1g, Ly6a, Igtp, and Gbp10, along with many others exhibiting lesser changes in expression levels. We found that these IRG mRNA transcripts are modulated in parallel across CHIKV-infected mouse brain tissues, human neuronal cell line IMR-32 and hepatic cell line Huh-7. The genes identified to be highly modulated both in mouse brain and human neuronal cells were Ifit1, Ifi44, Ddx60, Usp18, and Mnda. In Huh-7 cells, however, only two IRGs (Gbp4 and Gbp7) showed a similar level of upregulation. Concordant modulation of IRGs in both mice and human cells indicates that they might play important roles in regulating CHIKV replication in the central nervous system (CNS). The induction of several IRGs in CNS during infection underscores the robustness of IRG-mediated innate immune response in CHIKV restriction. Further studies on these IRGs would help in evolving possibilities for their targeting in host-directed therapeutic interventions against CHIKV.

High-Coverage Whole-Exome Sequencing Identifies Candidate Genes for Suicide in Victims with Major Depressive Disorder

We carried out whole-exome ultra-high throughput sequencing in brain samples of suicide victims who had suffered from major depressive disorder and control subjects who had died from other causes. This study aimed to reveal the selective accumulation of rare variants in the coding and the UTR sequences within the genes of suicide victims. We also analysed the potential effect of STR and CNV variations, as well as the infection of the brain with neurovirulent viruses in this behavioural disorder. As a result, we have identified several candidate genes, among others three calcium channel genes that may potentially contribute to completed suicide. We also explored the potential implication of the TGF-β signalling pathway in the pathogenesis of suicidal behaviour. To our best knowledge, this is the first study that uses whole-exome sequencing for the investigation of suicide.

Impact of caspase-1/11, -3, -7, or IL-1\u03b2/IL-18 deficiency on rabies virus-induced macrophage cell death and onset of disease

Rabies virus is a highly neurovirulent RNA virus, which causes about 59000 deaths in humans each year. Previously, we described macrophage cytotoxicity upon infection with rabies virus. Here we examined the type of cell death and the role of specific caspases in cell death and disease development upon infection with two laboratory strains of rabies virus: Challenge Virus Standard strain-11 (CVS-11) is highly neurotropic and lethal for mice, while the attenuated Evelyn–Rotnycki–Abelseth (ERA) strain has a broader cell tropism, is non-lethal and has been used as an oral vaccine for animals. Infection of Mf4/4 macrophages with both strains led to caspase-1 activation and IL-1β and IL-18 production, as well as activation of caspases-3, -7, -8, and -9. Moreover, absence of caspase-3, but not of caspase-1 and -11 or -7, partially inhibited virus-induced cell death of bone marrow-derived macrophages. Intranasal inoculation with CVS-11 of mice deficient for either caspase-1 and -11 or -7 or both IL-1β and IL-18 led to general brain infection and lethal disease similar to wild-type mice. Deficiency of caspase-3, on the other hand, significantly delayed the onset of disease, but did not prevent final lethal outcome. Interestingly, deficiency of caspase-1/11, the key executioner of pyroptosis, aggravated disease severity caused by ERA virus, whereas wild-type mice or mice deficient for either caspase-3, -7, or both IL-1β and IL-18 presented the typical mild symptoms associated with ERA virus. In conclusion, rabies virus infection of macrophages induces caspase-1- and caspase-3-dependent cell death. In vivo caspase-1/11 and caspase-3 differently affect disease development in response to infection with the attenuated ERA strain or the virulent CVS-11 strain, respectively. Inflammatory caspases seem to control attenuated rabies virus infection, while caspase-3 aggravates virulent rabies virus infection.

Highly Neurovirulent Viruses Invade and Spread in the Brain Using the Host Reactions Triggered by Infection

