Gene NADH Dehydrogenase Subunit Research Articles

Evidence for hybridization-driven heteroplasmy maintained across generations in a ricefish endemic to a Wallacean ancient lake.

Heteroplasmy, the presence of multiple mitochondrial DNA (mtDNA) haplotypes within cells of an individual, is caused by mutation or paternal leakage. However, heteroplasmy is usually resolved to homoplasmy within a few generations because of germ-line bottlenecks; therefore, instances of heteroplasmy are limited in nature. Here, we report heteroplasmy in the ricefish species Oryzias matanensis, endemic to Lake Matano, an ancient lake in Sulawesi Island, in which one individual was known to have many heterozygous sites in the mitochondrial NADH dehydrogenase subunit 2 (ND2) gene. In this study, we cloned the ND2 gene for some additional individuals with heterozygous sites and demonstrated that they are truly heteroplasmic. Phylogenetic analysis revealed that the extra haplotype within the heteroplasmic O. matanensis individuals clustered with haplotypes of O. marmoratus, a congeneric species inhabiting adjacent lakes. This indicated that the heteroplasmy originated from paternal leakage due to interspecific hybridization. The extra haplotype was unique and contained two non-synonymous substitutions. These findings demonstrate that this hybridization-driven heteroplasmy was maintained across generations for a long time to the extent that the extra mitochondria evolved within the new host.

Genotyping of Echinococcus granulosus Human Isolates Obtained from the Puncture, Aspiration, Injection, and Re-Aspiration (PAIR) Process in Türkiye.

Echinococcus granulosus is spread by the excretion of cystic organs into the environment. The dog is infected via eating the cystic organ. It then contaminates the environment with eggs of E. granulosus, which are infective to humans and animals. We aimed to determine the E. granulosus genotypes that cause infection in humans in the Van region, Türkiye. Sixty patients between 18 and 100 years of age, who underwent the puncture, aspiration, injection, re-aspiration (PAIR) procedure in the Department of Radiodiognastics of Van Yüzüncü Yıl University, Van, Türkiye were included in the study. PAIR fluids were examined microscopically and DNA was isolated from the fluids. After DNA isolation, polymerase chain reaction (PCR) was performed using primers that amplify the E. granulosus NADH dehydrogenase subunit 1 (NAD1) gene region. After sequence analysis of the PCR amplicons, Basic Local Alignment Search Tool (BLAST) was performed. In the microscopic examination, protoscolex or hook was detected in 42 (70%) of the samples. DNA was successfully extracted from all of the cyst fluids containing protoscolex and hook, and the NAD1 gene region was PCR-amplified. After using BLAST, all of the samples were determined to be an E. granulosus sensu stricto G1 genotype. Sequence comparison revealed that four (9.5%) isolate sequences showed single nucleotide polymorphism (SNP). Sequences of isolates with SNP submitted to the GenBank with accession numbers OR565864 to OR565867. E. granulosus s.s. G1 genotype, known as sheep strain, is common in human hydatid disease in the Van region of Türkiye.

A new species of Cyrtodactylus Gray, 1827 (Squamata: Gekkonidae) from the Thai-Malay Peninsula and the independent evolution of cave ecomorphology on opposite sides of the Gulf of Thailand.

An integrative taxonomic analysis recovers a distinctive new species of the gekkonid genus Cyrtodactylus Gray, 1827 from Satun Province in extreme southern Thailand as the sister species to the Cyrtodactylus intermedius group of southern Indochina, approximately 600 km to the northeast across the Gulf of Thailand. Based on 1449 base pairs of the mitochondrial gene NADH dehydrogenase subunit 2 (ND2) and its flanking tRNAs, the new species, C. disjunctus sp. nov., bears a pairwise sequence divergence from the mean divergences of the intermedius group species ranging from 17.923.6%. Three different principal component analyses (PCA) and a multiple factor analysis (MFA) recover C. disjunctus sp. nov. as a highly distinctive karst cave-adapted species based on morphology and color pattern. Its sister species relationship to the intermedius groupto which it is added herefurther underscores a growing body of analyses that have recovered a trans-Gulf of Thailand connection across the submerged Sunda Shelf between the southern Thai-Malay Peninsula and southern Indochina. Fragmented karstic archipelagos stretching across Indochina have served as foci for the independent evolution of nearly 25% of the species of Cyrtodactylus. The description of C. disjunctus sp. nov. continues to highlight the fact that karstic habitats support an ever-increasing number of threatened site-specific endemics that compose much of the reptile diversity of many Asian nations but, as of yet, most of these landscapes have no legal protection.

Improving correlation of wastewater SARS-CoV-2 gene copy numbers with COVID-19 public health cases using readily available biomarkers.

