Neighbor-joining Tree Research Articles

SSR and SNP Marker-Based Investigation of Indian Rice Landraces in Relation to Their Genetic Diversity, Population Structure, and Geographical Isolation

India is blessed with an abundance of diverse rice landraces in its traditional cultivated areas. Two marker systems (simple sequence repeats (SSR) and single nucleotide polymorphism (SNP)) were used to study a set of 298 rice landrace accessions collected from six different regions of India (Andaman and Nicobar Islands, Chhattisgarh, Jharkhand, Uttar Pradesh, Uttarakhand, and West Bengal). Thirty hyper-variable simple sequence repeats (HvSSRs) and 32,782 single nucleotide polymorphisms (SNPs) were used in inferring genetic structure and geographical isolation. Rice landraces from Uttar Pradesh were the most diverse, with a gene diversity value of 0.42 and 0.49 with SSR and SNP markers, respectively. Neighbor-joining trees classified the rice landraces into two major groups with SSR and SNP markers, and complete geographical isolation was observed with SSR markers. Fast STRUCTURE analysis revealed four populations for SSR markers and three populations for SNP markers. The population structure with SSR markers showed that few individuals from Uttarakhand and Andaman and Nicobar Islands were grouped in small clusters. Population structure analysis with SNP markers showed not very distinct region-wise clustering among the rice landraces. Discriminant analysis of principal components (DAPC) and minimum spanning network (MSN) using SSR markers showed region-wise grouping of landraces with some intermixing, but DAPC and MSN with SNP markers showed very clear region-wise clustering. Genetic differentiation of rice landraces between the regions was significant with both SSR (Fst 0.094–0.487) and SNP markers (Fst 0.047–0.285). A Mantel test revealed a positive correlation between the genetic and geographic distance of rice landraces. The present study concludes that rice landraces investigated in this study were very diverse, and unlinked SSR markers show better geographical isolation than a large set of SNP markers.

First report of bacterial wilt disease caused by Pantoea agglomerans on the ornamental perennial Oxalis articulata in China.

Oxalis articulata is now widely cultivated in China as an ornamental species, and thus found in abundance in agricultural farms, gardens, and lawns. In December 2021, some severely infected Oxalis articulata were observed at many places at Zhejiang Normal University (29°8'4″N, 119°37'54″E) in Jinhua City, Zhejiang Province, China. Yellow was first observed on the margin of the leaves, leading to light brown and wilting at a later stage. To identify the pathogen, symptomatic leaves were collected and cut into small pieces, surface disinfected in 1% sodium hypochlorite solution for 3 min, followed by 75% alcohol for 0.5 min, then rinsed in sterile distilled water thrice. Then they were transferred onto Luria-Bertani medium and incubated at 28°C for 3 days. The colonies were round, yellow, viscous and smooth, which was consistent with the characteristics of Pantoea agglomerans (Li et al. 2020; Zhang et al. 2022). The bacteria tested gram-negative, negative for indole test and Voges-Proskauer reaction, and positive for methyl red reaction, lysine decarboxylase and ornithine decarboxylase. In addition, the bacteria can utilize D-xylose, sorbitol, adonitol, and glucose, but can't utilize raffinose, urea, and Simmons. Meanwhile the bacteria can not produce H2S, and can not produce gas from D-glucose as well. These results of physiological and biochemical characteristics were consistent with those of Pantoea agglomerans (Gavini et al. 1989). To identify the strain, the 16S rDNA gene fragment was amplified by polymerase chain reaction (PCR) using universal primers 8F and 1510R, and sequenced. The BLAST results indicated that the 16S rDNA sequence of the strain OAPB-1, deposited under GenBank accession LC709256, showed 99.93%(1376/1377) and 99.49% (1370/1377) identitytothecorresponding sequence of Pantoea agglomerans FC2948 (MH532498.1) and the type strain Pantoea agglomerans DSM 3493 (AJ233423) respectively. The Neighbor-Joining phylogenetic tree generated using MEGA11 indicated that it formed a clade with the other P. agglomerans. Furthermore, the phylogenetic analysis based on sequences of housekeeping genes (atpD, rpoB and infB; GenBank accession LC722492 to LC722494) showed the same result. Based on the above results, the strain OAPB-1 from Zhejiang was identified as P.agglomerans. To test the Koch's postulates, bacterial suspensions (2×108CFU/mL) were injected into the middle of healthy leaves of mature plants with sterile water as a control. Then the plants were placed at 28°C in a light incubator with 12-h-light/12-h-dark photoperiod and approximately 60% humidity. Leaves in the inoculated group showed symptoms similar to those observed on the naturally infected leaves, while leaves in the control group showed no symptoms. The pathogen was reisolated from inoculated leaves, and its morphological characteristics and molecular identification results were consistent with those of the original isolate. P. agglomerans is a bacterium associated with plants, and also infects humans and animals (Dutkiewicz et al. 2016). In China, it has been reported to infect many kinds of plants (Fan et al. 2022; Guo et al. 2020; Han et al. 2020; Li et al. 2020; She et al. 2019; Zhang et al. 2022). As far as we know, this is the first report of P. agglomerans causing bacterial wilt on Oxalis articulata in China. These results further expand the range of plants that can be infected by P. agglomerans, and help to establish an effective control strategy against the disease.