Coronaviruses (CoVs) have relatively high mutation and RNA recombination rates and undergo rapid crossspecies transmission events in vitro and in vivo. The viruses have evolved diverse strategies to evade, blocking host immune responses, and resulting in an emergence of highly virulent CoVs to cause fatal diseases in human, such as severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS). Among CoVs used for experimental studies, the cl-2 virus (cl-2), isolated from a neuropathogenic JHM viral strain (JHMV) of mouse hepatitis virus (MHV), shows extremely high virulence. All mice infected with cl-2 die within 3 days post-inoculation (dpi). Less virulent but still highly neurovirulent mutant viruses, soluble receptor resistant mutant virus (srr7) and Mu-3 virus (Mu-3), have been isolated from cl-2 and srr7, respectively. Although these viruses cause different pictures of neuropathologies with different distribution of viral antigens after infection, they use the same pathway to enter the brain before inducing lesions in the brain parenchyma. The pathway is formed as an astrocytic reticular network (ARN) after infection. The ARN functions as a conduit system in a similar way to a fibroblastic reticular network (FRN) in lymphoid organs. In addition, the viruses induce an immunosuppressive state in infected mice, mimicking endotoxin tolerance (ET), or lipopolysaccharide (LPS) tolerance. The immunosuppressive states are detected by; 1) pathological findings as 1a); a very low -level inflammatory response, 1b); the shrunken spleen, 1c); the refractory state to LPS challenge, and 1d); the local production of anti-inflammatory cytokines by neurons, and by 2) immunological studies, which showed 2a); the systemic production of anti-inflammatory cytokines by eliciting CD11b+Gra-1+ suppressor monocytes/macrophages (Mo/Mas).In addition, cultured splenic cells and Mo/Mas after infection exhibit 2b); low-level responses to stimulation of toll-like receptors (TLRs) 4 and 7, and 2c); the induction of Lewis X carbohydrate structure (Lex), which can trigger the C-type lectin-like receptor that initiates an immunosuppressive pathway, respectively.

Sindbis Virus Can Exploit a Host Antiviral Protein To Evade Immune Surveillance.

Sindbis virus, a prototypic member of the Alphavirus genus, has been used to study the pathogenesis of acute viral encephalitis in mice for many years. How the virus evades immune surveillance to establish effective infection is largely unknown. ZAP is a host antiviral factor that potently inhibits Sindbis virus replication in cell culture. We show here that infection of ZAP knockout suckling mice with an SVNI led to faster disease progression. However, SVNI infection of weanling mice led to slower disease progression in knockout mice. Further analyses revealed that in weanling knockout mice, SVNI replicated more efficiently in lymphoid tissues at early times postinfection and induced higher levels of interferon production, which restricted viral spread to the central nervous system. These results uncover a mechanism by which SVNI exploits a host antiviral factor to evade innate immune surveillance and allow enhanced neuroinvasion.

Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8% identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7%) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

Enhanced antagonism of BST-2 by a neurovirulent SIV envelope.

Current antiretroviral therapy (ART) is not sufficient to completely suppress disease progression in the CNS, as indicated by the rising incidence of HIV-1-associated neurocognitive disorders (HAND) among infected individuals on ART. It is not clear why some HIV-1-infected patients develop HAND, despite effective repression of viral replication in the circulation. SIV-infected nonhuman primate models are widely used to dissect the mechanisms of viral pathogenesis in the CNS. Here, we identified 4 amino acid substitutions in the cytoplasmic tail of viral envelope glycoprotein gp41 of the neurovirulent virus SIVsm804E that enhance replication in macrophages and associate with enhanced antagonism of the host restriction factor BM stromal cell antigen 2 (BST-2). Rhesus macaques were inoculated with a variant of the parental virus SIVsmE543-3 that had been engineered to contain the 4 amino acid substitutions present in gp41 of SIVsm804E. Compared with WT virus-infected controls, animals infected with mutant virus exhibited higher viral load in cerebrospinal fluid. Together, these results are consistent with a potential role for BST-2 in the CNS microenvironment and suggest that BST-2 antagonists may serve as a possible target for countermeasures against HAND.

MicroRNA-based control of tick-borne flavivirus neuropathogenesis: Challenges and perspectives

In recent years, microRNA-targeting has become an effective strategy for selective control of tissue-tropism and pathogenicity of both DNA and RNA viruses. Previously, we reported the successful application of this strategy to control the neurovirulent phenotype of a model chimeric tick-borne encephalitis/dengue type 4 virus (TBEV/DEN4), containing the structural protein genes of a highly virulent TBEV in the genetic backbone of non-neuroinvasive DEN4 virus. In the present study, we investigated the suitability of this approach for the attenuation of the more neurovirulent chimeric virus (TBEV/LGTV), which is based on the genetic backbone of the naturally attenuated member of the TBEV serocomplex, a Langat virus (LGTV). Unlike the TBEV/DEN4, the TBEV/LGTV virus retained the ability of its parental viruses to spread from the peripheral site of inoculation to the CNS. We evaluated ten potential sites in the 3′NCR of the TBEV/LGTV genome for placement of microRNA (miRNA) targets and found that the TBEV/LGTV genome is more restrictive for such genetic manipulations compared to TBEV/DEN4. In addition, unlike TBEV/DEN4 virus, the introduction of multiple miRNA targets into either the 3′NCR or ORF of the TBEV/LGTV genome had only a modest effect on virus attenuation in the developing CNS of highly permissive newborn mice. However, simultaneous miRNA-targeting in the ORF and 3′NCR had synergistic effect on control and silencing of virus replication in the brain and completely abolished the virus neurotropism. Furthermore, neuroinvasiveness of miRNA-targeted TBEV/LGTV viruses in very sensitive immunodeficient SCID mice was significantly limited. Immunocompetent animals immunized with such viruses were completely protected against challenge with the neurovirulent LGTV parent. These findings support the rationale of the miRNA-targeting approach to develop live attenuated virus vaccines against various neurotropic viruses.