The COVID-19 pandemic has highlighted the potential role that wastewater-based epidemiology can play in assessing aggregate community health. However, efforts to translate SARS-CoV-2 gene copy numbers obtained from wastewater samples into meaningful community health indicators are nascent. In this study, SARS-CoV-2 nucleocapsid (N) genes (N1 and N2) were quantified weekly using reverse transcriptase droplet digital PCR from two municipal wastewater treatment plants for seven months. Four biomarkers (ammonium, biological oxygen demand (BOD), creatinine, and human mitochondrial gene NADH dehydrogenase subunit 5) were quantified and used to normalize SARS-CoV-2 gene copy numbers. These were correlated to daily new case data and one-, two-, and three-week cumulative case data. Over the course of the study, the strongest correlations were observed with a one-day case data lag. However, early measurements were strongly correlated with a five-day case data lag. This indicates that in the early stages of the pandemic, the wastewater samples may have indicated active COVID-19 cases before clinical indications. Mitochondrial and creatinine normalization methods showed the strongest correlations throughout the study, indicating that human-specific biomarkers were better at normalizing wastewater data than ammonium or BOD. Granger causality tests supported this observation and showed that gene copies in wastewater could be predictive of new cases in a sewershed.

First Report of Late Blight Caused by Phytophthora infestans in Potato in Tibet, China.

Late blight caused by Phytophthora infestans (Mont.) De Bary is the most destructive diseases in the potato field. Although it has been studied worldwide, it has not been reported in Tibet Autonomous Region of China, lying on the world's highest plateau. To investigate whether the disease caused by P. infestans occurred in such region, a survey on potato disease was conducted in the summer in 2020. In August, potato (Solanum tuberosum) of the cultivar 'Longshu 10' with diseased leaves was observed in a potato field in Shigatse city in Tibet Autonomous Region (29.3N,88.8E). The necrotic brown lesions were shaped in round or irregularly with whitish growth of sporangium-producing structures on the underleaf surface, similar to typical late blight symptom. Affected leaves were collected for pathogen isolation. The abaxial side of the decayed leaves showed grey zones of sporulation. Upon isolation, three isolates were used for further investigation. The mycelium grew averagely at a linear rate of 4.35 mm per day at 19oC on Rye B agar (RBA, containing 50 g/L rye and 12 g/L agar), forming white colony. The opaque and lemon-shaped spores with a papilla at the distal end (Figure S1) had an average size of 36.2ⅹ20.3 µm, the shape and size consistent with P. infestans (Cardenas et al. 2011; Winton et al. 2007). The ribosomal ITS1-5.8S-ITS2 region was amplified from genomic DNA obtained from mycelium using primers ITS1 and ITS4 (Glass and Donaldson 1995). The sequences with 829 bp in size obtained from three isolates were identical, among which one of the sequences from Tibet isolate RKZ_27 was submitted to GenBank with Accession No. of MW559423. A BLAST search in NCBI (National Center for Biothchnology Information) revealed MW559423 had the highest similarity (100%) to P. infestans sequences (GenBank Accession No. of MK507866, MH401206 and KU992300). In addition, a partial nucleus DNA sequence from elongation factor 1-α (EF1-α) was amplified using primer set of EF_F/ EF_R (EF_F: 5'GGCCTTGACGACATCCAGAA3'; EF_R: 5'TAGCAGCTCAACCCGAAGTG3'), and a partial mitochondria DNA sequence (P2 region) including partial ATP synthase F1 subunit α gene (atp1), tRNA-Glu gene and partial NADH dehydrogenase subunit 4 (ND4) was amplified using primer set of P2F/P2R (P2F: 5'TTCCCTTTGTCCTCTACCGAT3'; P2R: 5'TTACGGCGGTTTAGCACATACA3') (Vargas et al. 2009). The EF1-α and P2 region for three isolates were all identical and one of each sequence was submitted to GenBank with Accession No. of MZ189257 and MZ399710, respectively, which had 99.78% (XM_002998924.1) and 100% (MG869098) similarity with P. infestans, respectively. Phylogenetic analyses showed that the RKZ_27 was close to P. infestans (Figure S2). Pathogenicity was confirmed by inoculating ten potato leaves cv. 'Favorita' for each isolate with a 5 mm in diameter mycelium plug on each leaf. After 3 days of incubation at 19 oC in air-tight plastic bags, the inoculated leaves developed typical symptoms of late blight. All control leaves treated with distilled water remained healthy. The pathogenicity of three isolates were also confirmed by inoculating potato seedlings cv. 'Favorita' with sporangia suspension. The pathogen re-isolation on inoculated symptomatic leaves and seedlings were confirmed to be P. infestans by the morphological characteristics, which was fulfilled Koch postulates. The pathogenicity test both on leaves and seedlings were conducted twice. To our knowledge, this is the first report of P. infestans in potato field in Tibet Autonomous Region of China. The finding of potato late blight in this region have important epidemiological implications for the growers especially under favorable environmental conditions.

