Negative Thyroid Hormone Response Elements Research Articles

Thyroid Hormones Decrease Plasma 1α,25-Dihydroxyvitamin D Levels Through Transcriptional Repression of the Renal 25-Hydroxyvitamin D3 1α-Hydroxylase Gene (CYP27B1)

The primary determinant of circulating 1α,25-dihydroxyvitamin D (1,25[OH](2)D) levels is the activity of 25-hydroxyvitamin D-1α-hydroxylase (cytochrome P450 27B1 [CYP27B1]) in the kidney. Hyperthyroid patients have been reported to have low levels of plasma 1,25(OH)(2)D. However, the detailed mechanism of thyroid hormone action on vitamin D metabolism is still poorly understood. The present study determined whether renal CYP27B1 gene expression was negatively regulated by thyroid hormones. T(3)-induced hyperthyroid mice showed marked decreases in plasma 1,25(OH)(2)D levels and in renal expression of CYP27B1 mRNA but no changes in plasma concentrations of calcium, PTH, or fibroblast growth factor-23. In addition, we observed that T(3) administration significantly decreased plasma 1,25(OH)(2)D and renal CYP27B1 mRNA levels that were increased by low-calcium or low-phosphorus diets and induced hypocalcemia in mice fed a low-calcium diet. Promoter analysis revealed that T(3) decreases the basal transcriptional activity of the CYP27B1 gene through thyroid hormone receptors (TRα and TRβ1) and the retinoid X receptor α (RXRα) in renal proximal tubular cells. Interestingly, we identified an everted repeat negative thyroid hormone response element (1α-nTRE) overlapping the sterol regulatory element (1α-SRE) and the TATA-box -50 to -20 base pairs from the human CYP27B1 gene transcription start site. Finally, we established that CYP27B1 gene transcription is positively regulated by SRE-binding proteins and that a T(3)-bound TRβ1/RXRα heterodimer inhibits SRE-binding protein-1c-induced transcriptional activity through the 1α-nTRE. These results suggest that transcriptional repression of the CYP27B1 gene by T(3)-bound TRs/RXRα, acting through the 1α-nTRE, results in decreased renal CYP27B1 expression and plasma 1,25(OH)(2)D levels.

Epigenetic involvement of Alien/ESET complex in thyroid hormone-mediated repression of E2F1 gene expression and cell proliferation

The ligand-bound thyroid hormone receptor (TR) is known to repress via a negative TRE (nTRE) the expression of E2F1, a key transcription factor that controls the G1/S phase transition. Alien has been identified as a novel interacting factor of E2F1 and acts as a corepressor of E2F1. The detailed molecular mechanism by which Alien inhibits E2F1 gene expression remains unclear. Here, we report that the histone H3 lysine 9 (H3K9) methyltransferase (HMT) ESET is an integral component of the corepressor Alien complex and the Alien/ESET complex is recruited to both sites, the E2F1 and the nTRE site of the E2F1 gene while the recruitment to the negative thyroid hormone response element (nTRE) is induced by the ligand-bound TRβ1 within the E2F1 gene promoter. We show that, overexpression of ESET promotes, whereas knockdown of ESET releases, the inhibition of TRβ1-regulated gene transcription upon T3 stimulation; and H3K9 methylation is required for TRβ1-repressed transcription. Furthermore, depletion of ESET impairs thyroid hormone-repressed proliferation as well as the G1/S transition of the cell cycle. Taken together, our data indicate that ESET is involved in TRβ1-mediated transcription repression and provide a molecular basis of thyroid hormone-induced repression of proliferation.