Ecotropic Murine Leukemia Virus Infection of Glial Progenitors Interferes with Oligodendrocyte Differentiation: Implications for Neurovirulence.

Certain murine leukemia viruses (MLVs) are capable of inducing fatal progressive spongiform motor neuron disease in mice that is largely mediated by viral Env glycoprotein expression within central nervous system (CNS) glia. While the etiologic mechanisms and the glial subtypes involved remain unresolved, infection of NG2 glia was recently observed to correlate spatially and temporally with altered neuronal physiology and spongiogenesis. Since one role of NG2 cells is to serve as oligodendrocyte (OL) progenitor cells (OPCs), we examined here whether their infection by neurovirulent (FrCasE) or nonneurovirulent (Fr57E) ecotropic MLVs influenced their viability and/or differentiation. Here, we demonstrate that OPCs, but not OLs, are major CNS targets of both FrCasE and Fr57E. We also show that MLV infection of neural progenitor cells (NPCs) in culture did not affect survival, proliferation, or OPC progenitor marker expression but suppressed certain glial differentiation markers. Assessment of glial differentiation in vivo using transplanted transgenic NPCs showed that, while MLVs did not affect cellular engraftment or survival, they did inhibit OL differentiation, irrespective of MLV neurovirulence. In addition, in chimeric brains, where FrCasE-infected NPC transplants caused neurodegeneration, the transplanted NPCs proliferated. These results suggest that MLV infection is not directly cytotoxic to OPCs but rather acts to interfere with OL differentiation. Since both FrCasE and Fr57E viruses restrict OL differentiation but only FrCasE induces overt neurodegeneration, restriction of OL maturation alone cannot account for neuropathogenesis. Instead neurodegeneration may involve a two-hit scenario where interference with OPC differentiation combined with glial Env-induced neuronal hyperexcitability precipitates disease. A variety of human and animal retroviruses are capable of causing central nervous system (CNS) neurodegeneration manifested as motor and cognitive deficits. These retroviruses infect a variety of CNS cell types; however, the specific role each cell type plays in neuropathogenesis remains to be established. The NG2 glia, whose CNS functions are only now emerging, are a newly appreciated viral target in murine leukemia virus (MLV)-induced neurodegeneration. Since one role of NG2 glia is that of oligodendrocyte progenitor cells (OPCs), we investigated here whether their infection by the neurovirulent MLV FrCasE contributed to neurodegeneration by affecting OPC viability and/or development. Our results show that both neurovirulent and nonneurovirulent MLVs interfere with oligodendrocyte differentiation. Thus, NG2 glial infection could contribute to neurodegeneration by preventing myelin formation and/or repair and by suspending OPCs in a state of persistent susceptibility to excitotoxic insult mediated by neurovirulent virus effects on other glial subtypes.

Opportunistic DNA Recombination With Epstein-Barr Virus at Sites of Control Region Rearrangements Mediating JC Virus Neurovirulence

We document a unique DNA recombination between polyomavirus JC (JC virus [JCV]) and Epstein-Barr virus (EBV) at sequences of JCV found infecting the brain. Archetype JCV is present in bone marrow and uroepithelial cells of most adults. During immunosuppression, JCV can infect the brain, causing a demyelinating disease, progressive multifocal leukoencephalopathy. Rearrangements in the archetype noncoding control region are necessary for neurovirulence. Two NCCR deletions and a duplication occur at sequences of homology with EBV, present latently in B cells, which may be coinfected with both viruses. Recombination between JCV and EBV occurs in B lymphoblasts at a sequence essential for JCV neurovirulence and in cerebrospinal fluid of immunosuppressed patients with multiple sclerosis, those susceptible to progressive multifocal leukoencephalopathy. Interviral recombination is a model for conferring advantages on JCV in the brain. It can alter a critical noncoding control region sequence and potentially facilitate use of EBV DNA abilities to transfer among different cell types.