A new cryptic arboreal species of the Cyrtodactylus brevipalmatus group (Squamata: Gekkonidae) from the uplands of western Thailand

The first integrative taxonomic analysis of the Cyrtodactylus brevipalmatus group of Southeast Asia recovered two newly discovered populations from the Tenasserim Mountains in Suan Phueng District, Ratchaburi Province, Thailand as a new species described here as C. rukhadeva sp. nov. Based on 1397 base pairs of the mitochondrial gene NADH dehydrogenase subunit 2 (ND2), C. rukhadeva sp. nov. is the well-supported sister species to a clade containing three undescribed species, C. ngati, and C. cf. interdigitalis with a large uncorrected pairwise sequence divergence from other species in the brevipalmatus group ranging from 15.4–22.1%. Cyrtodactylus elok and C. brevipalmatus are recovered as poorly supported sister species and the well-supported sister lineage to the remainder of the brevipalmatus group. Cyrtodactylus rukhadeva sp. nov. is putatively diagnosable on the basis of a number of meristic characters and easily separated from the remaining species of the brevipalmatus group by a number of discrete morphological characters as well as its statistically significant wide separation in multivariate morphospace. The discovery of C. rukhadeva sp. nov. continues to underscore the unrealized herpetological diversity in the upland forests of the Tenasserim Mountains and that additional field work will undoubtedly result in the discovery of additional new species.

Molecular phylogenetics, PCA, and MFA recover a new species of Cyrtodactylus (Squamata: Gekkonidae) from an isolated sandstone massif in northwestern Cambodia.

The integrated results of maximum likelihood (ML) and Bayesian inference (BI) analyses, principal component analyses (PCA), and a multiple factor analysis (MFA) recover a new, widely allopatric species of the Cyrtodactylus intermedius species group. Cyrtodactylus kulenensis sp. nov is endemic to the Phnom Kulen sandstone massif of the Phnom Kulen National Park, Siem Reap Province, in the lowlands of northwestern Cambodia. A phylogenetic analysis from a short read (275 base pairs) of the mitochondrial gene NADH dehydrogenase subunit 2 (ND2) from C. kulenensis sp. nov. was aligned with 1449 base pairs from all other species in the intermedius group. The analysis recovered C. kulenensis sp. nov. as the sister species to a lineage composed of populations from the widely separated hilly regions of Sa Keao and Sakaerat in eastern Thailand. Multivariate (PCA, DAPC, and MFA) and univariate analyses (ANOVA) using combinations of meristic (scale counts), mensural (morphometric), and categorical (color pattern and morphology) characters from 52 specimens encompassing all species of the intermedius group clearly demonstrate C. kulenensis sp. nov. is significantly different and discretely diagnosable from all other species in the intermedius group. This new discovery further highlights the herpetological diversity and high levels of range-restricted endemism in basin-habitat-island landscapes throughout Indochina and the continued need for field work in the landscapes that remain unsurveyed.

Genetic Identification of Edible Bird's Nest in Thailand Based on ARMS-PCR.

Edible bird’s nest (EBN) is a popular delicacy in the Asian Pacific region originating from Indonesia, Malaysia, Thailand and Vietnam, which consist of various potential medicine value in Traditional Chinese Medicine (TCM). Thailand is one of the main exporters of EBN. However, the genetic information of EBN, a key part of molecular biology, has yet to be reported in Thailand. It is necessary to explore the genetic information of EBN in Thailand based on a quick and simple method to help protect the rights and interests of consumers. This research aimed to systematically evaluate different methods of extracting EBN DNA to improve the efficiency of the analysis of cytochrome b (Cytb) and NADH dehydrogenase subunit 2 (ND2) gene sequences, the establishment of phylogenetic trees, and the genetic information of EBN in Thailand. Additionally, we aimed to develop a quick and simple method for identifying EBN from different species based on the genetic information and amplification-refractory mutation system PCR (ARMS-PCR). By comparing the four methods [cetyltrimethylammonium bromide (CTAB), sodium dodecyl sulfate (SDS), kit and guanidinium isothiocyanate methods] for EBN extraction, we found that the guanidinium isothiocyanate method was the optimal extraction method. Phylogenetic trees generated on the basis of Cytb and ND2 gene analyses showed that 26 samples of house EBN and 4 samples of cave EBN came from Aerodramus fuciphagus and Aerodramus maximus, respectively. In addition, to distinguish different samples from different species of Apodiformes, we designed 4 polymerase chain reaction (PCR) amplification primers based on the ND2 gene sequences of A. fuciphagus and A. maximus. The ARMS-PCR results showed band lengths for A. fuciphagus EBN of 533, 402, and 201 bp, while those for A. maximus EBN were 463, 317, and 201 bp. Collectively, the results showed that ARMS-PCR is a fast and simple method for the genetic identification of EBN based on designing specific original identification primers.

