Negative Control Research Articles

Application of the horse grimace scale in horses with dental disease: Preliminary findings.

Dental disease is a common but often under-recognised condition in horses, possibly due to an inability to recognise clinical signs of oral discomfort. Some dental disorders are reportedly more painful than others, but there is no current metric by which dental pain can be objectively assessed. This study aimed to determine whether a facial expression-based pain scale offered an objective and reliable method for assessing dental pain in horses. It was hypothesised that dental disorders affecting the periodontium would produce high pain scores. Twelve horses with dental disease were evaluated for pain using a numerical rating scale (NRS) and a horse grimace scale (HGS) by blinded observers using still, lateral photographs. Interobserver reliability was poor across all observers when both the NRS (intraclass correlation coefficient [ICC] = 0.36) and the HGS (ICC = 0.27) were used in horses with dental disease. The highest mean scores were given for horses with equine odontoclastic tooth resorption and hypercementosis (EOTRH) and periodontal disease (PD). This study has a small sample size of both horses and questionnaire respondents, and the respondent demographics are not representative of the wider veterinary population Furthermore, no positive or negative controls were used for the pain scoring. The results of this study indicate the unreliability of tools designed for identifying acute pain for assessing chronic pain, such as dental pain. A more dental-specific ethogram is required to accurately identify dental pain in horses. Both the NRS and HGS produced the highest mean scores for EOTRH and PD, supporting existing literature that these conditions are associated with more obvious signs of pain.

Effectiveness of Mango Gedong Gincu Peel Extract Gel (<i>Mangifera indica</i> L.) on Cut Wounds in Male Wistar White Rats (<i>Rattus norvegicus</i>)

Background: A wound is an injury to a part of the body where the skin and the underlying tissue lose continuity. The wound healing is a complex process consisting inflammatory phase, proliferation phase, and maturation phase. Open wounds often occur in everyday life and if left behind and untreated can potentially lead to bacterial infection. Mango gedong gincu peel extract (Mangifera indica L.) contains flavonoids, tannins, phenols, triterpenoids, steroids, alkaloids, and saponins which have roles in wound healing. Aims: To analyses the effectiveness of mango gedong gincu peel extract gel (Mangifera indica L.) against the healing of cut wounds in male wistar white rats (Rattus norvegicus). Methods: The study was an experimental study with a post-test only control group design using 25 male wistar white rat as the subject and was carried out in the FK UGJ Research Laboratory. The study used five groups : negative control group, positive control group, and treatment group using mango gedong gincu peel extract gel (Mangifera indica L.) with concentrations of 5%, 10%, and 15%. Results: The results of the study revealed that mango (Mangifera indica L.) gedong gincu peel is a source of various phytochemical such as flavonoids, tannins, phenols, triterpenoids, steroids, alkaloids, and saponins. This study showed that the 5% and 10% concentration treatment groups had the same average length measurement wound of 0.86 cm. The fastest observation of erythema was the 5% concentration group with a healing rate of 8 days, in the observation of edema the 10% concentration group was the fastest of 6 days, and the observation long of healing time was 5% and 10% concentration had the same rate of 11 days. Conclusion: Mango gedong gincu peel extract gel (Mangifera indica L.) was effective against wound healing with optimum concentrations of 5% and 10% which gives the best healing effect against wounds in male wistar white rats (Rattus norvegicus). Received: 25 September 2024 | Reviewed: 22 October 2024 | Revised: 05 November 2024 | Accepted: 09 November 2024.

MR Corge: Sensitivity analysis of Mendelian randomization based on the core gene hypothesis for polygenic exposures.

Mendelian randomization is being utilized to assess causal effects of polygenic exposures, where many genetic instruments are subject to horizontal pleiotropy. Existing methods for detecting and correcting for horizontal pleiotropy have important assumptions that may not be fulfilled. Built upon the core gene hypothesis, we developed MR Corge for performing sensitivity analysis of Mendelian randomization. MR Corge identifies a small number of putative core instruments that are more likely to affect genes with a direct biological role in an exposure and obtains causal effect estimates based on these instruments, thereby reducing the risk of horizontal pleiotropy. Using positive and negative controls, we demonstrated that MR Corge estimates aligned with established biomedical knowledge and the results of randomized controlled trials. MR Corge may be widely applied to investigate polygenic exposure-outcome relationships. An open-sourced R package is available at https://github.com/zhwm/MRCorge. Supplementary data are available at Bioinformatics online.