Thyroid Hormone and COUP-TF1 Regulate Kallikrein-Binding Protein (KBP) Gene Expression

Kallikrein-binding protein (KBP) is a component of the kallikrein-kinin system that mediates vasodilation and inhibits tumor growth by antagonizing vascular endothelial growth factor-mediated angiogenesis. We demonstrate that KBP gene expression is repressed by T(3) and modulated by the orphan nuclear receptor, chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1). In hypothyroid mice, KBP mRNA expression in the testis was increased 2.1-fold compared with euthyroid mice. We have identified two negative thyroid hormone response elements (nTREs) in the mouse KBP gene, nTRE1 located in the 5' flanking region (-53 to -29) and nTRE2, located in the first intron (104-132). We used functional assays, cofactor knockdown, and chromatin immunoprecipitation assays to characterize nTRE1 and nTRE2 in hepatic (HepG2) and testes (GC-1spg) cell lines. Reporter expression directed by both elements was enhanced with addition of thyroid hormone receptor and repressed with the addition of T(3). COUP-TF1 enhanced basal expression of both elements but blunted unliganded thyroid hormone receptor enhancement and T(3) repression of nTRE1 but not nTRE2. Both nTREs bound nuclear corepressor and binding increased in response to T(3). Nuclear corepressor knockdown resulted in loss of T(3) repression of both nTRE1 and nTRE2. COUP-TF1, which usually represses T(3) induction of positive thyroid hormone response elements, reverses T(3) repression mediated by nTRE1 in the mouse KBP gene. Endogenous KBP expression is repressed by T(3) and two functional nTREs, both of which are required, have been characterized in the KBP gene. COUP-TF1 may be an important factor to modulate expression of genes that are repressed by T(3).

Tumor Suppressor Action of Liganded Thyroid Hormone Receptor β by Direct Repression of β-Catenin Gene Expression

The abundance of β-catenin, which plays a critical role in oncogenesis, is tightly controlled by proteasomal pathways. Its aberrant accumulation is associated with the overactivation of its oncogenic signaling and tumorigenesis in cancers, including thyroid cancer. Our previous studies have suggested that β-catenin abundance could also be regulated at the transcriptional level by thyroid hormone (T(3)) and thyroid hormone receptor β (TRβ). By using hypothyroid mice supplemented or not with T(3), we showed that T(3) significantly repressed Ctnnb1 expression in vivo in the thyroid. By using two human cell lines, i.e., the thyroid HTori and the cervical cancer HeLa cell lines, each stably expressing TRβ, we observed that T(3) induced the down-regulation of CTNNB1 transcript levels. Luciferase reporter assays with various constructs harboring 5' deletion of the CTNNB1 promoter or with mutated thyroid hormone response element (TRE) binding sites, and EMSAs showed that this transrepression was mediated through an interaction between TRβ-retinoid X receptor β complexes and TREs located in the human CTNNB1 promoter between -807 and -772 and consisting of two hexamers separated by 14 nucleotides. The direct regulation of CTNNB1 expression by TRβ was further confirmed by chromatin immunoprecipitation assays showing TRβ recruitment to the CTNNB1 promoter in thyroid cells. This is the first report demonstrating a direct repression of the β-catenin gene by liganded TRβ through interaction with negative TREs located in CTNNB1 promoter. Importantly, this study uncovers a new molecular mechanism whereby liganded TRβ acts as a tumor suppressor via inhibition of the expression of a potent tumor promoter, the CTNNB1 gene.

Thyroid Hormone Regulates Endogenous Amyloid-β Precursor Protein Gene Expression and Processing in Both In Vitro and In Vivo Models

Thyroid hormone negatively regulates the amyloid-beta precursor protein (APP) gene in thyroid hormone receptor (TR)-transfected neuroblastoma cells. A negative thyroid hormone response element (nTRE) that mediates this regulation has been identified in the first exon of the APP gene. We demonstrate in an in vivo system that expression of APP mRNA, APP protein, and APP secretase cleavage products in mouse brain is influenced by thyroid status. Adult female mice were made hyperthyroid or hypothyroid for 3 weeks and compared to euthyroid mice. APP gene product expression was increased in hypothyroid mouse brain and reduced in hyperthyroid mouse brain, when compared to euthyroid controls. We observed similar effects of thyroid hormone on endogenous APP gene expression in human neuroblastoma cells. The incidence of hypothyroidism increases with age, and localized hypothyroidism of central nervous system has been reported in some patients with Alzheimer's disease (AD). Reduced action of thyroid hormone on the APP gene may contribute to AD pathology by increasing APP expression and the levels of processed APP products. These findings may be an underlying mechanism contributing to the association of hypothyroidism with AD in the elderly, as well as identifying a potential therapeutic target. Pharmacologic supplementation of thyroid hormone, or its analogs, may reduce APP gene expression and beta amyloid peptide accumulation.

