Neural Crest-derived Cells Research Articles

CCN2/CTGF promotor activity in the developing and adult mouse eye

CCN2/CTGF is a matricellular protein that is known to enhance transforming growth factor-β signaling and to induce a myofibroblast-like phenotype in a variety of cell types. Here, we investigated Ccn2/Ctgf promotor activity during development and in the adult mouse eye, using CTGFLacZ/+ mice in which the β-galactosidase reporter gene LacZ had been inserted into the open reading frame of Ccn2/Ctgf. Promotor activity was assessed by staining for β-galactosidase activity and by immunolabeling using antibodies against β-galactosidase. Co-immunostaining using antibodies against glutamine synthetase, glial fibrillary acidic protein, choline acetyltransferase, and CD31 was applied to identify specific cell types. Ccn2/Ctgf promotor activity was intense in neural crest-derived cells differentiating to corneal stroma and endothelium, and to the stroma of choroid, iris, ciliary body, and the trabecular meshwork during development. In the adult eye, a persistent and very strong promotor activity was present in the trabecular meshwork outflow pathways. In addition, endothelial cells of Schlemm’s canal, and of retinal and choroidal vessels, retinal astrocytes, Müller glia, and starburst amacrine cells were stained. Very strong promoter activity was seen in the astrocytes of the glial lamina at the optic nerve head. We conclude that CCN2/CTGF signaling is involved in the processes that govern neural crest morphogenesis during ocular development. In the adult eye, CCN2/CTGF likely plays an important role for the trabecular meshwork outflow pathways and the glial lamina of the optic nerve head.

MYCN Function in Neuroblastoma Development.

Dysregulated expression of the transcription factor MYCN is frequently detected in nervous system tumors such as childhood neuroblastoma. Here, gene amplification of MYCN is a single oncogenic driver inducing neoplastic transformation in neural crest-derived cells. This abnormal MYCN expression is one of the strongest predictors of poor prognosis. It is present at diagnosis and is never acquired during later tumorigenesis of MYCN non-amplified neuroblastoma. This suggests that increased MYCN expression is an early event in these cancers leading to a peculiar dysregulation of cells that results in embryonal or cancer stem-like qualities, such as increased self-renewal, apoptotic resistance, and metabolic flexibility.

Exosomes derived from stem cells from apical papilla promote craniofacial soft tissue regeneration by enhancing Cdc42-mediated vascularization

BackgroundReconstruction of complex critical-size defects (CSD) in the craniofacial region is a major challenge, and soft tissue regeneration is crucial in determining the therapeutic outcomes of craniofacial CSD. Stem cells from apical papilla (SCAP) are neural crest-derived mesenchymal stem cells (MSCs) that are homologous to cells in craniofacial tissue and represent a promising source for craniofacial tissue regeneration. Exosomes, which contain compound bioactive compounds, are the key factors in stem cell paracrine action. However, the roles of exosomes derived from SCAP (SCAP-Exo) in tissue regeneration are not fully understood. Here, we explored the effects and underlying mechanisms of SCAP-Exo on CSD in maxillofacial soft tissue.MethodsSCAP-Exo were isolated and identified by transmission electron microscopy and nanoparticle tracking analysis. The effects of SCAP-Exo on wound healing and vascularization were detected by measuring the wound area and performing histological and immunofluorescence analysis on the palatal gingival CSD of mice. Real-time live-cell imaging and functional assays were used to assess the effects of SCAP-Exo on the biological functions of endothelial cells (ECs). Furthermore, the molecular mechanisms of SCAP-Exo-mediated EC angiogenesis in vitro were tested by immunofluorescence staining, Western blot, and pull-down assays. Finally, in vivo experiments were carried out to verify whether SCAP-Exo could affect vascularization and wound healing through cell division cycle 42 (Cdc42).ResultsWe found that SCAP-Exo promoted tissue regeneration of palatal gingival CSD by enhancing vascularization in the early phase in vivo and that SCAP-Exo improved the angiogenic capacity of ECs in vitro. Mechanistically, SCAP-Exo elevated cell migration by improving cytoskeletal reorganization of ECs via Cdc42 signalling. Furthermore, we revealed that SCAP-Exo transferred Cdc42 into the cytoplasm of ECs and that the Cdc42 protein could be reused directly by recipient ECs, which resulted in the activation of Cdc42-dependent filopodium formation and elevation in cell migration of ECs.ConclusionThis study demonstrated that SCAP-Exo had a superior effect on angiogenesis and effectively promoted craniofacial soft tissue regeneration. These data provide a new option for SCAP-Exo to be used in a cell-free approach to optimize tissue regeneration in the clinic.

