NADH Dehydrogenase Genes Research Articles

Complete mitochondrial genome assembly of Juglans regia unveiled its molecular characteristics, genome evolution, and phylogenetic implications

BackgroundThe Persian walnut (Juglans regia), an economically vital species within the Juglandaceae family, has seen its mitochondrial genome sequenced and assembled in the current study using advanced Illumina and Nanopore sequencing technology.ResultsThe 1,007,576 bp mitogenome of J. regia consisted of three circular chromosomes with a 44.52% GC content encoding 39 PCGs, 47 tRNA, and five rRNA genes. Extensive repetitive sequences, including 320 SSRs, 512 interspersed, and 83 tandem repeats, were identified, contributing to genomic complexity. The protein-coding sequences (PCGs) favored A/T-ending codons, and the codon usage bias was primarily shaped by selective pressure. Intracellular gene transfer occurred among the mitogenome, chloroplast, and nuclear genomes. Comparative genomic analysis unveiled abundant structure and sequence variation among J. regia and related species. The results of selective pressure analysis indicated that most PCGs underwent purifying selection, whereas the atp4 and ccmB genes had experienced positive selection between many species pairs. In addition, the phylogenetic examination, grounded in mitochondrial genome data, precisely delineated the evolutionary and taxonomic relationships of J. regia and its relatives. We identified a total of 539 RNA editing sites, among which 288 were corroborated by transcriptome sequencing data. Furthermore, expression profiling under temperature stress highlighted the complex regulation pattern of 28 differently expressed PCGs, wherein NADH dehydrogenase and ATP synthase genes might be critical in the mitochondria response to cold stress.ConclusionsOur results provided valuable molecular resources for understanding the genetic characteristics of J. regia and offered novel perspectives for population genetics and evolutionary studies in Juglans and related woody species.

HGG-52. MULTI-INTEGRIN TARGETING EFFECTIVELY SUPPRESSES DIFFUSE MIDLINE GLIOMA MIGRATION

Abstract Diffuse midline gliomas (DMGs) are aggressive tumors characterized by infiltration into normal midline brain tissue, hindering surgical resection and contributing to overall morbidity and mortality. We established a novel two-step pooled whole genome CRISPR-Migration screen by using serum-free conditions and laminin-dependent cell attachment, mimicking cell migration on brain vasculature scaffolds, a common feature in glioblastoma (GBM). Comparing DMG and GBM primary cell lines (n=5), genes involved in focal adhesion (ITGB1, CRKL, PARVA, PTK2, FERMT2) were identified as significantly restricting migration in all cell lines. Multi-institutional transcriptomic data revealed an association of expression of these focal adhesion genes with survival primarily in K27M-DMG and pediatric high-grade glioma compared to lower-grade brain tumors, and ITGB1 expression increased with glioma grade. Single-cell RNA-seq and spatial transcriptomic data demonstrated higher expression of ITGB1 in OPC-like/Mesenchymal cells associated with leading edge and microvasculature in both K27M-DMG and GBM tumors. Unexpectedly, knockout of ITGB1 (ITGB1-KO), primarily responsible for cell adhesion to laminin, led to the decreased expression of multiple mitochondrial NADH dehydrogenase genes, and reduced levels of glycolysis and oxidative phosphorylation (OXPHOS) activity. Preliminary mechanistic data linked this phenotype to impaired mitochondrial fusion. Orthotopic implantation of control and ITGB1-KO models of H3K27M-DMG and adult GBM in mouse brains revealed two distinct phenotypes: (1) ITGB1-KO reducing proliferation and significantly increasing survival; and (2) ITGB1-KO leading to upregulation of ITGB3 and ITGB5 in vivo without impacting survival. Cilengitide (αvβ3 and αvβ5 inhibitor) ablated migration of all ITGB1-KO models on vitronectin (secreted by pericytes surrounding blood vessels) in vitro. Ongoing combinatorial therapy with an experimental anti-Integrin Beta 1 antibody (AIIB2, CNS delivered) and Cilengitide is underway with promising early results. In summary, multi-integrin inhibition provides a feasible avenue to curb glioma spread in the brain through impaired focal adhesion as well as blunting mitochondrial glucose metabolism.