First Report of the Root-Knot Nematode, Meloidogyne floridensis, on Tomato in Georgia, USA.

Meloidogyne floridensis, also known as the peach root-knot nematode (RKN), is a new emerging species found to break crop host-resistance to M. incognita (Stanley et al. 2009). It was first described from Florida (Handoo et al. 2004) parasitizing M. incognita-resistant rootstock cultivars of peach (Prunus persica), and tomato (Solanum lycopersicum) (Church 2005). The nematode has recently been reported in California's almond orchards (Westphal et al. 2019) and peach rootstock (cv. Guardian) in South Carolina (Reighard et al. 2019). In a 2018 survey of vegetable fields sampled randomly in South Georgia, RKN was found with a high density (5,264 second-stage juveniles (J2)/100 cm3 of soil) from a tomato field in Ware County, GA. The soil sample consist of 30 soil cores sampled at 20-cm depth across the field in a zig-zag motion. To perform Koch's postulate, 2,000 eggs from a single egg-mass culture were inoculated into deepots filled with mixture of sand and sterilized field soil (1:1 v/v) and grown with tomato cv. Rutgers for 60 days in the greenhouse. A reproduction factor of 21.1 ± 6.1 was obtained confirming the nematode parasitism on tomato (Fig. 1S). For molecular identification, DNA was extracted by smashing three individual females isolated from the galled roots in 50 µl sterile distilled water, followed by a freeze-thaw (95°C, 1 min). Results of PCR analyzes by species-specific primers (Fjav/Rjav, Finc/Rinc and Far/Rar) did not detect the nematode species (Zijlstra et al. 2000). PCR products were obtained and sequenced from two primer sets consisting of the forward NAD5F2 (5'-TATTTTTTGTTTGAGATATATTAG-3') and the reverse NAD5R1 (5'-CGTGAATCTTGATTTTCCATTTTT-3') for amplification of a fragment of the NADH dehydrogenase subunit 5 (NADH5) gene (Janssen et al. 2016), and the forward TRANH (5'-TGAATTTTTTATTGTGATTAA-3') and the reverse MRH106 (5'-AATTTCTAAAGACTTTTCTTAGT-3') for amplification covering a portion of the cytochrome c oxidase subunit II (COII) and large subunit 16SrDNA (16S) gene (Stanton et al. 1997). DNA sequence of NADH5 gene fragment (accession no. MT795954) was 100% identical (532/532 bp) with a M. floridensis isolate from California and South Carolina (accession no. MH729181 and MN072363), while fragment of the COII and 16S genes (accession no. MT787563) was 99.76% identical (421/422 bp) with an isolate from Florida (accession no. DQ228697). The nematode females were also used for morphometric and perennial pattern analysis. Several micrographs with the inverted microscope (ZEISS Axio Vert.A1, Germany) and camera (ZEISS Axiocam 305 color, Germany) were taken from ten J2s for mean, standard deviation and range of body length: 362.7 ± 11.2 (340.4-379) µm, maximum body width: 15 ± 1.3 (12.4-16.4) µm, stylet length: 12.3 ± 1.3 (9.5-14) µm, hyaline tail terminus: 8.9 ± 1.1 (7.5-10.9) µm and tail length: 35.7 ± 4.4 (28.5-39.5) µm. Morphological measurements and configuration of perineal patterns (Fig. 2S) were comparable to previous reports of M. floridensis isolates from Florida (Handoo et al. 2004; Stanley et al. 2009). To the best of our knowledge, this is the first report of M. floridensis in Georgia as the fourth state in the USA after South Carolina, California and Florida. This nematode has been reported to parasitize several vegetable crops, including cucumber, eggplant, tomato, snap bean and squash. Furthermore, RKN resistant cultivars of tomato (harboring Mi-1 gene), pepper (harboring N gene), corn cv. Mp-710 and tobacco cv. NC 95 have been found susceptible to M. floridensis (Stanley et al. 2009), making it a serious threat.