Characterization of the Blood Bacterial Microbiota in Lowland Tapirs (Tapirus terrestris), a Vulnerable Species in Brazil

Microbiome studies targeting hypervariable regions of the 16S rRNA gene are suitable for understanding interactions between animals and their associated bacteria. While many studies focus on the gut microbiome, assessments of blood microbiota remain scarce despite the prevalence of blood-borne pathogens in vertebrates. This study aimed to investigate the bacterial community in blood samples from 79 living and 7 road-killed lowland tapirs (Tapirus terrestris), a vulnerable species, sampled in two biomes in midwestern Brazil: Pantanal and Cerrado. Animals were categorized by condition (living or road-killed), sex, age, and biome. V3–V4 16S rRNA fragments were obtained from 86 blood samples and 4 negative controls. After filtering contaminants, 13,742,198 sequences representing 2146 ASVs were analyzed. Alpha diversity significantly differed by condition, while beta diversity differed by condition, site, and age (adults vs. sub-adults). For living animals (79/86 samples), alpha diversity showed no significant differences, but beta diversity differed by age. Different vector-borne bacterial pathogens, including Anaplasmataceae, Bartonella, and Borrelia spp., were detected. Additionally, evidence of transient translocation of microbial communities from other body regions to the bloodstream was observed. Amplification of bacterial 16S rRNA from blood samples of wild T. terrestris provided novel information about the diversity of blood-borne microbiota of lowland tapirs, members of a poorly studied mammalian family. Next-generation sequencing proved to be a valuable tool for screening potential vector-borne pathogens in this host.

The possible protective effect of luteolin on cardiovascular and hepatic changes in metabolic syndrome rat model.

The metabolic syndrome, or MetS, is currently a global health concern. The anti-inflammatory, anti-proliferative, and antioxidant properties of luteolin are some of its advantageous pharmacological characteristics. This research was designed to establish a MetS rat model and investigate the possible protective effect of luteolin on cardiovascular, hepatic, and metabolic changes in diet-induced metabolic syndrome in rats. Forty adult male albino rats were split into four groups: a negative control group, a group treated with luteolin, a group induced MetS (fed 20% fructose), and a group treated with luteolin (fed 20% fructose and given luteolin). Following the experiment after 8weeks, biochemical, histological (light and electron), and immunohistochemistry analyses were performed on liver and heart tissues. Serum levels of cTnI, CK-MB, and LDH were significantly elevated in response to the cardiovascular effect of MetS. Furthermore, compared to the negative control group, the MetS group showed a marked increase in lipid peroxidation in the cardiac and hepatic tissues, as evidenced by elevated levels of MDA and a decline in the antioxidant defense system, as demonstrated by lower activities of GSH and SOD. The fatty liver-induced group exhibited histological alterations, including disrupted hepatic architecture, dilated and congested central veins, blood sinusoids, and portal veins. In addition to nuclear structural alterations, most hepatocytes displayed varying degrees of cytoplasmic vacuolation, mitochondrial alterations, and endoplasmic reticulum dilatation. These alterations were linked to inflammatory cellular infiltrations, collagen fiber deposition, active hepatic stellate cells, and scattered hypertrophied Kupffer cells, as demonstrated by electron microscopy and validated by immunohistochemical analysis. It is interesting to note that eosinophils were seen between the liver cells and in dilated blood sinusoids. Moreover, the biochemical (hepatic and cardiac) and histological (liver) changes were significantly less severe in luteolin-treated raton a high-fructose diet.These results suggested that luteolin protects against a type of metabolic syndrome that is produced experimentally.

17β-estradiol inhibits Notch1 activation in murine macrophage cell line RAW 264.7.

Macrophages are major effectors in regulating immune response and inflammation. The pro-inflammatory phenotype (M1) is induced by the activation of the Toll-like receptor 4 (TLR4) on the macrophage surface, which recognizes lipopolysaccharide (LPS), a component of Gram-negative bacterial wall, and by the binding of interferon-gamma (IFNγ), a cytokine released by activated T lymphocytes, to its receptor (IFNGR). Among the pathways activated by LPS/IFNγ is the Notch pathway, which promotes the M1 phenotype. Conversely, 17β-estradiol (E2) has been shown to blunt LPS-mediated inflammatory response. While it has been shown that E2 regulates the activity of the Notch1 receptor in human endothelial cells, there is no evidence of estrogen-mediated regulation of Notch1 in macrophages. In this study, RAW 264.7 cells were stimulated with LPS/IFNγ in the presence or absence of E2 and/or N-[N-(3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT), an inhibitor of γ-secretase, the enzyme involved in Notch activation. The effects of treatment on inducible nitric oxide synthase (iNOS), on components of the Notch pathway, and MAPK (mitogen-activated protein kinase) were assessed by quantitative PCR and Western blotting. We found that E2, through a mechanism involving the inhibition of p38 phosphorylation, reduces the activation of Notch1 induced by LPS/IFNγ. On the contrary, Notch1 exerts a negative control on the estrogen receptor α (ERα) since Notch1 inhibition increases the protein levels of this receptor. In conclusion, we report for the first time a Notch-ERα interaction in macrophages. Our data suggest that E2 may reduce LPS/IFNγ-mediated M1 pro-inflammatory phenotype in macrophages by inhibiting Notch1. This finding encourages further studies on Notch1 inhibitors as novel treatments for inflammation-related diseases.

