Natural Microbial Consortia Research Articles

Study of the effect of microbial addition in seed germination and seedling growth of Cryptocarya densiflora L

Cryptocarya densiflora L belongs to the Lauraceae family that is famous for its utilization of its leaves, stems, roots, and fruit. These species are also widely spread. The hardness of its seed coats inhibits its germination. Various efforts to accelerate the germination process by immersion in water or chemicals have done. However, the application of microbes has never been reported. Naturally, C. densiflora seeds fall to the ground directly in contact with soil microbes that might play a significant role in the germination process. This research aims to reveal the effect of inoculants’ application originated from soil microbes, Aspergillus niger, and natural microbial consortia in germination and growth of seedling C. densiflora. The experiments employed a completely randomized design using two main treatments, the inoculant formula, and the growing media. Inoculant formula factors consist of Formula 1 (A. niger), Formula 2 (microbial consortia), and Control, while the growing media consists of 3 types, A (soil and sand/1:1), B (soil, sand, and compost/1:1:1), and C (sand). All growing media were treated with 2 different treatments, sterilized (S) and non-sterilized (N). The growth stage was observed for 12 weeks after sowing with the following observed parameters: pH of the media at the end of the experiment, the percentage of sprout growth, plant height, number of leaves, root length, wet and dry weight of roots, and shoots. The results showed that the addition of microbial inoculant significantly affected the germination of C. densiflora seeds in all parameters measured, both for media A and B (sterile and non-sterile). Formula 1 gave the best results on all media, especially sterile media with parameters of plant height, number of leaves, root length, wet and dry weight of roots and shoots. The presence of microbes significantly affected germination and C. densiflora seedling growth.

Cotton Stalk Compost as a Substitution to Farmyard Manure Along with Mineral Fertilizers and Microbials Enhanced Bt Cotton Productivity and Fibre Quality in Rainfed Vertisols

Cotton stalks, remaining after the cotton is harvested, are considered waste material and disposed of by burning. Presently, the supply of good quality manure, such as farmyard manure (FYM) is low. Thus, recycling of cotton stalks as compost can reduce the dependency on FYM apart from reducing inorganic fertilizer use and soil health enhancement. Some studies have reported on the conversion of cotton ginnery wastes into organic manure. However, no studies have reported about the composting of cotton stalks. We conducted field studies over three years on Vertisols to evaluate the impact of integrated use of microbially enriched cotton stalk compost (ECC) as an alternative to FYM along with mineral fertilizers in cotton production. Additionally, we evaluated an option of using native microbial consortia as seed treatment and studied their synergistic effect along with ECC application on cotton yield, fibre quality, and soil properties. Results indicated that the substitution of FYM with ECC in integrated nutrient management (INM) produced effects similar to that of FYM use in enhancing cotton yield, fibre quality and soil properties. Application of ECC + inorganic fertilizers (referred as modified nutrient management practice—MINM) increased boll numbers (8.4%) and boll weight (9.9%) compared to the recommended dose of fertilizers (RDF). Treating cotton seeds with microbial consortia increased seed cotton yield (SCY) by 12.8% (2815 kg ha−1) compared to untreated seed plot (2496 kg ha−1). Averaged over the years, INM (3344 kg ha−1) followed by MINM (3190 kg ha−1) recorded significantly higher SCY than RDF (2835 kg ha−1), which were 18 and 13% more than the RDF, respectively. MINM practice enhanced cotton fibre properties (staple length and bundle strength), soil nutrient status (major, secondary and micronutrients), and biological activities (microbial biomass carbon and soil enzymes), which were on par with INM. The use of ECC in INM is estimated to reduce 33% costs on nitrogenous, phosphatic, and potassic fertilizers, and can save approximately US$ 38 ha−1 on inorganic fertilizers and manures in the recommended dose of fertilizers (RDF) and INM practice.