Tropism and Induction of Cytokines in Human Embryonic-Stem Cells-Derived Neural Progenitors upon Inoculation with Highly- Pathogenic Avian H5N1 Influenza Virus.

Central nervous system (CNS) dysfunction caused by neurovirulent influenza viruses is a dreaded complication of infection, and may play a role in some neurodegenerative conditions, such as Parkinson-like diseases and encephalitis lethargica. Although CNS infection by highly pathogenic H5N1 virus has been demonstrated, it is unknown whether H5N1 infects neural progenitor cells, nor whether such infection plays a role in the neuroinflammation and neurodegeneration. To pursue this question, we infected human neural progenitor cells (hNPCs) differentiated from human embryonic stem cells in vitro with H5N1 virus, and studied the resulting cytopathology, cytokine expression, and genes involved in the differentiation. Human embryonic stem cells (BG01) were maintained and differentiated into the neural progenitors, and then infected by H5N1 virus (A/Chicken/Thailand/CUK2/04) at a multiplicity of infection of 1. At 6, 24, 48, and 72 hours post-infection (hpi), cytopathic effects were observed. Then cells were characterized by immunofluorescence and electron microscopy, supernatants quantified for virus titers, and sampled cells studied for candidate genes.The hNPCs were susceptible to H5N1 virus infection as determined by morphological observation and immunofluorescence. The infection was characterized by a significant up-regulation of TNF-α gene expression, while expressions of IFN-α2, IFN-β1, IFN-γ and IL-6 remained unchanged compared to mock-infected controls. Moreover, H5N1 infection did not appear to alter expression of neuronal and astrocytic markers of hNPCs, such as β-III tubulin and GFAP, respectively. The results indicate that hNPCs support H5N1 virus infection and may play a role in the neuroinflammation during acute viral encephalitis.

Is a multivalent hand, foot, and mouth disease vaccine feasible?

Enterovirus A infections are the primary cause of hand, foot and mouth disease (HFMD) in infants and young children. Although enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16) are the predominant causes of HFMD epidemics worldwide, EV-A71 has emerged as a major neurovirulent virus responsible for severe neurological complications and fatal outcomes. HFMD is a serious health threat and economic burden across the Asia-Pacific region. Inactivated EV-A71 vaccines have elicited protection against EV-A71 but not against CV-A16 infections in large efficacy trials. The current development of a bivalent inactivated EV-A71/CV-A16 vaccine is the next step toward that of multivalent HFMD vaccines. These vaccines should ultimately include other prevalent pathogenic coxsackieviruses A (CV-A6 and CV-A10), coxsackieviruses B (B3 and B5) and echovirus 30 that often co-circulate during HFMD epidemics and can cause severe HFMD, aseptic meningitis and acute viral myocarditis. The prospect and challenges for the development of such multivalent vaccines are discussed.

Capillaries in the olfactory bulb but not the cortex are highly susceptible to virus-induced vascular leak and promote viral neuroinvasion.

Viral neuroinvasion is a critical step in the pathogenesis of viral encephalitis. Multiple mechanisms of neuroinvasion have been identified, but their relative contribution to central nervous system (CNS) infection remains unclear for many viruses. In this study, we examined neuroinvasion of the mosquito-borne bunyavirus La Crosse (LACV), the leading cause of pediatric viral encephalitis in the USA. We found that the olfactory bulb (OB) and tract were the initial areas of CNS virus infection in mice. Removal of the OB reduced the incidence of LACV-induced disease demonstrating the importance of this area to neuroinvasion. However, we determined that infection of the OB was not due to axonal transport of virus from olfactory sensory neurons as ablation of these cells did not affect viral pathogenesis. Instead, we found that OB capillaries were compromised allowing leakage of virus-sized particles into the brain. Analysis of OB capillaries demonstrated specific alterations in cytoskeletal and Rho GTPase protein expression not observed in capillaries from other brain areas such as the cortex where leakage did not occur. Collectively, these findings indicate that LACV neuroinvasion occurs through hematogenous spread in specific brain regions where capillaries are prone to virus-induced activation such as the OB. Capillaries in these areas may be "hot spots" that are more susceptible to neuroinvasion not only for LACV, but other neurovirulent viruses as well.

Function of the Herpes Simplex Virus 1 Small Capsid Protein VP26 Is Regulated by Phosphorylation at a Specific Site.