Phylogenetic relationships and systematics of tapeworms of the family Davaineidae (Cestoda, Cyclophyllidea), with emphasis on species in rodents.

The present study aims at clarifying the poorly known phylogenetic relationships and systematics of cestodes of the family Davaineidae Braun, 1900 (Cyclophyllidea), primarily the genus Raillietina Fuhrmann, 1920 and of the subfamily Inermicapsiferinae (Anoplocephalidae) from mammals (mostly rodents, 31 new isolates) and birds (eight new isolates). Phylogenetic analyses are based on sequences of the large subunit ribosomal RNA gene (28S) and mitochondrial NADH dehydrogenase subunit 1 gene (nad1). The main phylogenetic pattern emerging from the present analysis is the presence of three independent lineages within the main clade of the subfamily Davaineinae, one of which is almost entirely confined to species from rodents and the other two show a mixture of species from birds and mammals. It is suggested that the major diversification of the main clade took place in birds, possibly in galliforms. The subsequent diversification included repeated host shifts from birds to mammals and to other birds, and from rodents to other mammals, showing that colonisation of new host lineages has been the main driver in the diversification of davaineine cestodes. It is also shown that all isolates of Inermicapsifer Janicki, 1910, mainly from rodents, form a monophyletic group positioned among Raillietina spp. in the "rodent lineage", indicating that the genus Inermicapsifer is a member of the family Davaineidae. This means that the subfamily Inermicapsiferinae and the family Inermicapsiferidae should be treated as synonyms of the Davaineidae, specifically the subfamily Davaineinae. Three additional genera generally included in the Inermicapsiferinae, i.e. Metacapsifer Spasskii, 1951, Pericapsifer Spasskii, 1951 and Thysanotaenia Beddard, 1911, are also assigned here to the Davaineidae (subfamily Davaineinae). Raillietina spp. were present in all three main lineages and appeared as multiple independent sublineages from bird and mammalian hosts, verifying the non-monophyly of the genus Raillietina and suggesting a presence of multiple new species and genera.

Transcriptomic insights unveil the crucial roles of cytochromes, NADH, and pili in Ag(I) reduction by Geobacter sulfurreducens

Silver (Ag) is a pivotal transition metal with applications in multiple industries, necessitating efficient recovery techniques. Despite various proposed methods for silver recovery from wastewaters, challenges persist especially for low concentrations. In this context, bioreduction by bacteria like Geobacter sulfurreducens, offers a promising approach by converting Ag(I) to Ag nanoparticles. To reveal the mechanisms driving microbial Ag(I) reduction, we conducted transcriptional profiling of G. sulfurreducens under Ag(I)-reducing condition. Integrated transcriptomic and protein-protein interaction network analyses identified significant transcriptional shifts, predominantly linked to c-type cytochromes, NADH, and pili. When compared to a pilus-deficient strain, the wild-type strain exhibited distinct cytochrome gene expressions, implying specialized functional roles. Additionally, despite a down-regulation in NADH dehydrogenase genes, we observed up-regulation of specific downstream cytochrome genes, highlighting NADH's potential role as an electron donor in the Ag(I) reduction process. Intriguingly, our findings also highlight the significant influence of pili on the morphology of the resulting Ag nanoparticles. The presence of pili led to the formation of smaller and more crystallized Ag nanoparticles. Overall, our findings underscore the intricate interplay of cytochromes, NADH, and pili in Ag(I) reduction. Such insights suggest potential strategies for further enhancing microbial Ag(I) reduction.