Effects of Matricaria aurea extract in excisional wound healing on albino rats

The Asteraceae herbal plant Matricaria aurea (Loefl.) Sch.Bip is well known for its use in treating gastrointestinal, cardiac, pulmonary, rheumatologic and many other ailments; nevertheless, wound care has not yet received scientific validation. This study was done to evaluate the efficacy of M. aurea topical formulation on the rate of wound healing and contraction and the histopathological properties of the healing tissue in a rat model of an excisional wound. A total of 45 male rats with excisional wounds were enrolled in the study. The rats were divided into three groups, each with 15 male rats weighing approximately 200–250 g. The first group received treatment with M. aurea, the second group received fusidic acid cream and the third group received normal saline. The treatment was administered for 15 days while photographs were taken every other day, the diameters were measured and a histopathologic examination was conducted. There was a significant accelerated effect for wound healing, as evidenced by the inflammatory cells and diameters reducing to almost the same degree in the M. aurea and fusidic acid groups as compared to the control group (p<0.05). In vivo, the healing of wounds in albino Wister rats is demonstrated by the ethanolic extract of M. aurea. The findings, which show enhanced contraction, epithelization and tensile strength, significantly imply that wound healing promotion and acceleration can be achieved based on faster healing as compared to negative control and similar to standard control (fusidic acid) wounds.

Anti –Inflammatory Activity of Propolis Trigona sp. Water Extract from North Lombok with Red Blood Cell Membrane Stability Method

Propolis is a bee product that can be used as an anti-inflammatory. Cultivation of propolis-producing bees is also carried out in North Lombok. However, propolis has not been utilized optimally by the people of North Lombok. Apart from that, testing of North Lombok propolis is still limited to the chemical content and antioxidant activity of propolis extracted with ethanol solvent. Therefore, this study aims to determine the activity and effective concentration of North Lombok propolis water extract as an anti-inflammatory using the red blood cell membrane stability method. Groups include control groups such as positive control (diclofenac sodium), negative control (distilled water), and test groups (propolis water extract concentrations of 10%, 12.5%, 15%, 17.5%, 20%, 22.5%, 25%, 27.5%, and 30%). In The first step human blood was centrifuged of human blood, and then part of the red blood cells (sediment) was taken and saline was added to obtain a red blood cell suspension. Next, mixing the test solution was carried out in the order of 0.5 ml of red blood cell suspension, then 0.5 ml of extract was added (0.1% w/v Na-diclofenac solution in the positive control, distilled water in the negative control), 1 mL of buffer solution and 2 mL of hyposaline solution, then homogenized. Each group was incubated at 37°C for 30 minutes, then centrifuged for 10 minutes at 3000 rpm. The supernatant was taken, and the absorbance was read with a UV-Vis spectrophotometer at 560 nm. Next, the percentage value of red blood cell hemolysis protection was calculated. The data obtained were tested statistically using One-way ANOVA and post-hoc (LSD) tests SPSS version 29. The results showed that propolis water extract concentrations were 10%, 12.5%, 15%, 17.5%, 20%, 22.5%, 25%, 27.5%, and 30% have anti-inflammatory activity because they can increase the stability of the red blood cell membrane with a percentage of hemolysis protection of respectively 57.92%, 59.99%, 60.99%, 61.99%, 64.31%, 69.59%, 75.07%, 79.77% and 84.45%. Propolis water extract concentrations of 10%, 12.5%, 15%, 17.5%, 20%, 22.5%, and 25% had anti-inflammatory effects that were not significantly different from the positive control (p>0.05). The 27.5 % and 30% concentrations had a higher percent hemolysis protection value than the positive control (p<0.05).

Gastroprotective Effect of Quercetin and Misoprostol in Ethanol-Induced Gastric Ulcer in Rats.

This study aimed to evaluate the possible synergistic gastroprotective activity of quercetin and misoprostol in gastric ulcers induced by ethanol in rats. Male Wister albino rats were allocated into 6 groups: Negative control, positive control, esomeprazole, quercetin, misoprostol, and a combination of quercetin and misoprostol. All the treatment groups except for the negative control were challenged with a single dose of ethanol (90%) after 14 days of treatment. The animals were euthanized 1 hour after ethanol administration, and the blood samples were collected and used for the measurement of catalase, GSH, LDH, and IL-6. The stomachs were immediately removed and used for the measurement of gastric ulcer index, lesion area, gastric volume, and pH. Finally, gastric tissue was sent for histopathological examination. The combination of quercetin with misoprostol resulted in a comparable effect to esomeprazole regarding the inhibitory effect on gastric lesions, ulcer index, and free and total acidity. Moreover, this combination significantly decreased the level of LDH with a nonsignificant decrease in the IL-6 level. Esomeprazole and the combination group restored the level of catalase and quercetin alone and in the combination group elevated the level of GSH. Additionally, remarkable protection appeared in the pathological findings, especially in the group treated with quercetin and misoprostol. This study clearly revealed the gastroprotective effect produced by combining quercetin with misoprostol by decreasing ulcer area and index, restoring antioxidant enzyme levels, and ameliorating inflammation. These findings suggest the use of this combination in a clinical setting.

Evaluation of the clinical performance of anti-mutated citrullinated vimentin antibody and 14-3-3 eta testing in rheumatoid arthritis.