Mouse Sterol Response Element Binding Protein-1c Gene Expression Is Negatively Regulated by Thyroid Hormone

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1-6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (-574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-alpha/thyroid hormone receptor-beta heterodimer bound to Site2, but retinoid X receptor-alpha/liver X receptor- heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-beta recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3 in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.

Thyroid hormone-mediated negative transcriptional regulation of Necdin expression

Unliganded thyroid hormone receptors (apoTRs) repress transcription of hormone-activated genes by recruiting corepressors to the promoters. In contrast, on promoters containing so-called negative thyroid hormone response elements (nTREs), apoTRs activate transcription. A number of different molecular mechanisms have been described as to how apoTRs activate transcription varying with the target gene of the study. Here we demonstrate that thyroid hormone regulates the transcription of the Necdin gene, a developmentally regulated candidate gene for the genomic imprinting-associated neurobehavioural disorder, Prader-Willi syndrome. ApoTRs activate Necdin expression through an nTRE in its promoter, downstream of the transcription start site. The nTRE of the Necdin gene resembles the nTREs of the TSHbeta genes of the hypothalamus-pituitary-thyroid axis in the sequence, position in the promoter, and mode of activation. We show that this group of nTRE-driven genes shares the requirements for binding of the retinoic X receptor and nuclear receptor corepressor/silencing mediator of retinoid and thyroid hormone receptors (NCoR/SMRT) for full ligand-independent activation, whereas there is no need for association of the p160 family of coactivators. In accordance with the requirement for corepressors, Necdin expression is influenced by deacetylase activity, suggesting that histone deacetylases and corepressors as well could function as activators of transcription, depending on the promoter context.

Regulation of regional expression in rat brain PC2 by thyroid hormone/characterization of novel negative thyroid hormone response elements in the PC2 promoter

The prohormone convertases (PCs) PC1 and PC2 are involved in the tissue-specific endoproteolytic processing of neuropeptide precursors within the secretory pathway. We previously showed that changes in thyroid status altered pituitary PC2 mRNA and that this regulation was due to triiodothyronine-dependent interaction of the thyroid hormone receptor (TR) with negative thyroid hormone response elements (nTREs) contained in a large proximal region of the human PC2 promoter. In the current study, we examined the in vivo regulation of brain PC2 mRNA by thyroid status and found that 6-n-propyl-2-thiouracil-induced hypothyroidism stimulated, whereas thyroxine-induced hyperthyroidism suppressed, PC2 mRNA levels in the rat hypothalamus and cerebral cortex. To address the mechanism of T3 regulation of the PC2 gene, we used human PC2 (hPC2) promoter constructs transiently transfected into GH3 cells and found that triiodothyronine negatively and 9-cis-retinoic acid positively regulated hPC2 promoter activity. EMSAs, using purified TRalpha1 and retinoid X receptor-beta (RXRbeta) proteins demonstrated that TRalpha bound the distal putative nTRE-containing oligonucleotide in the PC2 promoter, and RXR bound to both nTRE-containing oligonucleotides. EMSAs with oligonucleotides containing deletion mutations of the nTREs demonstrated that the binding to TR and RXR separately is reduced, but specific binding to TR and RXR together persists even with deletion of each putative nTRE. We conclude that there are two novel TRE-like sequences in the hPC2 promoter and that these regions act in concert in a unique manner to facilitate the effects of thyroid hormone and 9-cis-retinoic acid on PC2.

Thyroid hormone regulation of prohormone convertase 1 (PC1): regional expression in rat brain and in vitro characterization of negative thyroid hormone response elements.