Mechanisms of Biostimulant-Enhanced Biodegradation of Pahs and Btex Mixed Contaminants in Soil by Native Microbial Consortium

Mechanisms of Biostimulant-Enhanced Biodegradation of Pahs and Btex Mixed Contaminants in Soil by Native Microbial Consortium

The Effect of Commercial Probiotics on the Phytoplankton Diversity Associated with Biofloc

The intensive aquaculture industry faces two main problems, first, the decrease in the water quality caused by high concentrations of metabolites, and second, the use of low natural food in aquaculture activities with high water exchange intensity. For this reason, efforts are needed to develop biofloc to maximize the contribution of natural food which can increase aquaculture production. The present study aimed to analyze the effect of commercial probiotics on the differences in the phytoplankton diversity associated with biofloc. The fish were divided into three treatment groups. Treatment A involved biofloc formation without using probiotics, treatment B contained biofloc formation using commercial probiotics (Bacillus spp., lactic acid, Lactobacillus spp., Saccharomyces spp. 50/50 feed), and treatment C entailed biofloc formation using commercial probiotics (containing a native microbial consortium, 50/50 feed). The treatment groups were repeated six times so that there were 18 experimental units. The research was conducted from March to April 2015. The results indicated that the administration of probiotics with different types led to insignificant differences among the treatment groups. The highest diversity index value occurred in treatment C on day 34 of the experiment that was equal to 0.49. On the other hand, the highest value of the dominance index (C = 0.99) occurred in treatments A and B on day 21. It can be concluded that the addition of probiotics with different biofloc could result in insignificant phytoplankton diversity. Furthermore, the Nitrogen/Phosphorus (N/P) ratio as a limiting factor for phytoplankton growth indicated different results in each treatment.

In Situ Bioremediation of a Chlorinated Hydrocarbon Plume: A Superfund Site Field Pilot Test

The North Railroad Avenue Plume, discovered in 1989, contained chlorinated solvent groundwater plumes extending over 23.5 hectares (58 acres) and three hydrostratigraphic units. The source contaminant, tetrachloroethene, stemmed from release at a dry cleaner/laundromat business. The anaerobic biodegradation byproducts trichloroethene, isomers of dichloroethene (DCE), and vinyl chloride were detected in groundwater samples collected prior to remedial action. The impacted aquifers are the sole source drinking water aquifers for the communities near the site. Following the remedial investigation and feasibility study, the selected alternative for full-scale remedial action at the site was enhanced reductive dichlorination (ERD) focused on four treatment areas: the shallow source zone, the shallow hotspot area, the shallow downgradient area, and the deep zone. Pilot testing, which was conducted in the source zone and hotspot areas, is the subject of this paper. The primary objectives of the pilot test were to obtain the necessary information to select an ERD treatment formulation, dose, and frequency of dosing for use during full-scale remedial action, as well as to refine the site’s hydrogeologic conceptual site model and design parameters. Four (4) test cells, each of which contained well pairs of injection and downgradient extraction wells, were used to test ERD bio-amendment formulations: ethyl lactate, dairy whey, emulsified vegetable oil (EVO), and a combination of EVO and a hydrogen gas infusion. A conservative tracer, bromide, was added to the recirculation flow to record tracer breakthrough, peak, and dissipation at extraction wells. The results of these dipole tracer tests were used to reassess the hydraulic conductivity and hydrodynamic dispersity used in the remedial design. In addition to water quality analyses of contaminants and substrates, groundwater samples were also analyzed for biological analyses before, during, and after the addition of bioamendment. Analyses of phospholipid fatty acids and deoxyribonucleic acid (DNA) extracts from fresh groundwater samples informed decisions on the capacity for complete ERD without DCE stalling and tracked the shifts in the bacterial and archaeal taxonomy and phylogeny stemming from the addition of bioamendments. The pilot test concluded that EVO was the most suitable, considering (1) support of the native microbial consortia for ERD, (2) mechanics and hydraulics of the remediation system, and (3) sustainability/retention of the substrate in the subsurface. Along with EVO, the addition of a nutrient broth derived from brewery waste accelerated and sustained the desired conditions and microbial diversity and population levels. The pilot test results were also used to assess the utilization kinetics of the injected substrates based on total organic carbon (TOC) concentrations measured in the groundwater. After determining that substrate utilization followed Monod kinetics, a TOC threshold at 300 milligrams per liter, equivalent to approximately twice its half-saturation constant was established. Full scale treatment dosing and dose frequency were designed around this threshold, assuming the maximum substrate utilization would yield optimum ERD.