Roseobacter insulae sp. nov. and Loktanella gaetbuli sp. nov., isolated from tidal flats in the Yellow Sea in Korea.

Two bacterial strains (designated as YSTF-M11T and TSTF-M6T) were isolated from tidal flat sediments of the Yellow Sea, Republic of Korea, and taxonomically characterized. A neighbour-joining phylogenetic tree based on 16S rRNA gene sequences showed that strain YSTF-M11T clusters with the type strains of Roseobacter species and strain TSTF-M6T clusters with the type strains of Loktanella salsilacus, Loktanella fryxellensis and Loktanella atrilutea. Strains YSTF-M11T and TSTF-M6T exhibited 16S rRNA gene sequence similarity values of 97.5-98.9 % and 94.1-97.2 % to the type strains of four Roseobacter species and to the type strains of four Loktanella species, respectively. An UBCG tree based on genomic sequences and a tree based on AAI showed that strains YSTF-M11T and TSTF-M6T form a cluster with the type strains of Roseobacter species and with the type strains of L. salsilacus, L. fryxellensis and L. atrilutea, respectively. The ANI and dDDH values between genomic sequences of strain YSTF-M11T and the type strains of four Roseobacter species and between those of strain TSTF-M6T and the type strains of the three Loktanella species were in ranges of 74.0-75.9 and 18.2-19.7 % and 74.7-75.5 and 18.8-19.3 %, respectively. The DNA G+C contents of strains YSTF-M11T and TSTF-M6T were 60.3 and 61.9 % based on their genomic sequences. Both strains contained Q-10 as the predominant ubiquinone and C18 : 1 ω7c as the major fatty acid. Strains YSTF-M11T and TSTF-M6T were separated from recognized Roseobacter species and L. salsilacus, L. fryxellensis and L. atrilutea, respectively, by their phenotypic properties together with the phylogenetic and genetic distinctiveness. Based on data presented in this study, strains YSTF-M11T (=KACC 21642T =NBRC 115155T) and TSTF-M6T (=KACC 21643T =NBRC 115154T) are considered to represent novel species of the genera Roseobacter and Loktanella, respectively, for which the names Roseobacter insulae sp. nov. and Loktanella gaetbuli sp. nov. are proposed.

Genetic diversity of mitochondrial DNA D-loop in wild and domestic pigs (Sus scrofa) in East Asia

Chinese domestic pig breeds have abundant genetic resources, but definite information about the geographic specificity and genetic structure is lacking. In this study, we analysed 359 mitochondrial D-loop sequences, including 86 sequences from Chinese domestic pigs and the rest downloaded from GenBank. The haplotype and nucleotide diversity indices ranged from 0.467 ±0.132 (Duroc) to 1.000 ±0.500 (Thailand, North Korea and Cambodia) and 0.00067 ±0.00019 (Duroc) to 0.02000 ±0.01000 (Thailand), respectively. The neighbour-joining tree revealed two clads in the individual pigs, with a Chinese domestic breed distributed discontinuously among several breeds. The network data indicated that the gene pools of Chinese domestic pigs are likely related to Chinese, Japanese and some other Southeast Asian wild boars.