Early rheumatoid arthritis (RA) detection is crucial for improving patient prognosis. Anticyclic citrullinated peptide antibodies (anti-CCP) and rheumatoid factors (RF) support RA diagnosis but are undetectable in ∼20 % of cases. Recently, antibodies against mutated citrullinated vimentin (anti-MCV) and detection of 14-3-3 eta have emerged with implications for preclinical RA diagnosis and monitoring treatment. The objective of this study was to assess the clinical performance of anti-MCV antibodies and 14-3-3 eta in RA and to compare it to current RA criteria anti-CCP and RF markers, individually and in combination. A retrospective chart review of 326 subjects submitted for RA serology testing identified 134 RA positive and 192 RA negative disease control individuals. Fifty healthy controls specimens were also included. Performance of anti-MCV and 14-3-3 eta, alone and combined with CCP3.1 and RF, was assessed. Anti-MCV had a sensitivity of 71 % and a specificity of 92 %. 14-3-3 eta had a sensitivity of 43 % and a specificity of 90 %. In comparison, CCP3.1 and RF displayed a sensitivity of 79 % and 84 % and a specificity of 92 % and 61 %, respectively. ROC curve analysis demonstrated CCP3.1 and anti-MCV had superior diagnostic performance compared to RF and 14-3-3 eta. In our cohort, anti-MCV and 14-3-3 eta failed to identify seronegative RA patients. Different combinations of double antibody positivity increased specificity at the cost of lost sensitivity. Individually, 14-3-3 eta, anti-MCV and CCP3.1 assays had≥90 % specificity in diagnosed RA patients, with better sensitivities for anti-MCV and CCP3.1 than 14-3-3 eta. Overall diagnostic performance of anti-MCV was similar to CCP3.1 and RF, all of which outperformed 14-3-3 eta in our cohort.

PROTECTIVE EFFECT OF COMBINATION OF ETHANOLIC EXTRACTS OF XIMENIA AMERICANA AND TERMINALIA MACROPTERA AGAINST ALCOHOL-INDUCED HEPATOTOXICITY IN RATS

Objective: The aim of this study was to evaluate the hepatoprotective effect of the combination. Methods: Serum liver markers, tissue antioxidant activity, and histological changes in the livers of rats from the blank, negative (distilled water), positive (silymarin 100 mg/kg bw), and test (combination 500 mg/kg bw) groups were measured after 7 days of pretreatment and induction of hepatotoxicity by 10 g/kg bw alcohol every 12 h for 48 h. Results: Rats in the negative control group showed a highly significant (p<0.001) increase in aspartate aminotransferase (AST), alanine aminotransferase (ALT), and total bilirubin (BT) levels by 281.13%, 221.7%, and 93.44%, respectively, compared to rats in the blank group. Pretreatment with the combination resulted in a highly significant (p<0.001) decrease in AST, ALT, and BT levels of 69.19%, 62.24%, and 41.52%, respectively. The study of tissue oxidative stress parameters revealed a very significant (p<0.01) increase in superoxide dismutase (123.08%), glutathione (131.66%), and catalase (49.01%) activities and a significant (p<0.05) decrease in malondialdehyde concentration (59.72%) in the group pretreated with the combination compared with the negative control group. Steatosis and necrosis estimated at 50% were observed in rats in the negative control group. In contrast, necrosis observed in the group pre-treated with the combination was <10%. Conclusion: These data suggest that the combination is effective in preventing the elevation of biochemical markers and the imbalance of enzymatic and non-enzymatic antioxidant systems caused by alcohol.

EVALUATION OF AN ANTI-DANDRUFF SHAMPOO INCORPORATING ETHANOL EXTRACT FROM CORN SILK (ZEA MAYS L.) AGAINST CANDIDA ALBICANS FUNGUS: FORMULATION AND ACTIVITY ASSESSMENT

Objective: The aim of this study was to investigate the effectiveness of corn silk (Zea mays L.) extract as an antifungal ingredient in shampoo formulation for treating dandruff caused by Candida albicans. Methods: Plant identification, sampling, preparation of simplisia, phytochemical screening, simplisia characterization, ethanol extraction of corn silk, and the formulation of shampoos with extract concentrations of 5%, 10%, and 15%, alongside blank and positive controls. The formulations underwent physical evaluation, irritation testing, and antifungal activity testing using the disc diffusion method. Results: The corn silk shampoo formulations were stable during storage, non-irritating, was in thick liquid form with yellowish to brown colour, corn scent, had pH between 5.0-5.8, foaming capacity at 10.3-13.0 cm, with the viscocity ranging 1967-2224 cPs, means it met the required standards for shampoo formulation and characterization. Antifungal testing revealed inhibition zone diameters of 0 mm for the blank (F0), 7.87 mm for F1 (5%), 9.46 mm for F2 (10%), 15.89 mm for F3 (15%), and 18.71 mm for the positive control (C+), with a one-way ANOVA test indicating a significant difference compared to the negative control. Conclusion: Corn silk extract could be effectively formulated into an antifungal shampoo, with the 15% concentration being the most effective against Candida albicans, highlighting its potential as a natural ingredient for anti-dandruff shampoos.