Most pro-neuropeptides are processed by the prohormone convertases, PC1 and PC2. We previously reported that changes in thyroid status altered anterior pituitary PC1 mRNA and this regulation was due to triiodothyronine (T(3))-dependent interaction of thyroid hormone receptor (TR) with negative thyroid hormone response elements (nTREs) contained in a large region of the human PC1 promoter. In this study, we demonstrated that hypothyroidism stimulated, while hyperthyroidism suppressed, PC1 mRNA levels in rat hypothalamus and cerebral cortex, but not in hippocampus. In situ hybridization was used to confirm real-time PCR changes and localize the regulation within the hypothalamus and cortex. Using a human PC1 (hPC1) promoter construct (with and without deletions in two regions that each contain a negative TRE) transiently transfected into GH3 cells, we found that T(3) negatively regulated hPC1 promoter activity, and this regulation required both of these two regions. Electrophoretic mobility shift assays (EMSAs) using purified thyroid hormone receptor alpha1 (TRalpha1) and retinoid X receptor beta (RXRbeta) proteins demonstrated that RXR and TRalpha both bound the PC1 promoter. Addition of TRalpha1/RXRbeta to the wild-type PC1 probe demonstrated binding as both homodimers and a heterodimer. EMSAs with oligonucleotides containing deletion mutations of the putative nTREs demonstrated that the proximal nTRE binds more strongly to TR and RXR than the distal nTRE, but that both regions exhibit specific binding. We conclude that there are multiple novel TRE-like sequences in the hPC1 promoter and that these regions act in a unique manner to facilitate the negative effect of thyroid hormone on PC1.

Hormone-dependent repression of the E2F-1 gene by thyroid hormone receptors.

Thyroid hormone induces differentiation of many different tissues in mammals, birds, and amphibians. The different tissues all differentiate from proliferating precursor cells, and the normal cell cycle is suspended while cells undergo differentiation. We have investigated how thyroid hormone affects the expression of the E2F-1 protein, a key transcription factor that controls G1- to S-phase transition. We show that during thyroid hormone-induced differentiation of embryonic carcinoma cells and of oligodendrocyte precursor cells, the levels of E2F-1 mRNA and E2F-1 protein decrease. This is caused by the thyroid hormone receptor (TR) regulating the transcription of the E2F-1 gene. The TR binds directly to a negative thyroid hormone response element, called the Z-element, in the E2F-1 promoter. When bound, the TR activates transcription in the absence of ligand but represses transcription in the presence of ligand. In addition, liganded TR represses transcription of the S-phase-specific DNA polymerase alpha, thymidine kinase, and dihydropholate reductase genes. These results suggest that thyroid hormone-induced withdrawal from the cell cycle takes place through the repression of S-phase genes. We suggest that this is an initial and crucial step in thyroid hormone-induced differentiation of precursor cells.

Thyroid Hormone Receptor DNA Binding Is Required for Both Positive and Negative Gene Regulation

The beta isoform of thyroid hormone receptor (TR-beta) has a key role in the feedback regulation of the hypothalamic-pituitary-thyroid (H-P-T) axis. The mechanism of trans-repression of the hypothalamic thyrotropin-releasing hormone (TRH) and pituitary thyroid-stimulating hormone (TSH) subunit genes, however, remains poorly understood. A number of distinct mechanisms for TR-beta-mediated negative regulation by thyroid hormone have been proposed, including those that require and do not require DNA binding. To clarify the importance of DNA binding in negative regulation, we constructed a DNA-binding mutant of TR-beta in which two amino acids within the P box were altered (GSG for EGG) to resemble that found in the glucocorticoid receptor (GR). We termed this mutant GS125, and as expected, it displayed low binding affinities for positive and negative thyroid hormone-response element (pTRE and nTRE, respectively) in gel-mobility shift assays. In transient transfection assays, the GS125 mutant abolished transactivation on three classic pTREs (DR+4, LAP, and PAL) and all negatively regulated promoters in the H-P-T axis (TRH, TSH-beta, and TSH-alpha). However, GS125 TR-beta bound to a composite TR/GR-response element and was fully functional on this hybrid TR/GR-response element. Moreover, the GS125 TR-beta mutant displayed normal interactions with transcriptional cofactors in mammalian two-hybrid assays. These data do not support a DNA-binding independent mechanism for thyroid hormone negative regulation in the H-P-T axis.