Mitochondrial A10398G Alteration in Plasma Exosome of Non-small Cell Lung Cancer Patients

This study identifies A10398G alteration of mitochondrial ND3 gene in plasma exosome of 29 non-small cell lung cancer (NSCLC) patients, 31 controls and 13 pairs of tumor tissue and adjacent tissue of NSCLC patients, thereby assessing the relationship between this alteration in plasma exosome and tissue as well as the pathological characteristics of NSCLC patients. Using the PCR-RFLP method, the homoplasmy and heteroplasmy of A10398G were initially identified in mitochondrial DNA from both exosomes and lung tissues. The rate of variant 10398G in plasma exosome was 62.1% in the NSCLC group and 61.3% in the control group. However, there was no statistically significant difference in A10398G between the patient and control groups. The alteration of A10398G in plasma exosome and in tissue correlated with each other (correlation coefficient 0.69; p = 0.009). However, this alteration was not related to age, gender, smoking, alcohol drinks status, tumor size, histological stage and TNM stage.
 Keywords
 A10398G alteration, mitochondrial DNA, plasma exosome, non-small cell lung cancer.
 References
 [1] Y. Zhang, Y. Liu, H. Liu, W.H. Tang, Exosomes: biogenesis, biologic function and clinical potential, Cell Biosci, 9 (2019) 19. https://doi.org/10.1186/s13578-019-0282-2.[2] H. Valadi, K. Ekström, A. Bossios, M. Sjöstrand, J.J. Lee, J.O. Lötvall, Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells, Nat Cell Biol, 9(6) (2007) 654–659. https://doi.org/10.1038/ncb1596.[3] A. Sharma & A. Johnson, Exosome DNA: Critical regulator of tumor immunity and a diagnostic biomarker, J Cell Physiol, 235(3) (2020) 1921–1932. https://doi.org/10.1002/jcp.29153.[4] Global Cancer Observatory, Cancer Today. https://gco.iarc.fr/today/online-analysis-pie. (accessed 05 November 2020).[5] A.A.M. Yusoff, F.N. Zulfakhar, S.Z.N.M. Khair, W.S.W. Abdullah, J.M. Abdullah, Z. Idris, Mitochondrial 10398A>G NADH-Dehydrogenase subunit 3 of complex I is frequently altered in intra-axial brain tumors in Malaysia, Brain Tumor Res Treat 6(1) (2018) 31–38. https://doi.org/10.14791/btrt.2018.6.e5.[6] P.T. Bich, N.N. Tu, N.T. Khuyen, Đ.M. Ha, T.V. To, T.H. Thai, The A10398G Alteration of Mitochondrial ND3 gene in Colorectal Cancer Patients, VNU Journal of Science: Medical and Pharmaceutical Sciences 34(2) (2018) 68. https://doi.org/10.25073/25881132/vnumps.4125. (in Vietnamese).[7] N.T.T. Linh, N.B. Hieu, Đ.M. Ha, T.V. To, T.H. Thai, Mitochondrial DNA A10398G Alteration in Breast Cancer Patients in Vietnam, VNU Journal of Science: Natural Sciences and Technology 31(2) (2015) 36. (in Vietnamese).[8] R.K. Bai, S.M. Leal, D. Covarrubias, A. Liu and L.J.C. Wong, Mitochondrial genetic background modifies breast cancer risk, Cancer Res 67(10) (2017) 4687-4694. https://doi.org/10.1158/0008-5472.CAN-06-3554.[9] J.A. Canter, A.R. Kallianpur, F.F. Parl, R.C. Millikan, Mitochondrial DNA G10398A polymorphism and invasive breast cancer in African-American women, Cancer Res 65(17) (2005) 8028-8033. https://doi.org/10.1158/0008-5472.can-05-1428.[10] K. Darvishi, S. Sharma, A.K. Bhat, E. Rai, R.N.K. Bamezai, Mitochondrial DNA G10398A polymorphism imparts maternal Haplogroup N a risk for breast and esophageal cancer, Cancer Letts 249(2) (2017) 249-255. https://doi.org/10.1016/j.canlet.2006.09.005.[11] S.H.H. Juo, M.Y. Lu, R.K. Bai, Y.C. Liao, R.B. Trieu, M.L. Yu, L.J.C Wong, A common mitochondrial polymorphism 10398A>G is associated metabolic syndrome in a Chinese population, Mitochondrion 10(3) (2010) 294-299. https://doi.org/10.1016/j.mito.2010.01.001.[12] H. Xu, W. He, H.G. Jiang, H. Zhao, X.H. Peng, Y.H. Wei, J.N. Wei, C.H. Xie, C. Liang, Y.H. Zhong, G. Zhang, D. Deng, Y.F. Zhou, F.X. Zhou, Prognostic value of mitochondrial DNA content and G10398A polymorphism in non-small cell lung cancer, Oncol Rep 30(6) (2013) 3006-3012. https://doi.org/10.3892/or.2013.2783.[13] Y. Qi, Y. Wei, Q. Wang, H. Xu, Y. Wang, A. Yao, H. Yang, Y. Gao, F. Zhou, Heteroplasmy of mutant mitochondrial DNA A10398G and analysis of its prognostic value in non-small cell lung cancer, Oncol Lett 12(5) (2016) 3081-3088. https://doi.org/10.3892/ol.2016.5086.[14] A.M. Czarnecka, T. Krawczyk, M. Zdrozny, J. Lubiński, R.S. Arnold, W. Kukwa, A. Scińska, P. Golik, E. Bartnik, J.A. Petros, Mitochondrial NADH-dehydrogenase subunit 3 (ND3) polymorphism (A10398G) and sporadic breast cancer in Poland, Breast Cancer Res Treat 121(2) (2010) 511-518. https://doi.org/10.1007/s10549-009-0358-5.[15] M. Guescini, S. Genedani, V. Stocchi & L. F.Agnati, Astrocytes and Glioblastoma cells release exosomes carrying mtDNA, J Neural Transm (Vienna), 117(1) (2010) 1–4. https://doi.org/10.1007/s00702-009-0288-8.[16] P. Sansone, C. Savini, I. Kurelac, Q. Chang, L.B. Amato, A. Strillacci, A. Stepanova, L. Iommarini, C. Mastroleo, L. Daly, A. Galkin, B.K. Thakur, N. Soplop, K. Uryu, A. Hoshino, L. Norton, M. Bonafé, M. Cricca, G. Gasparre, D. Lyden, and J. Bromberg, Packaging and transfer of mitochondrial DNA via exosomes regulate escape from dormancy in hormonal therapy-resistant breast cancer, PNAS, 114(43) (2017) E9066-9075. https://doi.org/10.1073/pnas.1704862114.
 