Modifikasi Media Tanam Tanah Terinfeksi Ganoderma pada Pembibitan Kelapa Sawit di Pre Nursery

Nursery planting media in smallholder oil palm plantations that are attacked by stem rot disease caused by Ganoderma sp do not receive special attention and it is not uncommon for farmers to use land around their oil palm plantations that is attacked by Ganoderma. This research aims to modify planting media infected with Ganoderma spp with Trichoderma spp input in the planting media for oil palm (Elaeis guineensis Jacq.) nurseries in the Pre-Nursery. The research was conducted in the Greenhouse of the Indonesian Palm Oil Technology Institute in March 2024. Planting media material from the Ganoderma-infested People's palm oil plantations was taken from Kwala Pesilam village, Padang Tualang sub-district, Langkat district, North Sumatra Province. The design used in the research was a non-factorial Randomized Design with 5 (five) treatment levels, namely T01 (positive control) using soil infected with Ganoderma spp, T02 (negative control) using sterile soil, T1 = 5 grams of Trichoderma, T2 = 10 grams of Tricodherma and T3 = 15 grams of Trichoderma. The research results the application of Trichoderma 10 g/seed doses gave good results on average growth of oil palm seedlings and diseasesin seedlings are dominates by anthacnose

First Report of Lelliottia amnigena Causing Soft Rot on Purple Stem Mustards in China.

The purple stem mustards (Brassica rapa subsp. chinensis var. purpuraria) (Govaerts R, 2003) are widely cultivated along Yangtze River Valley in China, which is famous for its flavorful and nutritious edible stalks (Wang et al., 2022). In February 2023, a disease of soft rot was observed in multiple purple stem mustards planting fields in Wuhan city, Hubei province, China (30.41°N, 114.22°E). Disease incidence rates were almost 20 to 30% in the planting area (5 ha in size), causing severe economic loss. Infected plants displayed water-soaked symptoms at the base of the petioles, emitting a foul soft rot odor. The severely infected petioles, stems and roots exhibit pus symptoms leading to plant death. To identify the causal agent, small pieces of soft rot symptomatic tissue were cut from the margin of necrotic lesions and surface disinfected with 75% (v/v) ethanol for 30 seconds, followed by three successive rinses with sterile distilled water. The exudates from the clipped tissues were serially diluted and then incubated onto nutrient agar (NA) plates to obtain purified strains at 28°C for 48 hours (Koike et al., 2002). After incubation, 15 strains were obtained and the colonies of all strains were Gram-negative, aerobic, small, round, convex, whitish to dull white, and had smooth slimy edges. Three single bacterial strains CT020801 - CT020803, which were individually isolated from three different diseased samples, were selected as representative strains for further study. Biochemical tests using the BIOLOG GENIII microplate system (Biolog, Hayward, CA, USA) revealed that these strains were positive for methyl red, pectin, dextrin, D-Cellobiose, β-galactosidase, citrate, and maltose, but negative for indole, arginine dihydrolase, urease, ornithine decarboxylase, and gelatinase tests. The 16S ribosomal RNA gene and the three housekeeping genes, atpD, rpoB, and recN were amplified using genomic DNA of Lelliottia amnigena NCTC12124T as the template, with specially designed primers. All amplified fragments were sequenced and deposited in GenBank with accession numbers OQ954706-OQ954707, OQ954713, and OQ953873-OQ953881. BLAST alignments of the 16S rRNA, atpD, rpoB and recN sequences revealed that the sequences of Strain CT020801-03 exhibited the highest identity (100%, ≥97.97%, ≥98.85% and ≥94.52%, respectively) with L. amnigena （Figure S2）. Phylogenetic tree analysis based on multilocus sequence joint 16S rRNA - atpD - rpoB - recN revealed that CT020801 - CT020803 and L. amnigena clustered together in the same clade (Carrie et al., 2013). These results were consistent with those reported for Lelliottia amnigena (Osei et al., 2022). To confirm pathogenicity, healthy base petioles of three-week-old purple stem mustards seedlings were stab inoculated with 20 μL bacterial suspensions (approximately 108 CFU/mL) and then incubated at 28°C and 80% relative humidity in a growth chamber. A sterile liquid NB medium served as the negative control. The test was repeated thrice with each test consisting of five seedlings per treatment. After three days, soft rot symptoms appeared on the stem bases of the inoculated plants, consistent with the initial symptoms observed in the field. Control plants showed no symptoms. The strains were successfully re-isolated from symptomatic plants and identified as L. amnigena, fulfilling Koch's postulates. L. amnigena, a member of the Enterobacter genus (Birlutiu et al., 2023; Brady et al., 2013; Izard et al., 1981), is commonly found in soil and has been identified as an opportunistic pathogen responsible for plant soft rot disease (Reyes-García et al., 2020; Schroeder et al., 2009; Wu et al., 2023). Previous studies have linked L. amnigena to soft rot disease in potato tubers in China. However, this study marks the first documented case of L. amnigena causing soft rot disease in purple stem mustards in China. This discovery expands the known host range of the pathogenic bacteria and will help to provide essential information for making effective measures to manage this disease.

First Report of Root-knot Nematode, Meloidogyne enterolobii, on Luffa cylindrica (L.) in Guangxi, China.