The structural basis for high-affinity uptake of lignin-derived aromatic compounds by proteobacterial TRAP transporters.

The organic polymer lignin is a component of plant cell walls, which like (hemi)-cellulose is highly abundant in nature and relatively resistant to degradation. However, extracellular enzymes released by natural microbial consortia can cleave the β-aryl ether linkages in lignin, releasing monoaromatic phenylpropanoids that can be further catabolised by diverse species of bacteria. Biodegradation of lignin is therefore important in global carbon cycling, and its natural abundance also makes it an attractive biotechnological feedstock for the industrial production of commodity chemicals. Whilst the pathways for degradation of lignin-derived aromatics have been extensively characterised, much less is understood about how they are recognised and taken up from the environment. The purple phototrophic bacterium Rhodopseudomonas palustris can grow on a range of phenylpropanoid monomers and is a model organism for studying their uptake and breakdown. R. palustris encodes a tripartite ATP-independent periplasmic (TRAP) transporter (TarPQM) linked to genes encoding phenylpropanoid-degrading enzymes. The periplasmic solute-binding protein component of this transporter, TarP, has previously been shown to bind aromatic substrates. Here, we determine the high-resolution crystal structure of TarP from R. palustris as well as the structures of homologous proteins from the salt marsh bacterium Sagittula stellata and the halophile Chromohalobacter salexigens, which also grow on lignin-derived aromatics. In combination with tryptophan fluorescence ligand-binding assays, our ligand-bound co-crystal structures reveal the molecular basis for high-affinity recognition of phenylpropanoids by these TRAP transporters, which have potential for improving uptake of these compounds for biotechnological transformations of lignin.

Tratamiento de aguas residuales con aceite de motor empleando un biorreactor de lecho empacado usando un consorcio microbiano nativo inmovilizado

Waste motor oil generates contamination in water due to its inappropriate disposal and is hence considered a hazardous residue. In this study a native microbial consortium was isolated from soil contaminated with waste motor oil. The ability to grow, biosurfactant production, and degradation of different oil concentrations (0.2, 0.5, 1.0, and 2.5 % v v-1) was analyzed. The growth kinetic analysis revealed the value of the maximum specific growth rate was 0.758 d1, while the saturation constant was 0.781 % v v-1 (7.11 mg mL-1) and the inhibition constant, 2.60 % v v-1 (23.77 mg mL-1). Waste motor oil (1.0% v v-1) was used in the biodegradation oil studies using a packed-bed bioreactor and native microbial consortium immobilized over plastic rings. The results obtained showed the biosurfactant production capacity was 398.18 mg L-1 and the efficiency of waste motor oil was 67.76%. The results obtained in the present work represent a significant advantage in bioremediation of oil contaminated water.

Measuring Biofouling Potential in SWRO Plants with a Flow-Cytometry-Based Bacterial Growth Potential Method.

Measuring the bacterial growth potential of seawater reverse osmosis (SWRO) feed water is an issue that is receiving growing attention. This study developed and demonstrated the applicability of the flow-cytometry (FCM)-based bacterial growth potential (BGP) method to assess the biofouling potential in SWRO systems using natural microbial consortium. This method is relatively fast (2–3 days) compared to conventional bioassays. The effect of the potential introduction of nutrients during measurement has been studied thoroughly to achieve the lowest measure value of about 45,000 cells/mL, which is equivalent to about (10 µg-C glucose/L). The BGP method was applied in two full-scale SWRO plants that included (i) dissolved air flotation (DAF) and ultra-filtration (UF); (ii) dual-media filtration (DMF) and cartridge filter (CF), which were compared with the cleaning frequency of the plants. A significant reduction (54%) in BGP was observed through DAF–UF as pre-treatment (with 0.5 mg Fe3+/L), while there was a 40% reduction by DMF–CF (with 0.8 mg Fe3+/L). In terms of the absolute number, the SWRO feed water after DAF–UF supports 1.5 × 106 cells/mL, which is 1.25 times higher than after DMF–CF. This corresponds to the higher cleaning-in-place (CIP) frequency of SWRO with DAF–UF compared to DMF–CF as pre-treatment, indicating that the BGP method has an added value in monitoring the biofouling potential in SWRO systems.