Effect of the overexpression of external alternative NADH dehydrogenase gene in Arabidopsis on the resistance of transformed tobacco plants to negative temperatures

The study aims to confirm the functional activity and localization of the At_NDB2 transgenic protein of Arabidopsis in tobacco cells and to evaluate the effect produced by the permanent expression of external alternative NADH dehydrogenase on the resistance of a heat-loving plant to low temperatures. Proteins and mitochondria were isolated from the leaves of tobacco plants grown at 25 °С (day/night) at the 7-leaf stage. At_NDB2 protein localization in mitochondria was determined via electrophoresis and immunoblotting. The functional activity of At_NDB2 was confirmed through the polarography of isolated mitochondria and the specific mitochondrial complex I inhibitor (rotenone). It was also found that the cyanide-resistant respiration rate and the activity of an alternative oxidase enzyme were significantly higher in transgenic plants than in wild-type plants. In order to determine the resistance to low temperatures, the parent and transgenic tobacco plants were grown in soil until the 2–3 and 6–7 leaf stages, after which they were kept at 3 to -3 °С for a day in the dark and left to regrow at 25 °С for seven days. Although it was previously shown that oxidative stress is reduced in transgenic plants at low temperatures as compared to wild-type plants, it was established that the tolerance of transgenic and nontransformed plants does not differ. Thus, alternative NADH dehydrogenase activity was found to reduce oxidative stress and increase alternative oxidase activity, without enhancing the resistance of Nicotiana tabacum to negative temperatures.

A new species of Cyrtodactylus Gray, 1827 (Squamata: Gekkonidae) from the Thai-Malay Peninsula and the independent evolution of cave ecomorphology on opposite sides of the Gulf of Thailand.

An integrative taxonomic analysis recovers a distinctive new species of the gekkonid genus Cyrtodactylus Gray, 1827 from Satun Province in extreme southern Thailand as the sister species to the Cyrtodactylus intermedius group of southern Indochina, approximately 600 km to the northeast across the Gulf of Thailand. Based on 1449 base pairs of the mitochondrial gene NADH dehydrogenase subunit 2 (ND2) and its flanking tRNAs, the new species, C. disjunctus sp. nov., bears a pairwise sequence divergence from the mean divergences of the intermedius group species ranging from 17.923.6%. Three different principal component analyses (PCA) and a multiple factor analysis (MFA) recover C. disjunctus sp. nov. as a highly distinctive karst cave-adapted species based on morphology and color pattern. Its sister species relationship to the intermedius groupto which it is added herefurther underscores a growing body of analyses that have recovered a trans-Gulf of Thailand connection across the submerged Sunda Shelf between the southern Thai-Malay Peninsula and southern Indochina. Fragmented karstic archipelagos stretching across Indochina have served as foci for the independent evolution of nearly 25% of the species of Cyrtodactylus. The description of C. disjunctus sp. nov. continues to highlight the fact that karstic habitats support an ever-increasing number of threatened site-specific endemics that compose much of the reptile diversity of many Asian nations but, as of yet, most of these landscapes have no legal protection.

Mitochondrial complex III bypass complex I to induce ROS in GPR17 signaling activation in GBM

Guanine nucleotide binding protein (G protein) coupled receptor 17 (GPR17) plays crucial role in Glioblastoma multiforme (GBM) cell signaling and is primarily associated with reactive oxidative species (ROS) production and cell death. However, the underlying mechanisms by which GPR17 regulates ROS level and mitochondrial electron transport chain (ETC) complexes are still unknown. Here, we investigate the novel link between the GPR17 receptor and ETC complex I and III in regulating level of intracellular ROS (ROSi) in GBM using pharmacological inhibitors and gene expression profiling. Incubation of 1321N1 GBM cells with ETC I inhibitor and GPR17 agonist decreased the ROS level, while treatment with GPR17 antagonist increased the ROS level. Also, inhibition of ETC III and activation of GPR17 increased the ROS level whereas opposite function was observed with antagonist interaction. The similar functional role was also observed in multiple GBM cells, LN229 and SNB19, where ROS level increased in the presence of Complex III inhibitor. The level of ROS varies in Complex I inhibitor and GPR17 antagonist treatment conditions suggesting that ETC I function differs depending on the GBM cell line. RNAseq analysis revealed that ∼ 500 genes were commonly expressed in both SNB19 and LN229, in which 25 genes are involved in ROS pathway. Furthermore, 33 dysregulated genes were observed to be involved in mitochondria function and 36 genes of complex I-V involved in ROS pathway. Further analysis revealed that induction of GPR17 leads to loss of function of NADH dehydrogenase genes involved in ETC I, while cytochrome b and Ubiquinol Cytochrome c Reductase family genes in ETC III. Overall, our findings suggest that mitochondrial ETC III bypass ETC I to increase ROSi in GPR17 signaling activation in GBM and could provide new opportunities for developing targeted therapy for GBM.