Molecular detection of Enterocytozoon bieneusi in farmed Asiatic brush-tailed porcupines (Atherurus macrourus) and bamboo rats (Rhizomys pruinosus) from Hainan Province, China: Common occurrence, wide genetic variation and high zoonotic potential

We investigated the occurrence and genotypic diversity of E. bieneusi in farmed Asiatic brush-tailed porcupines and bamboo rats from Hainan Province, China. Four hundred and sixty-seven fresh feces were collected from 164 Asiatic brush-tailed porcupines and 303 bamboo rats. DNA extraction from the feces and genotyping of E. bieneusi were performed by the amplification of the internal transcribed spacer (ITS) region of rDNA of E. bieneusi using PCR. A neighbor-joining tree was constructed based on the sequences obtained here and other sequences of E. bieneusi genotypes stored in Genbank. The total rate of infection with E. bieneusi was 32.5% (152/467), with 14.6% (24/164) in Asiatic brush-tailed porcupines and 42.2% (128/303) in bamboo rats infected. Seventeen genotypes of E. bieneusi were identified including 12 known genotypes, i.e., D (n = 78), Henan-III (n = 21), SHW7 (n = 19), KIN-1 (n = 11), ETMK5 (n = 7), TypeIV (n = 4), EbpD (n = 2), EbpA (n = 1), EbpC (n = 1), S7 (n = 1), HNPL-III (n = 1), HNR-VII (n = 1), and five novel genotypes named as HNZS-I (n = 1) and HNHZ-I to HNHZ-IV (n = 1 per genotype). Phylogenetic analysis revealed that all the genotypes found here except genotype S7 fell into Group 1. The present study demonstrated a relatively high prevalence of E. bieneusi infection (32.5%) and a large genetic variation of E. bieneusi (seventeen genotypes) in farmed Asiatic brush-tailed porcupines and bamboo rats in Hainan, China. The high proportion (78.3%) of zoonotic genotypes identified in the animals investigated here suggests that there is the potential for zoonotic or cross-species transmission which may pose a serious public health threat in the area. Public education on the management of Asiatic brush-tailed porcupines and bamboo rats should be implemented in the investigated areas.

DNA Barcoding of Commercial Cockroaches in Turkey

Accurate species identification has become a precondition for accomplished biodiversity administration and further genetic research. Species acquaintance technics require molecular tools such as DNA barcoding as well as morphological identification for accurate identification. Particularly, the application of subunit I of the mitochondrial cytochrome c oxidase (COI) gene for DNA barcoding for insects has approved to be very useful in species acquaintance. The main aim of this study is to generate the first reference library of DNA barcode for cockroaches in Turkey using previously published data. As a result of the literature research, it has been observed that no study has been carried out on the DNA barcode of Turkish cockroaches. Therefore, in this study, we evaluated the advantage of DNA barcoding applied to two cockroach samples from Turkey for the first time. Our working samples implicated 10 DNA barcodes grounded on sequences created from our present study and 109 other DNA barcodes from BOLD. Various molecular analyzes including genetic distance-origin assessment (NeighborJoining and Maximum Likelihood trees) has been applied to accurately identify and describe species. In addition, Blaptica dubia (B. dubia) (Serville, 1838) and Nauphoeta cinerea (N. cinerea) (Olivier, 1789) have been reported as the first country records. It has been observed that reference libraries like BOLD are not yet sufficiently populated with COI sequences of Turkish cockroach species. In order for Turkish cockroach bio-assessment and biodiversity studies to benefit from the advantages of DNA barcoding, it is of great importance that cockroach inventories and taxonomic studies include DNA barcodes.

Genome-Wide Identification and Expression Analysis of the fw2.2-like Gene Family in Pear

Fruit size is a major factor determining yield, quality, and consumer acceptability. fw2.2 (fruit weight-2.2) is a primary quantitative trait locus that was the first to be cloned, accounting for 30% of the variation in tomato fruit size. The various homologs of fw2.2 (fw2.2-like) have been identified in many plants and belong to a large family. To date, there has been no report that has carried out a comprehensive identification of fw2.2-like members in pear. In this study, a total of 14 fw2.2-like genes were identified in the pear (Pyrus bretschneideri Rehd) genome and designated as PbFWL1-14. All of the PbFWL genes were unevenly distributed on nine chromosomes, and each chromosome contained between one and four genes. All PbFWL proteins contained more than two conserved motifs, and PbFWL genes contained more than one intron, and the genes of the same subfamily seemed to have a similar intron gene structure. According to the neighbor-joining phylogenetic tree, a total of 78 fw2.2/CNR (cell number regulator) from five plant species, including pear, maize, tomato, peach, rice, and physalis, could be divided into seven subgroups, and PbFWL proteins were mainly distributed in subgroups 1, 3, 4, 5, and 6. The Ka/Ks analysis also revealed that the fw2.2-like gene family of pear may have been subjected to strong purifying selection pressure during its evolution. A cis-element analysis found that many cis-elements responsive to hormones and stress were discovered in promotion regions for all PbFWLs. When combining real-time quantitative PCR analysis detection results, PbFWL1/2/5 were found to be the most likely candidate genes for regulating pear fruit size.