Luffa cylindrica (L.), an annual climbing herb of the Cucurbitaceae family, has a long planting history in China and is deeply loved by people due to its nutritional and medicinal value (Partap S, Kumar A et al., 2012). April 2023, symptoms such as plant dwarfism, decreased yield and serious root-knots appeared on L. cylindrica sampled from a commercial production base in Beihai, Guangxi, China (GPS 21°55'79″ N;109°49'61″ E). The investigated area of L. cylindrica was about 1.3 ha, the incidence of root-knot nematode disease was almost 90%. The roots of 20 L. cylindrica were dug up and many root-knots and egg masses were found. Nematodes in samples at different stages were collected by shallow dish method, and morphological identification was caried out. Males were worm-like, annulated, with the anterior part slightly conical. Females were globular to pyriform. The perineal pattern was oval, with the dorsal arch being moderately high to tall. The tail of the second-stage juvenile (J2) was very slender with a sharp tip. The transparent tail end was clearly visible. Morphological measurements of females (n = 20): body length = 677.2 ± 34.4 μm, body width = 512.8 ± 45.4 μm, stylet = 13.7 ± 0.5 μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 5.7 ± 0.8 μm. The measurements of J2s (n = 20): body length = 412.5 ± 19.4 μm, body wide = 16.2 ± 1.3 μm, stylet lengths = 12.6 ± 0.92 μm, DGO length = 3.1 ± 0.3 μm. Average tail length = 45.44 ± 4.1μm. The observed typical characteristics of M. enterolobii were consistent with those previously described by Yang & Eisenback (1983) and EPPO (2016). J2s hatched by single egg mass were used for DNA extraction and identification of molecular biology. Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), the specific primers of M. enterolobii, was used to validate this pathogen (Long et al., 2006). Consistent with that described before, the target amplification product was about 236 bp, and no product was obtained from the negative control, M. incognita and M. javanica (Chen et al., 2023). Using V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG), the rDNA ITS region was obtained and sequenced (Vrain et al., 1992). The target product was 765 bp (GenBank accession no. PQ205316), which was 100% homologous to those M. enterolobii ITS sequence available in the GenBank (KX823372, KJ146863). Koch's postulates were used to verify the pathogenicity of M. enterolobii on L. cylindrica, twelve 2-week-old L. cylindrica were planted in sterilized soil and inoculated with M. enterolobii J2s at a rate of 3,000 individuals per plant. The plants were grown at 26°C in a greenhouse, with non-inoculated controls set up. After 8 weeks, the roots of the non-inoculated plants (n = 12) showed no root-knot and grew well, while all inoculated plants developed root-knots and exhibited stunted growth. The average reproduction factor of the inoculated plants was 19.5, and the average root-knot rating was 7.2 (on a scale of 0 to 10) (Bridge and Page 1980), confirming the pathogenicity of M. enterolobii on L. cylindrica. We found that this is consistent with the description of M. enterolobii infecting Coriandrum sativum in Shanxi, China (Pan et al., 2024) and the infection of Selenicereus costaricensis in Guangxi, China by M. enterolobii (Wu et al., 2023). To our knowledge, this is the first report of M. enterolobii parasitizing L. cylindrica in Guangxi, China. With the increase of vegetable planting area, root-knot nematodes are becoming more and more serious and have become a limiting factor on vegetable production. This finding is of significant importance for vegetable growers to control M. enterolobii in this region, based on which suitable management measures will be taken.

Biological evaluation of CH3OH and C2H5OH of Berberis vulgaris for in vivo antileishmanial potential against Leishmania tropica in murine models

Abstract Leishmaniasis is one of the global health issues and is still being handled with costly and sometimes unsuccessful compounds having serious side effects, highlighting the importance of seeking new potent antileishmanial compounds. Herbal medicines have been considered as the main source of prevention and treatment for a wide variety of diseases as well as other photogenetic diseases over the last few centuries. The current study was designed to investigate the in vitro and in vivo antileishmanial efficacy of ethanolic and methanolic extracts of Berberis vulgaris root collected from Kurez region of District Orakzai, Khyber Pakhtunkhwa, Pakistan. Stationary growth-phase metacyclic promastigotes form of Leishmania tropica was incubated in vitro in methanolic and ethanolic extracts using amphotericin B as a positive control. The antileishmanial activity of B. vulgaris extracts was measured after the incubation period using methoxynitrosulfophenyl-tetrazolium carboxanilide assay. For the in vivo study, BALB/c mice were infected with metacyclic L. tropica promastigotes, and lesions appeared after 28 days of inoculum. The results of study research showed that B. vulgaris extract had a powerful antileishmanial activity on promastigotes of L. tropica at different concentrations (5, 10, 25, 50, and 75 μg/mL). The inhibition concentration 50 values for ethanolic and methanolic extracts of B. vulgaris were determined to be 15.37 and 17.55 μg/mL, respectively. In the in vivo activity, it was observed that B. vulgaris ethanolic extract at the concentration of 1.5 mg/kg decreased the lesion diameter in BALB/c infected mice. The ethanolic extract topically and orally reduced the lesion size 0.51 ± 0.023 and 0.56 ± 0.008 mm, while methanolic extract both topically and orally decrease the lesion diameter of 0.63 ± 0.008 and 0.68 ± 0.009 mm relatively, in comparison with negative control (1.45 ± 0.016 mm). Hematological parameters of mice including blood red blood cells, hematocrit, and hemoglobin in mice groups (infected non-treated) were found to be decreased, while the mice group treated with extract demonstrated nearly similar results to non-infected group. It is concluded from the current study that antileishmanial activity of B. vulgaris from Pakistan against L. tropica in both in vitro and in vivo showed a promising antileishmanial activity. This study might be helpful in the control strategies of cutaneous leishmaniasis caused by L. tropica.