From the Basis of Epimorphic Regeneration to Enhanced Regenerative Therapies.

Current cell-based therapies to treat degenerative diseases such as osteoarthritis (OA) fail to offer long-term beneficial effects. The therapeutic effects provided by mesenchymal stem cell (MSC) injection, characterized by reduced pain and an improved functional activity in patients with knee OA, are reported at short-term follow-up since the improved outcomes plateau or, even worse, decline several months after MSC administration. This review tackles the limitations of MSC-based therapy for degenerative diseases and highlights the lessons learned from regenerative species to comprehend the coordination of molecular and cellular events critical for complex regeneration processes. We discuss how MSC injection generates a positive cascade of events resulting in a long-lasting systemic immune regulation with limited beneficial effects on tissue regeneration while in regenerative species fine-tuned inflammation is required for progenitor cell proliferation, differentiation, and regeneration. Finally, we stress the direct or indirect involvement of neural crest derived cells (NCC) in most if not all adult regenerative models studied so far. This review underlines the regenerative potential of NCC and the limitations of MSC-based therapy to open new avenues for the treatment of degenerative diseases such as OA.

Dissecting human embryonic skeletal stem cell ontogeny by single-cell transcriptomic and functional analyses

Human skeletal stem cells (SSCs) have been discovered in fetal and adult long bones. However, the spatiotemporal ontogeny of human embryonic SSCs during early skeletogenesis remains elusive. Here we map the transcriptional landscape of human limb buds and embryonic long bones at single-cell resolution to address this fundamental question. We found remarkable heterogeneity within human limb bud mesenchyme and epithelium, and aligned them along the proximal–distal and anterior–posterior axes using known marker genes. Osteo-chondrogenic progenitors first appeared in the core limb bud mesenchyme, which give rise to multiple populations of stem/progenitor cells in embryonic long bones undergoing endochondral ossification. Importantly, a perichondrial embryonic skeletal stem/progenitor cell (eSSPC) subset was identified, which could self-renew and generate the osteochondral lineage cells, but not adipocytes or hematopoietic stroma. eSSPCs are marked by the adhesion molecule CADM1 and highly enriched with FOXP1/2 transcriptional network. Interestingly, neural crest-derived cells with similar phenotypic markers and transcriptional networks were also found in the sagittal suture of human embryonic calvaria. Taken together, this study revealed the cellular heterogeneity and lineage hierarchy during human embryonic skeletogenesis, and identified distinct skeletal stem/progenitor cells that orchestrate endochondral and intramembranous ossification.

Selective Cryolysis of Melanocytes: Critical Temperature and Exposure Time to Induce Selective Pigmentary Loss in Yucatan Pig Skin.