A new species of Cyrtodactylus Gray (Squamata; Gekkonidae) from the ThaiHighlands with a discussion on the evolution of habitat preference.

A new gekkonid lizard, Cyrtodactylus maelanoi sp. nov., from Mae Hong Son Province of the Thai Highlands is described using an integrative taxonomic analysis based on morphology, color pattern, and the mitochondrial gene NADH dehydrogenase subunit 2 (ND2) and its flanking tRNAs. Phylogenetic analyses place the new species within clade 1 of the C. sinyineensis group and as the sister species to C. inthanon with an uncorrected pairwise sequence divergence of 3.9%. Collection data gathered in the field indicate that C. maelanoi sp. nov. is a habitat generalist. Reconstruction of the ancestral habitat preference for the C. sinyineensis group by way of stochasitc character mapping (SCM) indicates that karstic environments were the ancestral condition out of which the general habitat preference of the ancestor of C. maelanoi sp. nov. and C. inthanon and that of C. amphipetreaus and C. doisuthep evolved three times independently. Additionally, SCM demonstrated that the evolution of a granitic habitat preference from a karst-adapted ancestor happened in C. aequalis. The discovery of a new upland species in the Thai Highlands brings into focus the understudied nature of the mountain systems of western Thailand and the need for their continued exploration and conservation.

A new species Cyrtodactytlus Gray (Squamata: Gekkonidae) from western Thailand and the phylogenetic placement of C. inthanon and C. doisuthep

A new species of Cyrtodactylus from Tak Province, Thailand, Cyrtodactylus amphipetraeus sp. nov., is described using an integrative taxonomic analysis based on morphology, color pattern, and the mitochondrial gene NADH dehydrogenase subunit 2 (ND2). The phylogenetic analyses place the new species within the C. sinyineensis group which was previously thought to be endemic to the Salween Basin in southern Myanmar. The phylogeny also places C. inthanon in the C. sinyneensis group which is expanded herein to also include the group's sister species C. doisuthep. Along with C. amphipetraeus sp. nov., these are the first three species of the C. sinyineensis group to be found outside of Myanmar east of the Tenasserim Mountains. The Tenasserim Mountain region is discussed as an area of cladogeneic turnover.

The phylogeny of Hemiphyllodactylus Bleeker, 1860 (Squamata: Gekkonidae) with a description of a new species from the Mangin Range, Sagaing Region, northern Myanmar

ABSTRACT Phylogenetic analyses of the 49 nominal species of the gekkonid genus Hemiphyllodactylus based on the mitochondrial gene NADH dehydrogenase subunit 2 and its flanking tRNAs resulted in a strongly supported tree composed of a number of regionally localised monophyletic lineages consistent with previous genus-wide analyses. One such lineage from Western Indochina is composed of three previously recognised clades plus an additional species from southern Thailand. An integrative taxonomic analysis of one of these clades (clade 3 from Western Yunnan, China) recovered a new species from the Mangin Mountain Range that represents the third independent origin of Hemiphyllodactylus in Myanmar (not counting the widespread parthenogenetic H. typus). Hemiphyllodactylus zalonicus sp. nov. from Mt. Zalon, Sagaing Region, is the first species of Hemiphyllodactyus known from the northern part of Ayeyarwady Basin and bears a 15.0–18.9% uncorrected sequence divergence from other clade members as well as having discretely non-overlapping meristic and mensural differences. This discovery brings the total number of Hemiphyllodactylus in Myanmar to at least 11 species.