Urinary Mitochondrial Deoxyribonucleic Acid: A Novel Biomarker of Coronavirus Disease 2019-associated Acute Kidney Injury in Renal Transplant Recipients

Abstract Background: Acute kidney injury (AKI) is one of the common manifestations of severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) infection. An early identification of AKI is of paramount importance to modulate the management of AKI, limiting the severity, avoiding nephrotoxic medicines, and modifying the drug dose depending on renal function. Aim: To determine the utility of urinary mitochondrial deoxyribonucleic acid (umt-DNA) and neutrophil gelatinase-associated lipocalin (NGAL) in predicting coronavirus disease 2019 (COVID-19)-associated AKI and mitochondrial stress. Materials and Methods: Live-related renal transplant recipients (RTRs) (n = 66), who acquired SARS-CoV-2 infection and were admitted to a COVID hospital were included and subclassified into AKI (n = 19) with > 1.5-fold rise in serum creatinine level from the pre-COVID-19 serum creatinine level, and non-AKI (n = 47) whose serum creatinine value remained stable, or a rise of <1.5-fold of the baseline values of pre-COVID-19. A 50 mL urine sample was collected and urinary mt-DNA and NGAL was determined by the reverse transcriptase-polymerase chain reaction and enzyme-linked immunosorbent assays methods. Results: Both the urinary mitochondrial gene NADH dehydrogenase (ND-1) and NGAL level were significantly higher in the AKI group compared to non-AKI. The mean ND-1 gene Ct in the AKI group was (19.44 ± 2.58 a.u) compared to non-AKI (21.77 ± 3.60; P = 0.013). The normalized ND-1 gene cycle of threshold (Ct) in AKI was 0.79 ± 0.11 a.u compared to non-AKI (0.89 ± 0.14; P = 0.007). The median urinary NGAL level in AKI group was (453.53; range, 320.22–725.02, 95% confidence interval [CI]) ng/mL compared to non-AKI (212.78; range, 219.80–383.06, 95% CI; P = 0.015). The median urine creatinine normalized uNGAL was 4.78 (0.58–70.39) ng/mg in the AKI group compared to 11.26 ng/mg (0.41–329.71) in the non-AKI group. The area under curve of ND-1 gene Ct was 0.725, normalized ND-1 Ct was 0.713, uNGAL was 0.663, and normalized uNGAL was 0.667 for detecting the AKI and mitochondrial stress. Conclusions: Urinary mt-DNA quantification can detect the post-COVID mitochondrial distress with higher sensitivity than uNGAL in RTRs.

Development of DNA methylation-based epigenetic age predictors in loblolly pine (Pinus taeda).

Biological ageing is connected to life history variation across ecological scales and informs a basic understanding of age-related declines in organismal function. Altered DNA methylation dynamics are a conserved aspect of biological ageing and have recently been modelled to predict chronological age among vertebrate species. In addition to their utility in estimating individual age, differences between chronological and predicted ages arise due to acceleration or deceleration of epigenetic ageing, and these discrepancies are linked to disease risk and multiple life history traits. Although evidence suggests that patterns of DNA methylation can describe ageing in plants, predictions with epigenetic clocks have yet to be performed. Here, we resolve the DNA methylome across CpG, CHG, and CHH-methylation contexts in the loblolly pine tree (Pinus taeda) and construct epigenetic clocks capable of predicting ages in this species within 6% of its maximum lifespan. Although patterns of CHH-methylation showed little association with age, both CpG and CHG-methylation contexts were strongly associated with ageing, largely becoming hypomethylated with age. Among age-associated loci were those in close proximity to malate dehydrogenase, NADH dehydrogenase, and 18S and 26S ribosomal RNA genes. This study reports one of the first epigenetic clocks in plants and demonstrates the universality of age-associated DNA methylation dynamics which can inform conservation and management practices, as well as our ecological and evolutionary understanding of biological ageing in plants.