Cryotherapy for melanocytic lesions is often accompanied by collateral damage tothe surrounding skin, resulting in skin necrosis and scarring. Adipocytes, like melanocytes, are neural crest-derived cells. Adipocytes have been shown to be more sensitive to cold exposure than their neighboring cells of ectodermal origin, such as epidermal keratinocytes. Such differential sensitivity to cold exposure has led to the development of novel treatment modalities, like cryolipolysis, to selectively target a cell type while sparing neighboring cells. In this study, we investigated the roles of controlled skin freezing, tissue temperature, and exposure time in inducing selective loss of melanocytes and skin depigmentation in swines. The results of our study demonstrated that contact cooling of the skin surface causes selective loss of epidermal melanocytes when the tissue temperature reaches -7.5°C or cooler with an exposure time of 10 minutes or longer, leading to partial skin depigmentation in swine skin. Longer exposures combined with colder temperature exposure led to more complete depigmentation in the treated skin surface. Cold-sensitivity of melanocytes can be harnessed to selectively remove melanocytes while sparing surrounding keratinocytes. The results from this study demonstrated that improved clinical treatments specifically targeting melanocytic lesions is possible using skin cooling to achieve tissue temperatures capable of inducing selective loss of melanocytes without skin necrosis or scarring. Additional studies are needed to optimize the treatment conditions to prolong the selective removal of melanocytes. Lasers Surg. Med. © 2020 Wiley Periodicals LLC.

Induced genetic ablation of Rest leads to the alteration of stimulus-induced response of the vagal nerve.

Rest (RE1-silencing transcription factor, also called Nrsf) is involved in the maintenance of the undifferentiated state of neuronal stem/progenitor cells by preventing precocious expression of neuronal genes. In order to further investigate the function of Rest in neurons, we generated and examined mice evoking genetic ablation of Rest specifically in neural tissues by generating Rest conditional knockout mice. As the Rest knockout mice are embryonically lethal, we used a Sox1-Cre allele to excise the floxed Rest gene from the early stage of nerve cell differentiation including neural crest-derived nerve cells. Using this conditional Rest knockout Sox1-Cre; Restflox/flox mice, we have revealed the role of Rest in the parasympathetic nervous system in the stomach and heart.

The MITF paralog tfec is required in neural crest development for fate specification of the iridophore lineage from a multipotent pigment cell progenitor.

Understanding how fate specification of distinct cell-types from multipotent progenitors occurs is a fundamental question in embryology. Neural crest stem cells (NCSCs) generate extraordinarily diverse derivatives, including multiple neural, skeletogenic and pigment cell fates. Key transcription factors and extracellular signals specifying NCSC lineages remain to be identified, and we have only a little idea of how and when they function together to control fate. Zebrafish have three neural crest-derived pigment cell types, black melanocytes, light-reflecting iridophores and yellow xanthophores, which offer a powerful model for studying the molecular and cellular mechanisms of fate segregation. Mitfa has been identified as the master regulator of melanocyte fate. Here, we show that an Mitf-related transcription factor, Tfec, functions as master regulator of the iridophore fate. Surprisingly, our phenotypic analysis of tfec mutants demonstrates that Tfec also functions in the initial specification of all three pigment cell-types, although the melanocyte and xanthophore lineages recover later. We show that Mitfa represses tfec expression, revealing a likely mechanism contributing to the decision between melanocyte and iridophore fate. Our data are consistent with the long-standing proposal of a tripotent progenitor restricted to pigment cell fates. Moreover, we investigate activation, maintenance and function of tfec in multipotent NCSCs, demonstrating for the first time its role in the gene regulatory network forming and maintaining early neural crest cells. In summary, we build on our previous work to characterise the gene regulatory network governing iridophore development, establishing Tfec as the master regulator driving iridophore specification from multipotent progenitors, while shedding light on possible cellular mechanisms of progressive fate restriction.

Tracking the movement of individual avian neural crest cells in vitro.

The origin, migratory pathways and adult derivatives of neural crest cells (NCCs) are well known. However, less is known about how these cells migrate. In this study, in a laboratory based in a low-resource setting, a hanging drop culture assay was utilised to study the movement of individual avian trunk neural crest cells. Mode of migration by means of lamellipodia and filopodia was studied in live cell cultures with a laser scanning confocal microscope and Airyscan module. Both distance migrated and speed of migration were calculated. NCCs migrated in a chain soon after emerging from the explanted neural tube, but were more dispersed and had random movements when they reached the periphery of the culture. While the distances travelled by these NCCs were less and the cells were slower on gelatine than on other extracellular matrices reported in the literature, the assay afforded detailed observation of actin filament distribution and cytoplasmic protrusions. The study has provided unique evidence of individual NCC movements in vitro, in a simple hanging drop assay optimized for the study of NCCs. The assay could be used for further analysis of the behaviour of NCCs on different extracellular matrices or with targeted action.