Xenotorodor stygioxanthus gen. nov., sp. nov. (Lepidoptera, Lecithoceridae, Torodorinae), described from an established population in Spain with discussion of taxonomic placement

The family Lecithoceridae is not well represented in the Palaearctic region, with very few taxa in Europe. Here we describe a new genus and species of lecithocerid moth, Xenotorodor stygioxanthus Sterling, Lees & Grundy, gen. nov., sp. nov. The taxon represents a subfamily new to Europe. We consider placement of the genus within Crocanthinae or Torodorinae. We place it in Torodorinae, notwithstanding the reduced gnathos in the male genitalia. DNA barcodes suggest that the taxon belongs within a distal clade of this subfamily. They are over 9.2% pairwise divergent from any hitherto cleanly sequenced Lepidoptera taxon and over 10.1% from nearest taxonomically identified neighbours in Neighbor Joining and ML trees. Characteristics of the DNA barcode and morphology of this new taxon suggest that refinement of synapomorphies for the family and two subfamilies is needed. We have nearly 100 records for this new species since 2020, all from a small area of Southern Spain, close to the Straits of Gibraltar. The life history and early stages of the species are unknown.

New species, a new combination, and DNA barcodes of Parachironomus Lenz, 1921 (Diptera, Chironomidae).

The genus Parachironomus has a cosmopolitan distribution including 85 valid described species worldwide. Species records and studies of the genus in the Tibetan Plateau are scarce. In this study, the genus Parachironomus from China is revised and two new species, Parachironomuswangi Liu & Lin, sp. nov. and Parachironomusnankaiensis Liu & Lin, sp. nov., are described based on adult morphology and molecular data. Paracladopelmademissum Yan, Wang & Bu is placed in the genus Parachironomus as a new combination. A neighbor-joining tree was reconstructed based on all known ParachironomusCOI DNA barcodes. A key to adult males of the genus Parachironomus from China is also provided.

Population Structure and Genetic Diversity Analysis of "Yufen 1" H Line Chickens Using Whole-Genome Resequencing.

The effective protection and utilization of poultry resources depend on an accurate understanding of the genetic diversity and population structure. The breeding of the specialized poultry lineage "Yufen 1", with its defined characteristics, was approved by the China Poultry Genetic Resource Committee in 2015. Thus, to investigate the relationship between the progenitor H line and other poultry breeds, the genetic diversity and population structure of "Yufen 1" H line (YF) were investigated and compared with those of 2 commercial chicken breeds, the ancestor breed Red Jungle Fowls, and 11 Chinese indigenous chicken breeds based on a whole-genome resequencing approach using 8,112,424 SNPs. The genetic diversity of YF was low, and the rate of linkage disequilibrium decay was significantly slower than that of the other Chinese indigenous breeds. In addition, it was shown that the YF population was strongly selected during intensive breeding and that genetic resources have been seriously threatened, which highlights the need to establish a systematic conservation strategy as well as utilization techniques to maintain genetic diversity within YF. Moreover, a principal component analysis, a neighbor-joining tree analysis, a structure analysis, and genetic differentiation indices indicated that YF harbors a distinctive genetic resource with a unique genetic structure separate from that of Chinese indigenous breeds at the genome level. The findings provide a valuable resource and the theoretical basis for the further conservation and utilization of YF.

Mitochondrial DNA D-loop Genetic Relatedness and Characterization of Nile Tilapia (Oreochromis niloticus Linnaeus, 1758) from Lakes Alau and Bako, Northeast, Nigeria

This study investigated the genetic relatedness and characterization of Nile tilapia (Oreochromis niloticus) populations from Lake Bako, Mambilla Plateau and Lake Alau, Maiduguri using Mitochondrial DNA (mtDNA) D-loop sequences. Blood samples were collected from each individual of and preserved on an FTA card. DNA was extracted from the card using Aqualex extraction kits. Polymerase Chain Reaction was performed using a commercially available decamer primer: FISH COMUM D-LOOP F (5’-GGATTYTAACCCYTRCCC -3’) and (R:) as the forward primer and C. zilli_rev (5′ – AGTAAAGTCAGGACCAAGCC – 3′) as reverse primer. The results showed that, in total 117 variable sites were observed and Hap_1_Hap_40 was detected. Lake Alau population has 65.50 % A+T and 34.5% G+C, while 65.5% and 34.9% were the nucleotide composition of Lake Bako population. Both populations have 1.00 Haplotypes diversity. The nucleotide diversity observed in Lake Bako population is 0.0342, while 0.0285 were recorded in Lake Bako population. The average number of nucleotide differences of 26.61053 and 31.98421 were observed in Lakes Bako and Alau populations, respectively with and overall value of 29.996. The Neighbour-Joining phylogenetic tree revealed two major clusters. The genetic variation among population is 95.31%and within population is 4.69%. Populations of O. niloticus in Lakes Bako and Alau are genetically different. Lake Bako population seemed to have intact genetic structure. Both populations have high genetic diversity, hence have high potential for genetic improvement and conservation.