Isolation and identification of a native microbial consortium for the coffee pulp degradation above 2000 masl

Pulp and mucilage constitute the most abundant by-products of the processing of coffee and inadequate handling produces high-rates of pollution. Considering that in nature there is a large number of cellulolytic microorganisms which can intervene in the degradation of coffee pulp, the inclusion of a native microbial cellulolytic consortium was assessed. The sample for insulation consisted of coffee pulp and soil from a humid forest at more than 2,000 m.a.s.l. Nutrient agar was used as a means of insulation for bacteria, and malt agar for fungi, supplemented with 50% soil extract and 1% carboxylmethylcellulose. This achieved the isolation of 118 strains of bacteria and 114 of fungi. Cellulolytic activity was established using the filter paper test, assessing and selecting only those that presented higher glucose production, among them 12 strains of fungi and 11 strains of bacteria. To attain the microbial consortium, randomized blends were performed for both fungi and bacteria, again assessing the production of glucose. The bacterial consortium was made up of Ochrobactrum pseudogrignonense, Paenibacillus lauruscon and Bacillus xiamenensis and the fungal consortium by Fusarium sp., Penicillum sp., Cylindrocarpon sp. The optimal treatment achieved a complete degradation of the pulp in 28 days, that would contribute to the recovery and conservation of the coffee ecosystem. Main interpretation was wet environment at more 2,000 m.a.s.l. is still good for coffee compost but different bacterial and fungi consortium were found supporting other recent work done with one type of consortium. Key words: Carboxymethylcellulose (CMC); Cellulose; Coffee pulp; Degradation; Microbial consortium; Meters above sea level (masl).

Removal of concentrated Cr(III) from real tannery wastewater using abiotic and anaerobic processes with native microbial consortia

Microbial consortia are isolated and enriched in discontinuous reactors under anaerobic conditions using different stoichiometric ratios of acetate (substrate): Cr(III) concentration: reactors A (0.5:1), B (1:1) and C (2:1). The inoculum is stemmed from a tannery effluent with the aim of tolerating and eliminating high concentrations of Cr(III) (2760 mg L−1). The Cr(III) removal process is performed in two stages for each reactor. Stage I is an abiotic process involving the reaction between acetate and Cr(III) forming the complex CrH2OxCH3COOy3-y, which on its turn precipitates as Cr2O3 (s) in the first five days, thus, decreasing the metal concentration by 24, 42 and 61 % for reactors A, B and C respectively. FT-IR analysis, SEM-EDX, biomass and extracellular polymeric substances (EPS) indicate that the native bacteria enriched in the reactors eliminate Cr (III) during the biotic stage via bioadsorption and bioaccumulation mechanisms. Reactor C achieved the lowest Cr(III) concentration around 600 mg L-1 (78 % removal). The occurrence of these mechanisms was due to the nature of the inoculum since the bacteria were well adapted to the presence of high Cr(III) concentrations, whereby they did not require optimal growth conditions unlike a pure strain. The isolated strains were molecularly identified by amplification and sequencing of the 16 s rRNA gene using universal oligos 63 F (5’CAGGCCTAACACATGCAAGTC3′) and 1542R (5′AAGGAGGTGATCCAGCCGCA3′), finding a 99.06 % of similarity to Lactobacillus diolivorans (strain JCM 12183 accession number LC311745.1), and 99.88 % similarity to Lactobacillus brevis (strain C23 accession number MN880215.1). SEM-EDX enables to identify that the consortia are mainly composed of bacilli undergoing pleomorphism, due to the complex formations between functional groups in the cell wall and Cr(III).