Synchronised interaction of carbon and nitrogen provides drought tolerance in Cyamopsis tetragonoloba

Drought is a major adverse environmental factor that limits plant productivity. Concomitant assimilation of carbon (C) and nitrogen (N) in illuminated leaves requires the regulated partitioning of reductant and photosynthate to sustain the demands of amino acid and carbohydrate biosynthesis. The short-term exposure to drought and its responses of photosynthesis and photosynthate partitioning to N enrichment was studied in Cyamopsis tetragonoloba (L.) Taub (guar). Four contrasting varieties of guar, HG-563, RGC-986 (drought-tolerant) and RGC-471, Varsha (drought-sensitive) were subjected to 15 days water stress and leaf tissues were studied in order to contemplate the counter strategy engaged under drought conditions. In guar plants, sensors trigger a signalling cascade that activates numerous proteins to induce the expression of certain genes involved in carbon and nitrogen metabolism.The levels of glucose, starch, and Glutamate dehydrogenase (GDH), Aspartate aminotransferase (AspAT), isocitrate dehydrogenase (ICDH), Nitrate Reductase (NR), and Nitrite reductase (NiR) activities were determined biochemically during 15 days drought treatment, at three stages. Further, the carbon (oxidative phosphorylation and TCA cycle) - nitrogen metabolic pathway interaction was studied at the molecular level. The respiratory pathway genes were upregulated, while the nitrogen metabolic pathway genes were downregulated under all stages of drought in guar plants. The physiological, biochemical and molecular data suggests that the high rates of dark respiration was insufficient to provide extra carbon required to assist amino acid synthesis but rather sufficed by a rapid metamorphosis in the photosynthetic carbon partitioning to amino acid metabolism via the nitrogen metabolism. • Drought causes NADH DEHYDROGENASE gene to escalate dark respiration. • Nitrogen assimilation reduces under drought in leguminous Cyamopsis tetragonoloba. • Drought triggers protein kinase cascade signalling in guar plants. • Drought regulates nitrogen metabolic genes in guar. • Drought triggers increase in sugar content at the cost of amino acids.

Tea Polyphenols Improve Down-Regulation of Mitochondrial Functional Gene Expression Induced by Bisphenol A in Zebrafish Ovaries

The plasticizer bisphenol A, a typical endocrine disrupting chemical, is widely present in the environment. Previous studies demonstrated that exposure to bisphenol A can cause reproductive toxicity, abnormal fertilization, and infertility. However, the mechanisms of low-concentration bisphenol A on the reproductive system and treatment measures have not been fully determined. In this study, we explored the transcriptomic profiles of female zebrafish ovaries. The transcriptomic data revealed that mitochondrial NADH dehydrogenase (mt-Nd) genes were significantly decreased in the bisphenol A-exposed group, while the co-administration of tea polyphenols remarkably elevated the expression of mt-Nd genes. To further explore the expression pattern of the mt-Nd, we analyzed the expression of six mt-Nd genes on different days by qRT-PCR in control, bisphenol A-exposed, and bisphenol A-tea polyphenols ovaries. Here, we found that 0.1 mg/L bisphenol A exposure adversely affects the mitochondrial respiratory chain in ovaries and may lead to reproductive disorders. Finally, our study demonstrated that tea polyphenols play a protective role in ovarian mitochondrial dysfunction in low-concentration bisphenol A-exposed female zebrafish.

Regulation of the NADH supply by nuoE deletion and pncB overexpression to enhance hydrogen production in Enterobacter aerogenes

In this study, seven mutants from E. aerogenes IAM1183 wildtype were constructed via different strategies including deletion of lactate dehydrogenase, disruption of NADH dehydrogenase gene nuoE , overexpression of pncB and a combination of both to regulate of the NADH supply to enhance hydrogen production. Compared with the parental strain, the hydrogen yields of the strains IAM1183-E, IAM1183-L and IAM1183-EL increased by 23.3, 81.7 and 97.9%, respectively. When the pncB gene was overexpressed, the hydrogen yield of IAM1183/P, IAM1183-E/P, IAM1183-L/P and IAM1183-EL/P increased by 39.0, 6.5, 5.9, and 5.1% compared with the respective original knockout strains. Among them, the total hydrogen yield of strain IAM1183-EL/P with highest production efficiency was 58% higher than IAM1183. Further metabolite analysis indicated that the knockout of nuoE and ldhA , combined with the overexpression of pncB , resulted in a redistribution of the metabolic fluxes in E. aerogenes , which led to an improvement of the hydrogen yield. • Disruption of nuoE or overexpression of pncB in E. aerogenes increased NADH/NAD + pool. • Deletion of ldhA of E. aerogenes enhanced the competitiveness of NADH dehydrogenase. • The knockout of nuoE and ldhA , combined with the overexpression of pncB improved H 2 yield. • Hydrogen yield of IAM1183-EL/P increased by 58% in 5-L fermenter.