A note on divergent mtDNA lineages of bottlenose dolphins from coastal waters of southern Australia

Bottlenose dolphins have a global distribution throughout tropical and temperate waters, both inshore and offshore. Many studies demonstrate the existence of at least two Tursiops species: Tursiops truncatus, consisting of inshore and offshore eco-types and T. aduncus, a coastal Indo-Pacific type known to extend south into temperate waters down the east coast of Australia. To clarify the taxonomic status of two populations (Port Phillip Bay and Gippsland Lakes) of coastal bottlenose dolphins along Australia’s south coast (Victoria), a 346bp region of the mitochondrial-DNA (mtDNA) control region was sequenced from ten individuals and they were incorporated into phylogenetic analyses involving published sequences of other Tursiops spp., Stenella spp. and Delphinus spp., found worldwide. Both neighbour-joining and maximum parsimony trees place Victorian coastal haplotypes in a highly-supported group separate to those from the other dolphins, including those from the southern part of the Australian eastern coast. Victorian haplotypes are least divergent from T. truncatus (average 5.5%) and most divergent from T. aduncus (9.1%), with intermediate levels of divergence from Stenella and Delphinus spp. These data suggest that the Victorian coastal dolphins, similar to other world-wide coastal populations, are genetically unique, long isolated and therefore likely to be locally adapted. This has important implications for management and conservation.

Development of Multiple Nucleotide Polymorphism Molecular Markers for Enoki Mushroom (Flammulina filiformis) Cultivars Identification.

The enoki mushroom (Flammulina filiformis) is one of the most important and popular edible mushrooms commercially in China. However, traditional mushroom cultivar identification is challenging due to poor accuracy, heavy workloads, and low reproducibility. To overcome this challenge, we developed a method for identifying F. filiformis strains using multiple nucleotide polymorphism sequencing (MNP-seq). This involved screening 179 universal MNP markers based on whole-genome sequencing data, constructing an MNP sequence library, and performing multiplex PCR amplification and high-sequencing. We further screened 69 core MNP markers and used them to build a neighbor-joining (NJ) phylogenetic tree of 232 cultivated and wild strains. Our analysis showed that all cultivars could be accurately separated by computing genetic similarity values and that the cultivars could be separated into 22 distinct evolutionary pedigrees. The specific value of genetic similarity can be used as the standard to distinguish F. filiformis cultivars, however, it needs to be comprehensively defined by the additional phenotype and biological characteristics of those strains in the future work.

DNA barcoding of the genus Alburnoides Jeitteles, 1861 (Actinopterygii, Cyprinidae) from Anatolia, Turkey

The present study investigated the ability of DNA barcoding to reliably identify the endemic freshwater species in Turkey, known as biodiversity hotspots. The barcode region (652 bp) of the mitochondrial cytochrome c oxidase subunit I (COI) was used to barcode 153 individuals from 13 morphologically identified species of the genus Alburnoides. Based on the Kimura two-parameter (K2P) evolution model, the average interspecific distance (0.0595) was 31-fold higher than the average intraspecific distance (0.0019). There was a clear-cut barcode gap (0.0158–0.0187) between maximum intraspecific distance (A. tzanevi and A. velioglui) and minimum nearest-neighbour distance (A. freyhofi and A. kurui) for Anatolian Alburnoides species and a common genetic threshold of 0.0158 sequence divergence was defined for species delimitation. The multiple species delimitation methods (ABGD, ASAP, GMYC and bPTP) revealed a total of 11 molecular operational taxonomic units (MOTUs) for 13 morphospecies. Neighbour-joining (NJ), Maximum Likelihood (ML) and Bayesian Inference (BI) tree analysis indicated that all haplotypes were clustered into two major clades, which corresponded to eleven Alburnoides species clusters, with strong bootstrap support. Furthermore, all the specimens clustered in concurrence with the morpho-taxonomic status of the species, except for two species (A. coskuncelebii and A. emineae) that were morphologically differentiated, but showed overlap in variation for COI-based DNA barcode data with other species. Overall, present results identified that COI-based DNA barcoding is effective for species identification and cataloguing of genus Alburnoides in Turkey.