Isolation of Skeletal Muscle-derived Cells Modeling Neural Crest-derived Stem Cells for Therapeutic use in Regenerative Periodontology

Isolation of Skeletal Muscle-derived Cells Modeling Neural Crest-derived Stem Cells for Therapeutic use in Regenerative Periodontology

Modeling Early Neural Crest Development via Induction from hiPSC-Derived Neural Plate Border-like Cells.

Neural crest cells (NCCs) are a multipotent and transient cell population that gives rise to many important tissues during human embryogenesis. Disturbances that occur during NCCs development may lead to numerous types of diseases and syndromes, which are called neurocristopathies. NCCs in vitro modeling enables the access to cellular, genetic, and biochemical information about the neural crest development and its derivatives. By using cells derived from patients with neurocristopathies it is possible to study the cellular and genetic mechanisms behind each disease in a specific and trustworthy manner, as well as to contribute to the development of prospective treatments. Here, we describe a protocol of 19days, capable of efficiently generating NCCs from human induced pluripotent stem cells (hiPSCs). This differentiation process recapitulates the intermediate stage of neural plate border-like cells (NBCs), the epithelial to mesenchymal transition (EMT), and enables further generation of NCCs derivatives, such as Schwann cells, smooth muscle cells, melanocytes, peripheral neurons, adipocytes, osteoblasts, and chondrocytes.

Trio cooperates with Myh9 to regulate neural crest-derived craniofacial development.

Trio is a unique member of the Rho-GEF family that has three catalytic domains and is vital for various cellular processes in both physiological and developmental settings. TRIO mutations in humans are involved in craniofacial abnormalities, in which patients present with mandibular retrusion. However, little is known about the molecular mechanisms of Trio in neural crest cell (NCC)-derived craniofacial development, and there is still a lack of direct evidence to assign a functional role to Trio in NCC-induced craniofacial abnormalities.Methods: In vivo, we used zebrafish and NCC-specific knockout mouse models to investigate the phenotype and dynamics of NCC development in Trio morphants. In vitro, iTRAQ, GST pull-down assays, and proximity ligation assay (PLA) were used to explore the role of Trio and its potential downstream mediators in NCC migration and differentiation.Results: In zebrafish and mouse models, disruption of Trio elicited a migration deficit and impaired the differentiation of NCC derivatives, leading to craniofacial growth deficiency and mandibular retrusion. Moreover, Trio positively regulated Myh9 expression and directly interacted with Myh9 to coregulate downstream cellular signaling in NCCs. We further demonstrated that disruption of Trio or Myh9 inhibited Rac1 and Cdc42 activity, specifically affecting the nuclear export of β-catenin and NCC polarization. Remarkably, craniofacial abnormalities caused by trio deficiency in zebrafish could be partially rescued by the injection of mRNA encoding myh9, ca-Rac1, or ca-Cdc42.Conclusions: Here, we identified that Trio, interacting mostly with Myh9, acts as a key regulator of NCC migration and differentiation during craniofacial development. Our results indicate that trio morphant zebrafish and Wnt1-cre;Triofl/fl mice offer potential model systems to facilitate the study of the pathogenic mechanisms of Trio mutations causing craniofacial abnormalities.

Phenotypic and functional comparison of rat enteric neural crest-derived cells during fetal and early-postnatal stages.