Improving correlation of wastewater SARS-CoV-2 gene copy numbers with COVID-19 public health cases using readily available biomarkers.

The COVID-19 pandemic has highlighted the potential role that wastewater-based epidemiology can play in assessing aggregate community health. However, efforts to translate SARS-CoV-2 gene copy numbers obtained from wastewater samples into meaningful community health indicators are nascent. In this study, SARS-CoV-2 nucleocapsid (N) genes (N1 and N2) were quantified weekly using reverse transcriptase droplet digital PCR from two municipal wastewater treatment plants for seven months. Four biomarkers (ammonium, biological oxygen demand (BOD), creatinine, and human mitochondrial gene NADH dehydrogenase subunit 5) were quantified and used to normalize SARS-CoV-2 gene copy numbers. These were correlated to daily new case data and one-, two-, and three-week cumulative case data. Over the course of the study, the strongest correlations were observed with a one-day case data lag. However, early measurements were strongly correlated with a five-day case data lag. This indicates that in the early stages of the pandemic, the wastewater samples may have indicated active COVID-19 cases before clinical indications. Mitochondrial and creatinine normalization methods showed the strongest correlations throughout the study, indicating that human-specific biomarkers were better at normalizing wastewater data than ammonium or BOD. Granger causality tests supported this observation and showed that gene copies in wastewater could be predictive of new cases in a sewershed.

Role of mitochondrial genetic interactions in determining adaptation to high altitude human population

Physiological and haplogroup studies performed to understand high-altitude adaptation in humans are limited to individual genes and polymorphic sites. Due to stochastic evolutionary forces, the frequency of a polymorphism is affected by changes in the frequency of a near-by polymorphism on the same DNA sample making them connected in terms of evolution. Here, first, we provide a method to model these mitochondrial polymorphisms as “co-mutation networks” for three high-altitude populations, Tibetan, Ethiopian and Andean. Then, by transforming these co-mutation networks into weighted and undirected gene–gene interaction (GGI) networks, we were able to identify functionally enriched genetic interactions of CYB and CO3 genes in Tibetan and Andean populations, while NADH dehydrogenase genes in the Ethiopian population playing a significant role in high altitude adaptation. These co-mutation based genetic networks provide insights into the role of different set of genes in high-altitude adaptation in human sub-populations.

First Report of Late Blight Caused by Phytophthora infestans in Potato in Tibet, China.