Decolourization of textile effluent using native microbial consortium enriched from textile industry effluent

A robust and efficient treatment process is required to address the problem of residual colour and avoid expensive post-treatment steps while dealing with textile effluents. In the present work, a novel microbial consortium enriched from textile effluent was used to optimize the process of decolourization under extreme conditions with minimum inputs. With PreTreatment Range (PTR) effluent as a carbon source and only 0.5 g/L yeast extract as external input, the process enabled 70-73% colour reduction (from 1910-1930 to 516-555 hazen) in dyeing unit wastewater. Unhindered performance at higher temperatures (30 °C-50 °C) and wide pH range (7-12) makes this process highly suitable for the treatment of warm and extremely alkaline textile effluents. No significant difference was observed in the decolourization efficiency for effluents from different batches (Colour: 1647-4307 hazen; pH-11.5-12.0) despite wide variation in nature and concentration of dyes employed. Long term (60 days) continuous mode performance monitoring at hydraulic retention time of 48 h in lab-scale bioreactor showed consistent colour (from 1734-1980 to 545-723 hazen) and chemical oxygen demand (1720-2170 to 669-844 mg/L) removal and consistently neutral pH of the treated water. Present study thus makes a significant contribution by uncovering the ability of native microbial consortium to reliably treat dye laden textile wastewater without any dilution or pre-treatment and with minimum external inputs. The results ensure easy applicability of this indigenously developed process at the industrial scale.

Biosolubilization of Low-Grade Rock Phosphate by Native Microbial Consortia from Phosphate Mines: Effect of Sampling Sources and Culture Media

Two native microbial consortia were isolated from the soil and drainage in the phosphate mines, and their abilities to solubilize low-grade rock phosphate (RP) in two different culture media, namely Pikovskaya (PKV) and National Botanical Research Institute’s phosphate (NBRIP) medium, respectively, were estimated. Results showed that the two microbial consortia could grow steadily in the solution and continuously released soluble phosphate from the RP during 14 d of experiments. This process was accompanied by a drop in pH of the solution. The microbial consortium isolated from the soil achieved the largest release of soluble phosphate and pH reduction in the PKV medium among the four microbial consortia named PS, NS, PD, and ND, respectively. Fourier transform infrared spectroscopy (FTIR) analysis of RP indicated that hydroxyl, alkyl C-H bond, amide, and carboxyl were involved in the RP solubilization, and significant changes of them were observed after the experiments. The four microbial consortia were sampled before and after the experiments for the analysis of their bacterial and fungal community structures by Illumina MiSeq sequencing. Results showed that the relative diversities and abundances of the dominant bacteria and fungi varied with different sampling sources (soil and drainage) and culture media (PKV and NBRIP medium).

Simple approach for the rapid estimation of BOD5 in food processing wastewater.

A simple approach was developed for the rapid and accurate estimation of 5-day biochemical oxygen demand (BOD5) in food processing wastewater. Immobilization of the natural microbial consortium that was collected from an aerobic compartment of a food processing wastewater treatment plant was simply performed by adhesion using a low-cost porous carrier. Pseudomonas aeruginosa, Bacillus cereus, and Streptomyces, whose salt-tolerance and ability to break down organic compounds have been widely reported, were found to be predominant. These microorganisms may cause an enhancement of the bioreactor response in the presence of sodium chloride. Consequently, a modified glucose-glutamic acid (GGA) calibration standard was proposed in which an appropriate amount of NaCl was added; this solution was found to be more effective in terms of accuracy and practicality than both conventional GGA and the synthetic wastewater recipe from the Organisation for Economic Cooperation and Development (OECD). The calibrated self-built packed-bed bioreactor exhibited good precision of 3% or less in predicting BOD5 in influent, which is similar to the performance of the most common commercial biochemical oxygen demand (BOD) bioreactors. There was a statistical agreement between the results obtained from this rapid BOD biosensor and the conventional methods, even when testing treated wastewater samples.

Genomic and physiological insights into the lifestyle of Bifidobacterium species from water kefir.