Patterns of mitochondrial and microsatellite DNA markers describe historical and contemporary dynamics of the Humboldt squid Dosidicus gigas in the Eastern Pacific Ocean

Dosidicus gigas is an economically important species distributed in the Eastern Pacific Ocean. Unraveling the genetic population structure of this species is crucial to ensure its fishery sustainability and management. Mitochondrial DNA sequences and nuclear neutral loci are useful to understand how historical and contemporary factors drive the genetic population structure of species. However, most studies investigating genetic structuring of D. gigas from its northern and southern populations rely on patterns identified using mitochondrial genes. The use of both types of DNA markers is especially relevant for marine species with high dispersal capabilities such as D. gigas. Here, we describe the genetic structure of D. gigas using partial sequences of the mitochondrial gene NADH dehydrogenase subunit 2 and nuclear microsatellite loci in populations of the northern hemisphere from the Costa Rica Thermal Dome and off Ecuador; and, of the southern hemisphere from the South Equatorial Current and off Peru. Statistical parsimony network and Bayesian analyses from mitochondrial sequences revealed three historical maternal lineages in both hemispheres, with high levels of genetic differentiation and signatures of population expansion during the late Pleistocene. Use of Discriminant Analysis of Principal Component (DAPC) with microsatellite loci of mature and immature individuals showed the presence of at least two contemporary genetic stocks homogeneously co-distributed in both northern and southern hemispheres, which can be explained by the biological characteristics of D. gigas and the variable oceanographic conditions of the Eastern Pacific Ocean. Overall, our findings indicate that cooperation between countries with intensive fishing will benefit the sustainability of D. gigas.

A New Species of <i>Diploderma</i> (Squamata: Sauria: Agamidae) from Yunnan Province, China

We describe a new Diploderma species from Southern Yunnan Province, China. It is morphologically similar to D. chapaense, D. hamptoni, and D. yunnanense, but can be distinguished from these three species and all other congeners by its unique morphometric and meristic characters, color patterns and localized distribution range. Moreover, phylogenetic analyses of mitochondrial gene NADH dehydrogenase subunit 2 sequence data also supports this point of view; the new species differs genetically from investigated congeners by percentage distance of 8.78 to 21.15%.

Two new species of Cyrtodactylus Gray, 1827 (Squamata: Gekkonidae) from a karstic archipelago in the Salween Basin of southern Myanmar (Burma).

An integrative taxonomic analysis of the 10 species of the Cyrtodactylus sinyineensis group based on squamation, color pattern, and the mitochondrial gene NADH dehydrogenase subunit 2 (ND2) and its flanking tRNA regions, recovered the newly discovered populations from Datt Kyaik and Taung Wine Hills in Kayin State as the new species Cyrtodactylus dattkyaikensis sp. nov. and C. taungwineensis sp. nov. The Maximum Likelihood and Bayesian phylogenetic estimates supported C. dattkyaikensis sp. nov. as the sister species of C. bayinnyiensis and C. taungwineensis sp. nov. as the sister species of C. sinyineensis. Each new species is differentially diagnosable from all other C. sinyineensis group species based on their morphological placement in multivariate space and several statistically significant mean differences is meristic squamation and color pattern data. The C. sinyineensis group ranges across an archipelago of karstic habitat-islands in the Salween Basin of southern Myanmar. The discovery of these new species continues to underscore the unprecedented high degree of diversity and site-specific endemism in this relatively small region and the urgent need for the conservation of its karstic terranes.

Correlation between sperm mitochondrial ND5 and ND6 gene variations and total fertilisation failure.

IntroductionThe purpose of this study was to investigate the correlation between sperm mitochondrial NADH dehydrogenase subunit 5 (ND5) and NADH dehydrogenase subunit 6 (ND6) gene variations and total fertilisation failure (TFF).Material and methodsA total of 232 sperm samples at the fresh in vitro fertilisation (IVF) cycle or the half-intracytoplasmic sperm injection (ICSI) cycle were collected for this retrospective controlled study on Han Chinese people between July 2011 and April 2014. Of the 232 total samples, 45 were from the IVF-TFF group and 187 were from couples with normal fertilisation (fertilisation rate > 50%). The mitochondrial ND5 and ND6 gene variations and sperm haplotypes were confirmed using nested PCR and DNA sequencing.ResultsTen homozygous variations were newly discovered, namely C12417T, T12441A, C12543A, C13650A, C13765A, T13769C, C13775T, A13776G, C13785A and C13845T. The gene variation rates of six sites, C12417T, C13650A, C13765A, T13769C, C13785A and C13845T, in the TFF group were significantly higher than those in the control group (p < 0.05). There were 231 heterozygous variations discovered; however, only nine heterozygous sites (12441, 12561, 12735, 13164, 13743, 13812, 13928, 14172 and 14368) had significantly higher gene variation rates than those in the control group (p < 0.05). In addition, the results showed that haplogroup C did not affect TFF (p > 0.05), and the fertilisation failure rates of haplogroup R and haplogroup D4a were both higher than those in the control group (p < 0.05).ConclusionsOur results suggested that the ND5 and ND6 gene variations are correlated with TFF. Furthermore, this study indicated that haplogroup R and haplogroup D4a might be risk factors for TFF.