Assessing the Genomics Structure of Dorper and White Dorper Variants, and Dorper Populations in South Africa and Hungary.

Dorper sheep was developed for meat production in arid and semi-arid regions under extensive production systems in South Africa. Two variants with distinct head and neck colors were bred during their development process. White Dorper have a white coat while Dorper have a black head and neck. Both variants have grown in popularity around the world. Therefore, understanding the genomic architecture between South African Dorpers and Dorper populations adapted to other climatic regions, as well as genomic differences between Dorper and White Dorper variants is vital for their molecular management. Using the ovine 50K SNP chip, this study compared the genetic architecture of Dorper variants between populations from South Africa and Hungary. The Dorper populations in both countries had high genetic diversity levels, although Dorper in Hungary showed high levels of inbreeding. White Dorpers from both countries were genetically closely related, while Dorpers were distantly related according to principal component analysis and neighbor-joining tree. Additionally, whereas all groups displayed unique selection signatures for local adaptation, Dorpers from Hungary had a similar linkage disequilibrium decay. Environmental differences and color may have influenced the genetic differentiation between the Dorpers. For their molecular management and prospective genomic selection, it is crucial to understand the Dorper sheep's genomic architecture, and the results of this study can be interpreted as a step in this direction.

Detection of a New Strain of the Yambean mosaic virus in Senna hirsuta (Irwin and Barneby) in Calabar, Southern Nigeria

Background: Hairy senna is an edible weed grown for both its vegetables and as a hedge plant in farms and backyard gardens in Calabar. Senna hirsuta leaf samples showing virus-like symptoms were collected in the growing seasons of between 2018 and 2020 from backyard gardens and farms in Calabar and the surrounding area. Methods: The virus was isolated and transmitted by mechanical inoculation for host range studies. Seed transmissibility and transmission by aphids were further used for detection. Reverse transcription polymerase chain reaction (RT-PCR) using primers specific to the cylindrical inclusion protein gene (CI) of potyviruses followed by sequencing was used for molecular identification. The neighbour-joining phylogenetic tree was constructed to determine the relationship of the Calabar isolate with those from other parts of the world. Result: For the host range studies, four species belonging to the Fabaceae family were infected by the isolate, indicating a narrow host range. The virus was found to be seed transmissible and could be vectored by both Aphis craccivora and Aphis spiraecola. Obtained DNA fragments with the expected size of~700 bp were amplified and a pairwise comparison with other potyviruses revealed a 94-95.87% similarity with complete sequence of YBMV (JN190431). Phylogenetic analysis placed the senna isolate in the same clade as the Brazilian isolates (MK825543 and MK825544) and JN190431. On the basis of this, the virus is adjudged to be the Nigerian strain of YBMV (JN190431).

First report of leaf blight on Eucalyptus cloeziana caused by Coniella quercicola in China.