Replacement of the herpes simplex virus 1 small capsid protein VP26 phosphorylation site Thr-111 with alanine reduced viral replication and neurovirulence to levels observed with the VP26 null mutation. This mutation reduced VP26 expression and mislocalized VP26 and its binding partner, the major capsid protein VP5, in the nucleus. VP5 mislocalization was also observed with the VP26 null mutation. Thus, we postulate that phosphorylation of VP26 at Thr-111 regulates VP26 function in vitro and in vivo.

Transolfactory neuroinvasion by viruses threatens the human brain.

Viral neuroinvasion via the olfactory system has been investigated in a variety of virus-animal models by scientists in many fields including virologists, pathologists, and neurologists. In humans, herpes simplex virus type 1 (HSV-1), human herpesvirus 6 (HHV-6), Borna disease virus, rabies virus, and influenza A virus have been shown to take the olfactory route for neuroinvasion based on forensic and post-mortem specimens. This article briefly summarizes the anatomy, physiology, and immunology of the olfactory system and presents a battery of neurovirulent viruses that may threaten the human brain by invading through this peripheral pathway, especially focusing on two of the most intensively studied viruses--HSV-1 and influenza A virus. Viruses may insidiously invade the olfactory neural network not only to precipitate encephalitis/encephalopathy but also to promote the development of neurodegenerative and demyelinating disorders. Substantial information obtained by analyzing human specimens is required to argue for or against this hypothesis.

Accumulation of defective interfering viral particles in only a few passages in Vero cells attenuates mumps virus neurovirulence

Immunization programs have implemented live attenuated mumps vaccines which reduced mumps incidence ≥97%. Some of the vaccine strains were abandoned due to unwanted side effects and the genetic marker of attenuation has not been identified so far. Our hypothesis was that non-infectious viral particles, in particular defective interfering particles (DIPs), contribute to neuroattenuation. We showed that non-infectious particles of the mumps vaccine L-Zagreb attenuated neurovirulence of wild type mumps virus 9218/Zg98. Then, we attenuated recent wild type mumps virus MuVi/Zagreb.HRV/28.12 in Vero cells through 16 passages but already the fifth passage (p5) showed accumulation of DIPs and attenuated neurovirulence in a newborn rat model when compared to the second passage (p2). Sequence analysis of the p2 and p5 revealed a single mutation in the 5′ untranslated region of the HN gene. Analysis of the expression level of the HN protein showed that this mutation does not affect the expression of the protein. We conclude that the passages of MuVi/Zagreb.HRV/28.12 in Vero cells for only three passages accumulated DIPs which attenuate neurovirulence.These findings reveal DIPs as a very promising and general neuroattenuating factor which should be considered in the rational design of the new mumps vaccine.

A substitution in nsP1 combined with a double substitution in E2 glycoprotein renders Sindbis-like virus XJ-160 fully neurovirulent for adult mice

Sindbis virus (SV) can be rendered neurovirulent for adult mice by a double substitution within the E2 glycoprotein, including replacing Gln at position 55 of E2 with a His (E2-55: Gln–His) and E2-70: Glu to Lys. However, the mutant Sindbis-like virus XJ-160 with the double substitution (BR-E5570) does not show neurovirulence for adult mice, although the mutant apparently reduced the average survival time of neonatal mice. To produce an XJ-160 virus neurovirulent for adult mice, the BR-E5570 virus containing the double substitution was provided with another substitution in the nsP1 region (nsP1-173: Thr–Ile), which could enhance viral infectivity and neurovirulence for neonatal mice. The mutant containing these three substitutions was accordingly designated as BR-5570-ns173. Like the BR-XJ160 virus derived from the wild-type clone, BR-E5570 and BR-E5570-ns173 were both virulent for newborn mice, between which BR-E5570-ns173 virus showed the greatest neurovirulence. Furthermore, only BR-E5570-ns173 virus was fully neurovirulent for 14-day-old mice, and this fatal adult mouse-virulence was dependent on the E2 double substitutions at positions 55 and 70. Compared with BR-XJ160, both the mutants showed a higher capacity for propagation both in cultured cells and in the mouse brain. In particular, BR-E5570-ns173 virus showed a more persistent existence and higher titer in the brains of 7-day-old mice. These findings indicate that the substitution at nsP1-173 combination with a double substitution in the E2 region renders the XJ-160 virus fully neurovirulent for adult mice, and this neurovirulence may be related to the increased efficiency and persistence of propagation of this virus.