Water kefir is a fermented beverage employing a natural microbial consortium, which harbours bifidobacteria, namely Bifidobacterium aquikefiri and Bifidobacterium tibiigranuli. However, little information is available on their metabolic properties or role in the consortium. In this study, we combined genomic and physiologic investigations to predict and characterize the properties of these organisms and their possible role in the consortium. When comparing the genomes of these psychrotrophic organisms with that of the three selected mesophilic probiotic Bifidobacterium strains, we could find 143 genes shared by the 3 known isolates of bifidobacteria from water kefir that do not occur in the probiotic strains. These include genes involved in acid and oxygen tolerance. In addition, their genomically predicted carbohydrate usage and transport suggest adaptation to sucrose and other plant-related sugars. Furthermore, they proved prototrophic for all amino acids in vitro, which enables them to cope with the strong amino acid limitation in water kefir.

Yeasts and Bacterial Consortia from Kefir Grains Are Effective Biocontrol Agents of Postharvest Diseases of Fruits.

Fungal pathogens in fruits and vegetables cause significant losses during handling, transportation, and storage. Biological control with microbial antagonists replacing the use of chemical fungicides is a major approach in postharvest disease control, and several products based on single antagonists have been developed but have limitations related to reduced and inconsistent performance under commercial conditions. One possible approach to enhance the biocontrol efficacy is to broaden the spectrum of the antagonistic action by employing compatible microbial consortia. Here, we explore commercial kefir grains, a natural probiotic microbial consortium, by culture-dependent and metagenomic approaches and observed a rich diversity of co-existing yeasts and bacterial population. We report effective inhibition of the postharvest pathogen Penicillium expansum on apple by using the grains in its fresh commercial and milk-activated forms. We observed few candidate bacteria and yeasts from the kefir grains that grew together over successive enrichment cycles, and these mixed fermentation cultures showed enhanced biocontrol activities as compared to the fresh commercial or milk-activated grains. We also report several individual species of bacteria and yeasts with biocontrol activities against Penicillium rots on apple and grapefruit. These species with antagonistic properties could be further exploited to develop a synthetic consortium to achieve enhanced antagonistic effects against a wide range of postharvest pathogens.

Development and performance evaluation of native microbial consortium for multi metal removal in lab scale aerobic and anaerobic bioreactor

Abstract Shortage of freshwater force farmers to use untreated wastewater for irrigation which leads to the accumulation of contaminants like heavy metals in the food chain and deteriorate the quality of produce and soil. Present study focused on bioremediation of multiple heavy metals (Cd, Cu, Cr, Zn. Pb and Ni) from wastewater used for irrigation of food crops using four continuous Stirred Tank Reactor (CSTR), two aerobic and two anaerobic. One set of bioreactor (aerobic and anaerobic) was fed with actual wastewater, showed heavy metal removal up to 30%–100%. Whereas other set fed with spiked with metal ion concentration showed removal up to 70%–100%, indicating the improvement in removal efficiency due to acclimatization of microbial consortia at higher metal concentration. Present study clearly shows the ability of native microbial consortia in removing even higher concentrations of heavy metals from actual wastewater under ambient conditions. The present bioreactors configuration can be scale up for the on-site wastewater treatment with further optimization of the removal process. It was recommended that after using the present treatment process, treated water is safe for irrational purposes.

Microbiological Safety and the Management of Microbial Resources in Artisanal Foods and Beverages: The Need for a Transdisciplinary Assessment to Conciliate Actual Trends and Risks Avoidance.

Current social and environmental trends explain the rising popularity of artisanal fermented foods and beverages. In contrast with their marketing success, several studies underline a lack of regulations necessary to claim differences occurred from the farm to the fork and to certify high quality and safety standards. Microbial-based fermentative processes represent the crucial phase in the production of fermented foods and beverages. Nevertheless, what are the effects of the application of the “artisanal” category to the management of food fermentations? This opinion paper is built up on this issue by analyzing microbial aspects, instances of innovation, safety issues, and possible solutions. Evidence indicates: (i) a global curiosity to exploit food fermentations as drivers of innovation in artisanal contexts and (ii) an increasing interest of the artisanal producers into management of fermentation that relies on native microbial consortia. Unfortunately, this kind of revamp of “artisanal food microbiology,” rather than re-establishing artisanal content, can restore the scarce hygienic conditions that characterized underdeveloped food systems. We highlight that in the scientific literature, it is possible to underline existing approaches that, surpassing the dichotomy between relying on spontaneous fermentation and the use of commercial starter cultures, depict a “third way” to conjugate interest in enhancing the artisanal attributes with the need for correct management of microbial-related risks in the final products.