In our previous study, we showed that with increasing time in culture, the growth characteristics of enteric neural crest-derived cells (ENCCs) change, and that the proliferation, migration and neural differentiation potential of these cells in vitro notably diminish. However, there are no studies on the developmental differences in these characteristics between fetal and early-postnatal stages in vitro or in vivo. In this study, we isolated fetal (embryonic day 14.5) and postnatal (postnatal day 2) ENCCs from the intestines of rats. Fetal ENCCs had greater maximum cross-sectional area of the neurospheres, stronger migration ability, and reduced apoptosis, compared with postnatal ENCCs. However, fetal and postnatal ENCCs had a similar differentiation ability. Fetal and postnatal ENCCs both survived after transplant into a rat model of Hirschsprung's disease. In these rats with Hirschsprung's disease, the number of ganglionic cells in the myenteric plexus was higher and the distal intestinal pressure change was greater in animals treated with fetal ENCCs compared with those treated with postnatal ENCCs. These findings suggest that, compared with postnatal ENCCs, fetal ENCCs exhibit higher survival and proliferation and migration abilities, and are therefore a more appropriate seed cell for the treatment of Hirschsprung's disease. This study was approved by the Animal Ethics Committee of the Second Affiliated Hospital of Xi'an Jiaotong University (approval No. 2016086) on March 3, 2016.

Umbilical artery tissue contains p75 neurotrophin receptor-positive pericyte-like cells that possess neurosphere formation capacity and neurogenic differentiation potential.

IntroductionThe p75 neurotrophin receptor (p75NTR) is known as an efficient marker for the prospective isolation of mesenchymal stem cells (MSCs) and neural crest-derived stem cells (NCSCs). To date, there is quite limited information concerning p75NTR-expressing cells in umbilical cord (UC), although UC is known as a rich source of MSCs. We show for the first time the localization, phenotype, and functional properties of p75NTR+ cells in UC.MethodsHuman UC tissue sections were subjected to immunohistochemistry for MSC markers including p75NTR. Enzymatically isolated umbilical artery (UA) cells containing p75NTR+ cells were assessed for immunophenotype, clonogenic capacity, and differentiation potential. To identify the presence of neural crest-derived cells in the UA, P0-Cre/Floxed-EGFP reporter mouse embryos were used, and immunohistochemical analysis of UC tissue was performed.ResultsImmunohistochemical analysis revealed that p75NTR+ cells were specifically localized to the subendothelial area of the UA and umbilical vein. The p75NTR+ cells co-expressed PDGFRβ, CD90, CD146, and NG2, phenotypic markers of MSCs and pericytes. Isolated UA cells possessed the potential to form neurospheres that further differentiated into neuronal and glial cell lineages. Genetic lineage tracing analysis showed that EGFP+ neural crest-derived cells were detected in the subendothelial area of UA with p75NTR immunoreactivity.ConclusionsThese results show that UA tissue harbors p75NTR+ pericyte-like cells in the subendothelial area that have the capacity to form neurospheres and the potential for neurogenic differentiation. The lineage tracing data suggests the p75NTR+ cells are putatively derived from the neural crest.

Sox10-cre BAC transgenes reveal temporal restriction of mesenchymal cranial neural crest and identify glandular Sox10 expression

Diversity of neural crest derivatives has been studied with a variety of approaches during embryonic development. In mammals Cre-LoxP lineage tracing is a robust means to fate map neural crest relying on cre driven from regulatory elements of early neural crest genes. Sox10 is an essential transcription factor for normal neural crest development. A variety of efforts have been made to label neural crest derivatives using partial Sox10 regulatory elements to drive cre expression. To date published Sox10-cre lines have focused primarily on lineage tracing in specific tissues or during early fetal development. We describe two new Sox10-cre BAC transgenes, constitutive (cre) and inducible (cre/ERT2), that contain the complete repertoire of Sox10 regulatory elements. We present a thorough expression profile of each, identifying a few novel sites of Sox10 expression not captured by other neural crest cre drivers. Comparative mapping of expression patterns between the Sox10-cre and Sox10-cre/ERT2 transgenes identified a narrow temporal window in which Sox10 expression is present in mesenchymal derivatives prior to becoming restricted to neural elements during embryogenesis. In more caudal structures, such as the intestine and lower urinary tract, our Sox10-cre BAC transgene appears to be more efficient in labeling neural crest-derived cell types than Wnt1-cre. The analysis reveals consistent expression of Sox10 in non-neural crest derived glandular epithelium, including salivary, mammary, and urethral glands of adult mice. These Sox10-cre and Sox10-cre/ERT2 transgenic lines are verified tools that will enable refined temporal and cell-type specific lineage analysis of neural crest derivatives as well as glandular tissues that rely on Sox10 for proper development and function.