Feedback on Hypothalamic TRH Transcription Is Dependent on Thyroid Hormone Receptor N Terminus

The beta thyroid hormone receptor (TRbeta), but not TRalpha1, plays a specific role in mediating T(3)-dependent repression of hypothalamic TRH transcription. To investigate the structural basis of isoform specificity, we compared the transcriptional regulation and DNA binding obtained with chimeric and N-terminally deleted TRs. Using in vivo transfection assays to follow hypothalamic TRH transcription in the mouse brain, we found that TRbeta1 and chimeras with the TRbeta1 N terminus did not affect either transcriptional activation or repression from the rat TRH promoter, whereas N-terminally deleted TRbeta1 impaired T(3)-dependent repression. TRalpha1 or chimeras with the TRalpha1 N terminus reduced T(3)-independent transcriptional activation and blocked T(3)-dependent repression of transcription. Full deletion of the TRalpha1 N terminus restored ligand-independent activation of transcription. No TR isoform specificity was seen after transcription from a positive thyroid hormone response element. Gel mobility assays showed that all TRs tested bound specifically to the main negative thyroid hormone response element in the TRH promoter (site 4). Addition of neither steroid receptor coactivator 1 nor nuclear extracts from the hypothalamic paraventricular nuclei revealed any TR isoform specificity in binding to site 4. Thus N-terminal sequences specify TR T(3)-dependent repression of TRH transcription but not DNA recognition, emphasizing as yet unknown neuron-specific contributions to protein-promoter interactions in vivo.

Feedback on hypothalamic TRH transcription is dependent on thyroid hormone receptor N terminus.

The beta thyroid hormone receptor (TRbeta), but not TRalpha1, plays a specific role in mediating T(3)-dependent repression of hypothalamic TRH transcription. To investigate the structural basis of isoform specificity, we compared the transcriptional regulation and DNA binding obtained with chimeric and N-terminally deleted TRs. Using in vivo transfection assays to follow hypothalamic TRH transcription in the mouse brain, we found that TRbeta1 and chimeras with the TRbeta1 N terminus did not affect either transcriptional activation or repression from the rat TRH promoter, whereas N-terminally deleted TRbeta1 impaired T(3)-dependent repression. TRalpha1 or chimeras with the TRalpha1 N terminus reduced T(3)-independent transcriptional activation and blocked T(3)-dependent repression of transcription. Full deletion of the TRalpha1 N terminus restored ligand-independent activation of transcription. No TR isoform specificity was seen after transcription from a positive thyroid hormone response element. Gel mobility assays showed that all TRs tested bound specifically to the main negative thyroid hormone response element in the TRH promoter (site 4). Addition of neither steroid receptor coactivator 1 nor nuclear extracts from the hypothalamic paraventricular nuclei revealed any TR isoform specificity in binding to site 4. Thus N-terminal sequences specify TR T(3)-dependent repression of TRH transcription but not DNA recognition, emphasizing as yet unknown neuron-specific contributions to protein-promoter interactions in vivo.

Regulation of apoA1 gene expression with acidosis: requirement for a transcriptional repressor.

Serum apolipoprotein A(1) (apoA(1)) concentration is inversely correlated with the risk of premature atherosclerosis. Serum apoA(1) concentrations are regulated, in part, at the transcriptional level. ApoA(1) mRNA is synthesized primarily in the liver and small intestine, under the direction of a number of signaling molecules and tissue-specific regulatory elements. Previously, we demonstrated that extracellular acidosis suppresses apoA(1) mRNA levels at the level of transcription. Here we demonstrate that intracellular acidosis, in the absence of extracellular pH changes, represses apoA(1) promoter activity. Repression occurs through a pH responsive element (pH-RE) located within the apoA(1) gene promoter. Acidosis increases the specific DNA binding activity of a putative repressor protein within the immediate 5'-flanking region of the apoA(1) gene. The cis-element that binds the putative repressor protein contains a negative thyroid hormone response element (nTRE) located 3' and adjacent to the apoA(1) TATA box. Mutation of the nTRE/pH-RE abrogates protein binding and alters the activity of reporter genes controlled by this element. Repression by acidosis did not require de novo mRNA and protein synthesis. Inhibition of tyrosine kinase activity and diacylglycerol-stimulated protein kinase C (PKC) signaling pathways with tyrophostin A47 and phorbol myristate acetate, respectively, did not affect the repression of apoA(1) promoter activity with acidosis. These results suggest that transcriptional repression of the apoA(1) gene by alterations in ambient pH is associated with enhanced DNA binding activity of a repressor protein, through a mechanism which appears to be independent of de novo mRNA and protein synthesis, tyrosine kinase activity, or PKC activation.