Microbial community analyses by high-throughput sequencing of rumen microorganisms fermenting office paper in mesophilic and thermophilic lysimeters

This study explored the hydrolysis and fermentation of paper with hydrogen (H2) and volatile fatty acid (VFA) recovery using a natural microbial consortium added to lysimeters. Serial dilutions of rumen fluid in natura were performed to obtain a fermentative nonmethanogen consortium, which was used as inoculum in lysimeters under two different incubation temperatures, L1 at 35°C and L2 at 55°C. H2 was detected in both lysimeters: 791.5mL (L1) and 70.4mL (L2). In L1, the production of 16,856mgL−1 acetic acid was likely due to the occurrence of homoacetogenesis. Under thermophilic conditions, L2, a low volume of H2 was detected, and the highlight was the production of ethanol and methanol at 2289 and 5614mgL−1, respectively. According to the Shannon index, there was great diversity of microorganism populations in the rumen fluid in natura (6.34) compared with the purified rumen fluid (2.73), L1 (2.67) and L2 (3.21). The most abundant genus in the rumen fluid in natura was Prevotella (37.5 %); in the purified consortium (68.7 %) and L1 (63.8), Dysgonomonas; and in L2 (88.7 %), Thermicanus. In conclusion, the temperature influenced the microbial community structure, the metabolic route and, consequently, the main byproducts produced by the fermentative activity at 35°C and 55°C.

Bioremediation of Hexanoic Acid and Phenanthrene in Oil Sands Tailings by the Microbial Consortium BioTiger™.

Polycyclic aromatic hydrocarbons (PAHs) and naphthenic acids (NAs) are toxic contaminants of environmental concern found in process water and mature fine tailings, or tailings, from the oil sands industry. BioTiger™, a patented microbial consortium of twelve natural environmental isolates, was found to cometabolically biodegrade the NA hexanoic acid and the PAH phenanthrene in the presence of tailings. Hexanoamide was found to be produced and consumed during cometabolism of hexanoic acid. Mechanistic analysis demonstrated three of the BioTiger™ strains generated biosurfactants with the bacterial adhesion to hydrocarbons assay, seven with the methylene blue active substances assay, and nine with a hemolysis assay. Serial transfers of the BioTiger™ consortium demonstrated the stability of hexanoic acid degradation over several generations. The results demonstrate that BioTiger™ cometabolically biodegrades combinations of phenanthrene and hexanoic acid in tailings. This work reveals the potential for in situ bioremediation of tailings with this natural microbial consortium.

Self-build packed-bed bioreactor for rapid and effective BOD estimation.

This work demonstrated a simple, low-cost, rapid, and effective biochemical oxygen demand (BOD) estimation system based on a packed-bed bioreactor that can be easily self-built on-site at a particular wastewater treatment plant for continuous monitoring of the influent and effluent. The use of natural microbial consortium that were collected from the target wastewater and immobilized on a cheap porous carrier simply by adhesion resulted in an acceptable accuracy of over 95%. The newly developed semi-continuous operating mode with peak-type signals was shown to be able to continuously estimate BOD at a high flow rate to overcome the flow dependence of the oxygen electrode, limit clogging issues, enhance the response time, and lower the limit of detection. The resulting packed-bed bioreactors could work continuously for 22h with a coefficient of variance (CoV) of only 1.8% or for 13h a day for several days with a maximum CoV of 1.4% and their response was observed to be stable over 80 consecutive measurements. They exhibited stable responses at a wide pH range of 6.5-8.5, which is also the recommended range for aerobic wastewater treatment, emphasizing the greater ease of use of natural microorganisms for BOD estimation.