Why Does the Face Predict the Brain? Neural Crest Induction, Craniofacial Morphogenesis, and Neural Circuit Development

Mesenchephalic and rhombencephalic neural crest cells generate the craniofacial skeleton, special sensory organs, and subsets of cranial sensory receptor neurons. They do so while preserving the anterior-posterior (A-P) identity of their neural tube origins. This organizational principle is paralleled by central nervous system circuits that receive and process information from facial structures whose A-P identity is in register with that in the brain. Prior to morphogenesis of the face and its circuits, however, neural crest cells act as “inductive ambassadors” from distinct regions of the neural tube to induce differentiation of target craniofacial domains and establish an initial interface between the brain and face. At every site of bilateral, non-axial secondary induction, neural crest constitutes all or some of the mesenchymal compartment for non-axial mesenchymal/epithelial (M/E) interactions. Thus, for epithelial domains in the craniofacial primordia, aortic arches, limbs, the spinal cord, and the forebrain (Fb), neural crest-derived mesenchymal cells establish local sources of inductive signaling molecules that drive morphogenesis and cellular differentiation. This common mechanism for building brains, faces, limbs, and hearts, A-P axis specified, neural crest-mediated M/E induction, coordinates differentiation of distal structures, peripheral neurons that provide their sensory or autonomic innervation in some cases, and central neural circuits that regulate their behavioral functions. The essential role of this neural crest-mediated mechanism identifies it as a prime target for pathogenesis in a broad range of neurodevelopmental disorders. Thus, the face and the brain “predict” one another, and this mutual developmental relationship provides a key target for disruption by developmental pathology.

Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis.

Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung’s disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung’s disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung’s disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype–phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype–phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

Transcriptome Analysis Reveals High Similarities between Adult Human Cardiac Stem Cells and Neural Crest-Derived Stem Cells.

Simple SummaryThe regeneration of nearly all organs of the human body mainly depends on the functionality of adult stem cell populations that reside in their respective niches and can be activated upon injuries or other damages. These stem cell populations greatly differ in their expression profile of molecular markers, which greatly influences their potential use in regenerative medicine. Neural crest-derived stem cells are a prominent subpopulation of adult stem cells and are known for their high regenerative potential. Within this study, we compared two adult human stem cell populations, namely neural crest-derived inferior turbinate stem cells from the nasal cavity and human cardiac stem cells from the heart, using global gene expression profiling. Here, we found differences that correspond to the tissue sources of origin but also similarities in the expression of markers that are associated with the neural crest. Further classifying nasal stem cells and cardiac stem cells in a broader context, we identified clear similarities between both populations and other adherent stem cell populations compared to non-adherent progenitor cells of the blood system. The analyses provided here might help to understand the differences and similarities between different adult human stem cell populations.For the identification of a stem cell population, the comparison of transcriptome data enables the simultaneous analysis of tens of thousands of molecular markers and thus enables the precise distinction of even closely related populations. Here, we utilized global gene expression profiling to compare two adult human stem cell populations, namely neural crest-derived inferior turbinate stem cells (ITSCs) of the nasal cavity and human cardiac stem cells (hCSCs) from the heart auricle. We detected high similarities between the transcriptomes of both stem cell populations, particularly including a range of neural crest-associated genes. However, global gene expression likewise reflected differences between the stem cell populations with regard to their niches of origin. In a broader analysis, we further identified clear similarities between ITSCs, hCSCs and other adherent stem cell populations compared to non-adherent hematopoietic progenitor cells. In summary, our observations reveal high similarities between adult human cardiac stem cells and neural crest-derived stem cells from the nasal cavity, which include a shared relation to the neural crest. The analyses provided here may help to understand underlying molecular regulators determining differences between adult human stem cell populations.