Eucalypt species are among the most important for timber production worldwide. Eucalyptus cloeziana is increasingly culticated due to its desirable structural properties. Leaf blight is one of the most devastating diseases of E. cloeziana in China. In May 2019, leaf blight samples were collected from E. cloeziana in Chongzuo, Guangxi, China (22°20'37.70"N, 107°49'29.29"E). Lesions began at the leaf margin and extended to 1/4-3/4 of the total leaf surface area. Lesions (26.76±12.64 mm diameter) were round, yellow, and withered in appearance, and sometimes many black, round pycnidia were observed. Leaves with blight were collected randomly from 10 E. cloeziana plants. Tissue blocks (3 mm×3 mm) were sampled from diseased and healthy leaf portions, then surface disinfected with 75% ethanol for 20 s and 0.1% HgCl2 for 3 min. After washing with sterile water three times, dry tissue blocks were placed on potato dextrose agar (PDA) medium and incubated at 28°C for 5 days. Hyphae were milky white or whitish, and sparse. The colonies had petal-shaped edges and the conidiophores were clustered, branched and transparent. Spore-forming cells were solitary and smooth; conidia were smooth, fusiform or oblong, transparent, blunt-based, mostly erect, and 16.54±2.19 × 3.38±0.77 μm (n=100 in each isolate) in size. Three representative isolates (AB-6, AB-9, AB-16) were selected for further study. For molecular identification, the internal transcribed spacer (ITS) region of rDNA, translation elongation factor 1-α (TEF1), and large subunit ribosomal RNA (LSU) were amplified with primers ITS1/ITS4 (White et al. 1990), EF1-983F/EF1-1567R (Rehner and Buckleyet al. 2005), and LR0R/LR5 (Vilgalys and Hesteret al. 1990), respectively. BLASTn searches showed that the ITS (OM280456, ON026088-89), TEF1 (ON055278-80) and LSU (OM281346, ON026097-98) sequences had the highest similarity to Coniella quercicola strains with: 99% (600/605, 600/605, 600/604) identity for ITS (MH859478.1); 98% (326/333, 327/334, 325/332) identity for TEF1 (KX833698.1); 99% (870/872, 833/834, 830/831) identity for LSU (MH871258.1) of ex-type CBS 904.69. A Neighbor-Joining phylogenetic tree was constructed by combining 3 sequenced loci. Three isolates clustered in the C. quercicola clade with 100% bootstrap support. Thus, based on morphological (Maas et al. 1979; Wang and Lin et al. 2004) and molecular characteristics, the pathogen was identified as C. quercicola. In a pathogenicity test, 20 healthy E. cloeziana seedlings with at least 5 leaves were divided into 4 groups: groups 1-3 were used to inoculate three isolates respectively, and the fourth group acted as control. After surface disinfection with 75% ethanol and wiping with sterile water, tiny wounds were maked made by inoculation needle on each leaf. Fungal culture plugsblocks cut from 3 isolates were placed on wounds in groups 1-3 respectively,. withWarter- agar blockplugs served as control in group 4. The leaves were covered with wet cotton and sealed in airtight bags to retain moisture at room temperature with natural light. After 3 days, light brown lesions were observed in groups 1-3, with no symptoms present in the control group. The pathogenicity test was confirmed by repeating in triplicate and fungi re-isolated from symptomatic leaves were identified as C. quercicola. To our knowledge, this is the first report of leaf blight on E. cloeziana caused by C. quercicola in China. This study increases our understanding of E. cloeziana leaf blight and future research may allow the development of targeted prevention methods for more effective disease controls.

First report of leaf spot on Magnolia grandiflora caused by Lasiodiplodia theobromae in Jiangsu.

Magnolia grandiflora linn, with large and fragrant flowers, is widely planted in the south of Yangtze River valley in China. It is an excellent street tree and a beautiful ornamental tree for landscaping.In October 2021, a new leaf spot disease was observed on M. grandiflora seedlings and maturetreesgrowing in NanjingBotanical Garden, Jiangsu Province, China. According to statistics, about 300 M. grandifloratrees were planted here, and approximately 60% of M. grandiflora trees suffered from the disease. In the beginning, small black spots appeared on the leaf of M. grandiflora, and then the disease spots were connected into coalesced, and eventually lead to a large area of leaf dead (Figure S1A). To isolate the pathogen, ten diseased leaves were collected from ten plants distributed in different five areas of the botanical garden. The leaf sections (3 to 4 mm) were excised from the margins between healthy and diseased tissues, surface sterilized in 75% alcohol for 30 s and then in 1.5% NaClO for 90 s, rinsed three times in sterilized distilled water, plated on potato dextrose agar (PDA) and incubated at 25℃in the darkness. Pure cultures were obtained by monosporic isolation. Twenty-three isolates were obtained (the isolate rate of 72%), and identified as Lasiodiplodia sp.. A representative isolate, G-H-1 was used for the further study. The colony of G-H-1, growing on PDA was cotton-like. The primary mycelia was gray and white in the early stage of culture. It gradually turned black gray in the later stage, and the reverse was similar in color (Figure S1B). The pycnidia (fruiting body) was black and appeared over PDA plates after 15 days (Figure S1C). The hyphae of G-H-1 were dark brown, and the conidia were monospora, oval or elliptic, with a size of (9.6 ~ 13.3) µm× (5.7 ~ 8.0) µm (mean 11.7×6.6 µm, n=35) (Figure S1D). In the pycnidia, the conidiophores were inside and produced conidia (Figure S1E). In the early stage, the conidia of G-H-1 were colorless transparent, then gradually turned dark brown with a septum in the center (Figure S1F). These characteristics were consistent with the description of Lasiodiplodia sp. (Alves et al. 2008). The regions of ITS, translation elongation factor 1-alpha (TEF1α) and β-tubulin (TUB) genes (GenBank Accession No.OM698339, No.OM942757, and No.OM942756, respectively) were amplified and sequenced with the primer pairs ITS1/ITS4 (White et al. 1990), EF1-728F/EF1-986R (Alves et al. 2008) and Bt2a/Bt2b (Glass and Donaldson 1995). The obtained sequences showed 99.05-99.81% similarity with those from L. theobromae accessions in GenBank. A neighbor-joining phylogenetic tree was generated by combining all sequenced loci in MEGA7. The isolate G-H-1 clustered in the L. theobromae clade with 96% bootstrap support (Figure S2). To test pathogenicity, three one-year-old M. grandiflora seedlings that previously had been wounded with a sterile needle were inoculated with 20 μL conidia suspension (1×106 spores/mL) on the left sides of leaves. Inoculation with 20 µL sterile water was treated as the control, which were inoculated on the right sides of leaves. All plants were covered with clear polyethylene bags to keep moisture. And inoculated detached leaves were incubated in a greenhouse (Institute of Botany, Jiangsu Province and Chinese Academy of Sciences) at 25℃, 80% relative humidity, and a 12-h light/dark cycle. The experiment was repeated three times. After 5 days of inoculation, typical black spots were found on the left sides of all inoculated leaves and the right sides did not have any leaf spot symptoms (Figure S1G-H). After 25 days of inoculation, perforation occurred at the black spots on the leaves of the inoculated plants, resulting in incomplete leaf (Figure S1I), which is identical disease symptoms to those observed in garden. The same fungus, identified by morphological characteristics and sequencing using ITS, TEF1α and TUB genes, was isolated from the diseased spots of the inoculated leaves to complete Koch,s postulates. The pathogen has a very wide host range. For example, it has been reported to cause dieback and sooty canker on Ficus trees (Abo Rehab et al. 2014), infected trunk of sultana seedless (Tang et al. 2021) and castor bean(Akgul et al. 2015),root ofCitrus (Al-Sadi et al. 2014), date palm,and Mango (Al-Sadi et al. 2013) and Cassia fistula (Deng et al. 2015). But, according to nt.ars-grin.gov, there are no other reports of L. theobromae on M. grandiflora in the world. So, this would be the first one. This study provides an important reference for the biology, epidemiology.