Genetic variation and phylogenetic relationship of Hypoderaeum conoideum (Bloch, 1782) Dietz, 1909 (Trematoda: Echinostomatidae) inferred from nuclear and mitochondrial DNA sequences

Objective: To explore genetic variations of Hypoderaeum conoideum collected from domestic ducks from 12 different localities in Thailand and Lao PDR, as well as their phylogenetic relationship with American and European isolates. Methods: The nucleotide sequences of their nuclear ribosomal DNA (ITS), mitochondrial cytochrome c oxidase subunit 1 (CO1), and NADH dehydrogenase subunit 1 (ND1) were used to analyze genetic diversity indices. Results: We found relatively high levels of nucleotide polymorphism in ND1 (4.02%), whereas moderate and low levels were observed in CO1 (2.11%) and ITS (0.96%), respectively. Based on these polymorphisms, the 20 ND1, 12 CO1, and 18 ITS haplotypes were classified, and several common haplotypes were observed in all samples. At least three major lineages, namely American, European and Asian lineages, have been classified by phylogenetic analyses based on ND1 sequences. Conclusions: Our report demonstrates that the ND1 gene is the most suitable genetic marker to explore genetic variation and phylogenetic relationship of Hypoderaeum conoideum. However, a combination of all loci for ND1, CO1 and ITS would be of great value toward further genetic investigation of this endemic worldwide parasite. Thus, comprehensive molecular genetic analyses of Hypoderaeum conoideum from its worldwide distribution is needed to further understanding of the evolutionary and systematic relationships of this parasite.

Multiplex PCR development for the differential detection of four medically important echinostomes (Trematoda: Echinostomatidae) in Thailand

Four species of echinostomes, Echinostoma revolutum (Froelich, 1802), Echinostoma ilocanum (Garrison, 1908), Hypoderaeum conoideum (Bloch, 1872) Dietz, 1909, and Artyfechinostomum malayanum (Leiper, 1911) Mendheim, 1943 commonly infect humans in Thailand, but their eggs present similar morphologies resulting in difficult differentiation for diagnosis. Present molecular methods have a great potential to provide superior detection/diagnosis. DNA sequences, especially the mitochondrial NADH dehydrogenase subunit 1 (ND1) gene, have already been used to differentiate among echinostomes; thus, we aimed to develop species-specific primers for the differential detection of four medically important echinostomes by multiplex PCR. The species-specific reverse primers and a forward primer were based on variable regions and conserved regions of the ND1 gene, respectively. Four reverse primers and a forward primer were combined in a multiplex PCR reaction to amplify the ND1 fragment. Different ND1 fragment sizes were amplified: 108, 209, 384 and 419 bp of E. revolutum H. conoideum, E. ilocanum and A. malayanum, respectively. Specificity was tested with other medically important parasite DNA; no cross-reaction occurred. Sensitivity ranged between 0.1 and 0.05 ng. The species-specific primers developed in this study could be of further use in differential diagnosis for these medically important echinostomes infection in human and animal hosts.

Genetic structure of the Chagas disease vector Triatoma infestans (Hemiptera: Reduviidae) based on nuclear and mitochondrial DNA sequences

AbstractIn the present study, we analysed the genetic structure of Triatoma infestans populations with a phylogeographical approach using sequences of the mitochondrial NADH dehydrogenase subunit 5 (ND5) and the nuclear elongation factor-1 alpha (EF-1α) genes of bugs obtained from Argentina and Bolivia. Spatially circumscribed haplogroups were distinguished from the ND5 gene sequences, one distributed exclusively to the south of the studied area and, in agreement with the results from the EF-1α gene, one haplogroup limited to Bolivia and another to Morajú located in the Chaco region of Argentina. In both the ND5 and EF-1α networks, the most widespread haplogroup or allele group showed a star-like topology, which is compatible with a recent demographic expansion. The asymmetric historical gene flow detected from a population of the Chaco region towards Bolivia and the spatiotemporal phylogeographical reconstruction of lineage dispersal would support the hypothesis that postulates the Chaco biogeographical region as the area of origin for the species. However, additional studies with a broader sampling in the Andean region are needed to define with certainty whether the origin of T. infestans is Chacoan or Andean.