Cell non-autonomous requirement of p75 in the development of geniculate oral sensory neurons

During development of the peripheral taste system, oral sensory neurons of the geniculate ganglion project via the chorda tympani nerve to innervate taste buds in fungiform papillae. Germline deletion of the p75 neurotrophin receptor causes dramatic axon guidance and branching deficits, leading to a loss of geniculate neurons. To determine whether the developmental functions of p75 in geniculate neurons are cell autonomous, we deleted p75 specifically in Phox2b + oral sensory neurons (Phox2b-Cre; p75fx/fx) or in neural crest-derived cells (P0-Cre; p75fx/fx) and examined geniculate neuron development. In germline p75−/− mice half of all geniculate neurons were lost. The proportion of Phox2b + neurons, as compared to Phox2b-pinna-projecting neurons, was not altered, indicating that both populations were affected similarly. Chorda tympani nerve recordings demonstrated that p75−/− mice exhibit profound deficits in responses to taste and tactile stimuli. In contrast to p75−/− mice, there was no loss of geniculate neurons in either Phox2b-Cre; p75fx/fx or P0-Cre; p75fx/fx mice. Electrophysiological analyses demonstrated that Phox2b-Cre; p75fx/fx mice had normal taste and oral tactile responses. There was a modest but significant loss of fungiform taste buds in Phox2b-Cre; p75fx/fx mice, although there was not a loss of chemosensory innervation of the remaining fungiform taste buds. Overall, these data suggest that the developmental functions of p75 are largely cell non-autonomous and require p75 expression in other cell types of the chorda tympani circuit.

Cell-Extracellular Matrix Interactions Play Multiple Essential Roles in Aortic Arch Development.

Defects in the morphogenesis of the fourth pharyngeal arch arteries (PAAs) give rise to lethal birth defects. Understanding genes and mechanisms regulating PAA formation will provide important insights into the etiology and treatments for congenital heart disease. Cell-ECM (extracellular matrix) interactions play essential roles in the morphogenesis of PAAs and their derivatives, the aortic arch artery and its major branches; however, their specific functions are not well-understood. Previously, we demonstrated that integrin α5β1 and Fn1 (fibronectin) expressed in the Isl1 lineages regulate PAA formation. The objective of the current studies was to investigate cellular mechanisms by which integrin α5β1 and Fn1 regulate aortic arch artery morphogenesis. Using temporal lineage tracing, whole-mount confocal imaging, and quantitative analysis of the second heart field (SHF) and endothelial cell (EC) dynamics, we show that the majority of PAA EC progenitors arise by E7.5 in the SHF and contribute to pharyngeal arch endothelium between E7.5 and E9.5. Consequently, SHF-derived ECs in the pharyngeal arches form a plexus of small blood vessels, which remodels into the PAAs by 35 somites. The remodeling of the vascular plexus is orchestrated by signals dependent on the pharyngeal ECM microenvironment, extrinsic to the endothelium. Conditional ablation of integrin α5β1 or Fn1 in the Isl1 lineages showed that signaling by the ECM regulates aortic arch artery morphogenesis at multiple steps: (1) accumulation of SHF-derived ECs in the pharyngeal arches, (2) remodeling of the EC plexus in the fourth arches into the PAAs, and (3) differentiation of neural crest-derived cells adjacent to the PAA endothelium into vascular smooth muscle cells. PAA formation is a multistep process entailing dynamic contribution of SHF-derived ECs to pharyngeal arches, the remodeling of endothelial plexus into the PAAs, and the remodeling of the PAAs into the aortic arch artery and its major branches. Cell-ECM interactions regulated by integrin α5β1 and Fn1 play essential roles at each of these developmental stages.