First Report of Xanthomonas hortorum pv. vitians as the Causal Agent of Bacterial Leaf Spot on Lettuce in China.

Lettuce (Lactuca sativa) is a leafy vegetable that belongs to the family Asteraceae. This cool-season crop grows well during Spring and Fall in China (Qi et al., 2021). In October 2023, a leaf disease with dark brown to black lesions was observed on lettuce (var. iceberg) in Yongning Town, Yanqing District, Beijing, China (40°53'N, 116°16'E). The disease incidence ranged from 10 to 40% in the surveyed greenhouse and field. Translucent and water-soaked brown spots were observed on the margins of leaf, then coalesced into large necrotic lesions surrounded by a chlorotic halo. Infected sections were soaked with 75% ethyl alcohol for 7 second, rinsed with sterile water for 15 second twice, and cut into pieces in the sterile water. The sample extracts were streaked on Nutrient agar medium. After incubation for 48 hours, 12 colonies were obtained and all the colonies were Gram-negative and aerobic with yellow, round-shape, smooth and glistening appearance. Four isolates SCZX1-SCZX4 with typical characteristics were selected for further identification tests. Pathogenicity test of SCZX1-SCZX4 was performed on the three-week-old lettuce (var. butterhead) by spraying with the bacterial suspension (108 CFU·ml-1). Inoculated lettuce were incubated at 26℃ and 70% relative humidity in the growth chamber. Another set of lettuce plants were mock inoculated with sterile distilled water. Three trials were carried out per isolate, and each treatment included fifteen lettuce plants. Symptoms appeared within 7-10 days after inoculation and are identical to those naturally infected lettuces. Negative control plants had no symptoms. The 16S rRNA region and two housekeeping genes (gyrB and atpD) of each isolate were amplified with universal primers F27/R1492 (Monciardini et al., 2006) and specific primers (Roach et al., 2018), respectively. According to BLAST analysis of each isolate (Genbank accession number PP027925, PP140779, PP140781 to PP140783, PP137422 to PP137428), BLAST searches of the obtained sequences revealed 100.0% of 16S rRNA region(1400/1400 nucleotides), 100.0% of gyrB(774/774 nucleotides), and 100.0% of atpD(768/768 nucleotides) identity and query coverage to Xhv CFBP 498 (Genbank accession number LR828257.1). Phylogenetic analysis revealed that SCZX1-SCZX4 clustered with the neopathotype strain Xhv LMG 938PT, which was isolated from a diseased L. sativa in Zimbabwe (Timilsina, S et al., 2015). Physiological and biochemical tests of SCZX1-SCZX4 were conducted by the BIOLOG GENIII microplate system (Biolog, Hayward, CA, USA), and the test results are consistent with the Xhv LMG 938PT (Morinière, L et al., 2020) and L1-L7 (Pernezny, K et al., 1995). Strains were re-isolated from re-inoculated lettuce, then re-identified as Xhv by the same method, fulfilling Koch's postulates. Bacterial leaf spot (BLS) is a worldwide-spread lettuce disease caused by numerous bacterial pathogens, including Xhv (Dia, N.C et al., 2022), Pseudomonas cichorii (Patel, N et al., 2021) and P. viridiflava (Alippi, A. M et al., 1999) etc. Xhv had been widely reported as the causal pathogen of BLS in Turkey (Sahin, F et al., 2000), United States (Bull, C.T et al., 2007), Saudi Arabia (Al-Saleh, M et al., 2008), and France (Morinière et al., 2020). However, the first report of Xhv causing BLS on lettuce in China is significant to provide pathogen information for growers in making effective measures to manage this disease.

A nanofibrous polycaprolactone/collagen neural guidance channel filled with sciatic allogeneic schwann cells and platelet-rich plasma for sciatic nerve repair.

Sciatic nerve damage, a common condition affecting approximately 2.8% of the US population, can lead to significant disability due to impaired nerve signal transmission, resulting in loss of sensation and motor function in the lower extremities. In this study, a neural guidance channel was developed by rolling a nanofibrous scaffold produced via electrospinning. The scaffold's microstructure, biocompatibility, biodegradation rate, porosity, mechanical properties, and hemocompatibility were evaluated. Platelet-rich plasma (PRP) activated with 30,000 allogeneic Schwann cells (SCs) was injected into the lumen of the channels following implantation into a rat model of sciatic nerve injury. Recovery of motor function, sensory function, and muscle re-innervation was assessed using the sciatic function index (SFI), hot plate latency time, and gastrocnemius muscle wet weight loss. Results showed mean hot plate latency times of Autograft: 7.03, PCL/collagen scaffolds loaded with PRP and SCs (PCLCOLPRPSCs): 8.34, polymer-only scaffolds (PCLCOL): 10.66, and untreated animals (Negative Control): 12.00. The mean SFI values at week eight were Autograft: -49.30, PCLCOLPRPSCs: -64.29, PCLCOL: -75.62, and Negative Control: -77.14. The PCLCOLPRPSCs group showed a more negative SFI compared to the Autograft group but performed better than both the PCLCOL and Negative Control groups. These findings suggest that the developed strategy enhanced sensory and functional recovery compared to the negative control and polymer-only scaffold groups.