Interactions between the prohormone convertase 2 promoter and the thyroid hormone receptor.

The majority of prohormones are cleaved at paired basic residues to generate bioactive hormones by prohormone convertases (PCs). As PC1 and PC2, two neuroendocrine-specific PCs, appear to be the key enzymes capable of processing a variety of prohormones, alterations of PC2 and/or PC1 levels will probably have a profound effect on hormonal homeostasis. We investigated the regulation of PC2 messenger RNA (mRNA) by thyroid hormone using GH3 cells to demonstrate that T3 negatively regulated PC2 mRNA levels in a dose- and time-dependent fashion. Functional analysis of progressive 5'-deletions of the human (h) PC2 promoter luciferase constructs in GH3 cells demonstrated that the regulation probably occurs at the transcriptional level, and that putative negative thyroid hormone response elements were located within the region from -44 to + 137 bp relative to the transcriptional start site. Transient transfections in JEG-3 cells and COS-1 cells showed that the suppressive effect of T3 was equally mediated by the thyroid hormone receptor (TR) isoforms TRalpha1 and TRbeta1. Electrophoretic mobility shift assays using purified TRal and retinoid X receptor-beta protein as well as GH3 nuclear extracts showed that regions from +51 to +71 bp and from +118 to +137 bp of the hPC2 promoter bind to TRalpha1 as both a monomer and a homodimer and with TRalpha1/retinoid X receptor-beta as a heterodimer. Finally, the in vivo regulation of pituitary PC2 mRNA by thyroid status was demonstrated in rats. These results demonstrate that T3 negatively regulates PC2 expression at the transcriptional level and that functional negative thyroid hormone response elements exist in the hPC2 promoter. We postulate that the alterations of PC2 activity may mediate some of the pathophysiological consequences of hypo- or hyperthyroidism.

Triac regulation of transcription is T 3 receptor isoform- and response element-specific

3,5,3′-triiodothyroacetic acid (Triac) is a naturally occurring triiodothyronine (T 3) analog, which has been used on an empirical basis to treat the syndrome of resistance to thyroid hormone (RTH). The aim of our studies was to compare the effects of Triac and T 3 on negative and positive thyroid hormone response elements (TREs). We used transient transfections with luciferase reporter genes to show that on palindromic, inverted palindrome and human TRH reporters, Triac is more potent than T 3 for transcriptional regulation by TRβ1 and TRβ2 isoforms, while regulation by TRα1 is equivalent for both ligands. Other TREs (direct repeat, hTSHα and hTSHβ) are not regulated differently by Triac and T 3. Dose–response curves show that the difference between Triac and T 3 is maximal in the 1–10 nM range. Receptor-binding studies reveal a greater affinity of Triac than T 3 for TRβ1 and TRβ2 isoforms, which could explain its isoform-specific effects. These data suggest that the TRE- and TR isoform-specific effects of Triac favor its use in RTH.