Comparative study and genetic diversity in Malva using srap molecular markers

The Malva genus has 25-40 species and it can be considered as an annual and/or biannual herb. Malva species are indicated with potential therapeutic as cicatrizing and analgesic by the Ministry of Health. The aim of this study was to analyze SRAP (Sequence-related amplified polymorphism) markers in a total of 70 accessions of Malva species, which included five species Malva neglecta Wallr., Malva pusilla Sm., Malva sylvestris L., Malva verticillata L., Malva nicaeensis All.. A total of 89 (Number of total loci) (NTL) DNA bands were produced through polymerase chain reaction amplifications (PCR) amplification of five Malva species. These bands were produced with the combinations of 5 selective primers. The total number of amplified fragments ranged from 10 to 27. The predicted unbiased gene diversity (UHe) varied between 0.077 (Malva sylvestris) and 0.382 (Malva pusilla). The genetic similarities between three species are estimated from 0.70 to 0.91. Neighbor-Joining tree results showed two major clusters. According to the SRAP (Sequence-related amplified polymorphism) markers analysis, Malva pusilla and Malva aegyptia had the lowest similarity. Our results provided great molecular identification of all assayed genotypes, which have shown that there is large quantity of genetic diversity among the Malva accessions. Objectives of the study were; a) to estimate genetic diversity; b) to evaluate population relationships using NJ approaches. Current results have implications in breeding and conservation programs.

Species Checklistand DNA Barcoding of Baung (Bagrid Catfish) Hemibagrus Hoevenii from Muar River, Johor

Of Asia, Africa, and the Middle East, there are 15 genera in the Bagridae family. The tropical freshwater catfish Hemibagrus hoeveniiis found in Asian waters. Bagrids are also known as Old World pimelodids, while New World bagrids may be more accurate. In Muar, Johor, DNA barcoding has never been utilised to determine the species of bagrid catfish. Therefore,this study was done to updatethe species checklist of Baung (bagrid catfish)in Muar River,and DNA barcoding of protein-coding cytochrome coxidase I (COI) mitochondrial gene was donefor species identification and phylogenetic analyses. A number of two partial COI gene sequencesranging 674-687 nucleotide baseswere successfully obtained for two specimens of Baung Lawi and the Nucleotide Basic Local Alignment Search Tool (BLAST) analysis suggested theirspecies status as from the genus Hemibagrus. Furthermore, the results of the phylogenetic analyses showedthat the neighbour joining tree, the maximum parsimony tree and the maximum likelihood tree grouped the COI mtDNA gene sequencesof Baung Lawifrom MuarRiverin one single cluster, thusconfirming the species status and showed the presence of H. hoeveniiin MuarRiver, Johor.