Therapeutic potential of hyaluronic acid hydrogel combined with bone marrow stem cells-conditioned medium on arthritic rats’ TMJs

Conditioned media (CM) is derived from mesenchymal stem cells (MSC) culture and contains biologically active components. CM is easy to handle and reduces inflammation while repairing injured joints. Combination therapy of the CM with cross-linked hyaluronic acid (HA) could ameliorate the beneficial effect of HA in treating degenerative changes of articulating surfaces associated with arthritic rats’ temporomandibular joints (TMJs). This study aimed to evaluate the therapeutic potential of HA hydrogel combined with bone marrow stem cells-conditioned medium (BMSCs-CM) on the articulating surfaces of TMJs associated with complete Freund’s adjuvant (CFA)-induced arthritis. Fifty female Sprague-Dawley rats were divided randomly into five equal groups. Rats of group I served as the negative controls and received intra-articular (IA) injections of 50 µl saline solution, whereas rats of group II were subjected to twice IA injections of 50 µg CFA in 50 µl; on day 1 of the experiment to induce persistent inflammation and on day 14 to induce arthritis. Rats of group III and IV were handled as group II and instead, they received an IA injection of 50 µl HA hydrogel and 50 µl of BMSCs-CM, respectively. Rats of group V were given combined IA injections of 50 µl HA hydrogel and BMSCs-CM. All rats were euthanized after the 4th week of inducing arthritis. The joints were processed for sectioning and histological staining using hematoxylin and eosin, Masson’s trichrome and toluidine blue special staining, and immunohistochemical staining for nuclear factor-kappa B (NF-κB). SPSS software was used to analyze the data and one-way analysis of variance followed by post-hoc Tukey statistical tests were used to test the statistical significance at 0.05 for alpha and 0.2 for beta. In the pooled BMSC-CM, 197.14 pg/ml of platelet-derived growth factor and 112.22 pg/ml of interleukin-10 were detected. Compared to TMJs of groups III and IV, TMJs of group V showed significant improvements (P = 0.001) in all parameters tested as the disc thickness was decreased (331.79 ± 0.73), the fibrocartilaginous layer was broadened (0.96 ± 0.04), and the amount of the trabecular bone was distinctive (19.35 ± 1.07). The mean values for the collagen amount were increased (12.29 ± 1.38) whereas the mean values for the NF-κB expression were decreased (0.62 ± 0.15). Combination therapy of HA hydrogel and BMSCs-CM is better than using HA hydrogel or BMSCs-CM, separately to repair degenerative changes in rats’ TMJs associated with CFA-induced arthritis.

MiR-301b-3p promotes breast cancer development through inhibiting the expression of transforming growth factor-beta receptor 2.

Breast cancer (BC) is a serious health threat to the patients. The present work explored the mechanism of miR-301b-3p and transforming growth factor-beta receptor 2 (TGFBR2 ) in affecting BC progression. The miR-301b-3p-inhibitor and si-TGFBR2 solution were added to the DEME/F12 medium to culture the BC and normal breast epithelial cell lines to prepare negative control, miR-301b-3p-IN and miR-301b-3p-IN+si-TGFBR2 in the two types of cell lines. The relative expression of target genes and the interference effect were analyzed by quantitative real-time PCR (qRT- PCR). Cell viability was detected applying cell counting kit-8 (CCK-8) assay. Transwell and wound healing assay were conducted to evaluate the invasion and migration of BC cells after miR-301b-3p inhibition. Additionally, cell apoptosis and the expression STAT protein were measured by flow cytometry and Western blot, respectively. The qRT-PCR results showed that miR-301b-3p were high-expressed but the level of TGFBR2 was significantly inhibited in BC cells. The miR-301b-3p-inhibitor significantly downregulated the expression of miR-301b-3p and upregulated that of TGFBR2. Meanwhile, inhibition of miR-301b-3p suppressed the cell viability, invasion, and migration of BC cells, which, however, were restored by the inhibition of TGFBR2. MiR-301b-3p conferred anti-apoptosis ability to BC cells, while TGFBR2 promoted apoptosis of BC cells through producing an antagonistic effect with miR-301b-3p. We found that miR-301b-3p played a crucial role in the phosphorylation of STAT1 and STAT3 to promote BC progression. The present findings demonstrated that miR-301b-3p played a crucial role in promoting BC cell growth, invasion and migration and anti-apoptosis, and that targeting TGFBR2 could inhibit the tumor-promoting effect of miR-301b-3p.