DNA binding and interaction with the nuclear receptor corepressor of thyroid hormone receptor are required for ligand-independent stimulation of the mouse preprothyrotropin-releasing hormone gene

A negative thyroid hormone response element (TRE) in the mouse preprothyrotropin-releasing hormone (TRH) gene was previously mapped within the proximal promoter element between −83 and +53 that contained a TRE half-site motif at −57 ( −57TGACCT −52). In transfection experiments, the promoter activity is stimulated by unliganded thyroid hormone receptor (TR) and T 3 reverses the basal promoter stimulation. In this study, we determined whether the direct binding of TR to the TRE half-site in the mouse TRH gene is required for the ligand-independent stimulation using a transient transfection assay into CV-1 cells and electrophoretic mobility shift assays (EMSA). In addition, the role of a corepressor protein for the ligand-independent stimulation was examined using a putative splicing variant of the nuclear receptor corepressor (N-CoRI). Point mutations introduced into the TRE half-site at −57 eliminated the binding of TR and the stimulatory effect of unliganded TR. Two mutant TRs lacking DNA-binding activity and two CoR box mutant TRs showed no stimulation in the wild-type TRH promoter. The cotransfected N-CoRI potentiated the ligand-independent stimulation by the wild-type TR, but did not compensate for the impaired function of the CoR box mutant TR. In EMSA, TR strongly bound as homodimers and weakly as heterodimers with retinoid X receptor (RXR) to the element containing the TRE half-site at −57. Binding of TR to the TRE half-site was essential to form homo- and heterodimers, and the RXR binding site appeared to be located downstream of the TRE half-site. In vitro translated N-CoRI preferentially bound TR homodimers over TR/RXR heterodimers. These results collectively suggest that the DNA-bound TR/corepressor complex might be directly involved in the ligand-independent stimulation of the mouse TRH gene promoter.

Thyroid Hormone Negatively Regulates the Transcriptional Activity of the β-Amyloid Precursor Protein Gene

The expression of the beta-amyloid precursor protein (APP), which plays a key role in the development of Alzheimer's disease, is regulated by a variety of cellular mediators in a cell-dependent manner. In the present study, we present evidence that thyroid hormones negatively regulate the expression of the APP gene in neuroblastoma cells. Transient transfection studies using plasmids that contain progressive deletions of the 5' region of the gene demonstrate that triiodothyronine (T3), the more active form of the thyroid hormones, represses APP promoter activity by a mechanism that requires binding of the nuclear T3 receptor (TR) to a specific sequence located in the first exon. The unliganded receptor increases promoter activity, and T3 reverses that activity to basal levels. The repressive effect of T3 does not exhibit TR isoform specificity, and it is equally mediated by TRalpha and TRbeta. Gel mobility shift assays using in vitro synthesized nuclear receptors and nuclear extracts led to the identification of a negative thyroid hormone response element, at nucleotide position +80/+96, that preferentially binds heterodimers of TR with the retinoid X receptor. Insertion of sequences containing this element confers negative regulation by T3 to a heterologous TK promoter, thus indicating the functionality of the element.

Characterization of a negative thyroid hormone response element in the rat sodium, potassium-adenosine triphosphatase alpha3 gene promoter.

The thyroid hormone L-T3 elicits either a stimulatory or an inhibitory effect on expression of the Na,K-adenosine triphosphatase alpha3-subunit gene in primary cultures of neonatal rat cardiac myocytes. The present study was undertaken to characterize a negative thyroid hormone response element present within the rat Na,K-adenosine triphosphatase alpha3-subunit gene proximal promoter. Transient transfection assays indicated that the DNA-binding domain of thyroid hormone receptor was essential for mediating repression of alpha3 gene transcription by thyroid hormone. This negative effect of thyroid hormone was enhanced in the presence of cotransfected retinoid X receptor and its ligand 9-cis-retinoic acid. Inhibition of alpha3 chimeric gene expression by thyroid hormone was dependent on the initial cell plating density. The negative thyroid hormone response element was localized to a region between nucleotides -68 to -6 of the alpha3 gene. Electrophoretic mobility shift assays showed that thyroid hormone receptor binds in a synergistic manner as a heterodimer with retinoid X receptor to two sites at positions -62 to -41 and -39 to -17 of the alpha3 gene promoter. The upstream and downstream heterodimer binding sites coexist with CAAT and TATA elements, respectively.

Characterization of a Negative Thyroid Hormone Response Element in the Rat Sodium, Potassium-Adenosine Triphosphatase 3 Gene Promoter

Characterization of a Negative Thyroid Hormone Response Element in the Rat Sodium, Potassium-Adenosine Triphosphatase 3 Gene Promoter