Late blight caused by Phytophthora infestans (Mont.) De Bary is the most destructive diseases in the potato field. Although it has been studied worldwide, it has not been reported in Tibet Autonomous Region of China, lying on the world's highest plateau. To investigate whether the disease caused by P. infestans occurred in such region, a survey on potato disease was conducted in the summer in 2020. In August, potato (Solanum tuberosum) of the cultivar 'Longshu 10' with diseased leaves was observed in a potato field in Shigatse city in Tibet Autonomous Region (29.3N,88.8E). The necrotic brown lesions were shaped in round or irregularly with whitish growth of sporangium-producing structures on the underleaf surface, similar to typical late blight symptom. Affected leaves were collected for pathogen isolation. The abaxial side of the decayed leaves showed grey zones of sporulation. Upon isolation, three isolates were used for further investigation. The mycelium grew averagely at a linear rate of 4.35 mm per day at 19oC on Rye B agar (RBA, containing 50 g/L rye and 12 g/L agar), forming white colony. The opaque and lemon-shaped spores with a papilla at the distal end (Figure S1) had an average size of 36.2ⅹ20.3 µm, the shape and size consistent with P. infestans (Cardenas et al. 2011; Winton et al. 2007). The ribosomal ITS1-5.8S-ITS2 region was amplified from genomic DNA obtained from mycelium using primers ITS1 and ITS4 (Glass and Donaldson 1995). The sequences with 829 bp in size obtained from three isolates were identical, among which one of the sequences from Tibet isolate RKZ_27 was submitted to GenBank with Accession No. of MW559423. A BLAST search in NCBI (National Center for Biothchnology Information) revealed MW559423 had the highest similarity (100%) to P. infestans sequences (GenBank Accession No. of MK507866, MH401206 and KU992300). In addition, a partial nucleus DNA sequence from elongation factor 1-α (EF1-α) was amplified using primer set of EF_F/ EF_R (EF_F: 5'GGCCTTGACGACATCCAGAA3'; EF_R: 5'TAGCAGCTCAACCCGAAGTG3'), and a partial mitochondria DNA sequence (P2 region) including partial ATP synthase F1 subunit α gene (atp1), tRNA-Glu gene and partial NADH dehydrogenase subunit 4 (ND4) was amplified using primer set of P2F/P2R (P2F: 5'TTCCCTTTGTCCTCTACCGAT3'; P2R: 5'TTACGGCGGTTTAGCACATACA3') (Vargas et al. 2009). The EF1-α and P2 region for three isolates were all identical and one of each sequence was submitted to GenBank with Accession No. of MZ189257 and MZ399710, respectively, which had 99.78% (XM_002998924.1) and 100% (MG869098) similarity with P. infestans, respectively. Phylogenetic analyses showed that the RKZ_27 was close to P. infestans (Figure S2). Pathogenicity was confirmed by inoculating ten potato leaves cv. 'Favorita' for each isolate with a 5 mm in diameter mycelium plug on each leaf. After 3 days of incubation at 19 oC in air-tight plastic bags, the inoculated leaves developed typical symptoms of late blight. All control leaves treated with distilled water remained healthy. The pathogenicity of three isolates were also confirmed by inoculating potato seedlings cv. 'Favorita' with sporangia suspension. The pathogen re-isolation on inoculated symptomatic leaves and seedlings were confirmed to be P. infestans by the morphological characteristics, which was fulfilled Koch postulates. The pathogenicity test both on leaves and seedlings were conducted twice. To our knowledge, this is the first report of P. infestans in potato field in Tibet Autonomous Region of China. The finding of potato late blight in this region have important epidemiological implications for the growers especially under favorable environmental conditions.

A new cryptic arboreal species of the Cyrtodactylus brevipalmatus group (Squamata: Gekkonidae) from the uplands of western Thailand

The first integrative taxonomic analysis of the Cyrtodactylus brevipalmatus group of Southeast Asia recovered two newly discovered populations from the Tenasserim Mountains in Suan Phueng District, Ratchaburi Province, Thailand as a new species described here as C. rukhadeva sp. nov. Based on 1397 base pairs of the mitochondrial gene NADH dehydrogenase subunit 2 (ND2), C. rukhadeva sp. nov. is the well-supported sister species to a clade containing three undescribed species, C. ngati, and C. cf. interdigitalis with a large uncorrected pairwise sequence divergence from other species in the brevipalmatus group ranging from 15.4–22.1%. Cyrtodactylus elok and C. brevipalmatus are recovered as poorly supported sister species and the well-supported sister lineage to the remainder of the brevipalmatus group. Cyrtodactylus rukhadeva sp. nov. is putatively diagnosable on the basis of a number of meristic characters and easily separated from the remaining species of the brevipalmatus group by a number of discrete morphological characters as well as its statistically significant wide separation in multivariate morphospace. The discovery of C. rukhadeva sp. nov. continues to underscore the unrealized herpetological diversity in the upland forests of the Tenasserim Mountains and that additional field work will undoubtedly result in the discovery of additional new species.

Metabolic Engineering of Enterobacter aerogenes for Improved 2,3-Butanediol Production by Manipulating NADH Levels and Overexpressing the Small RNA RyhB.

Biotechnological production of 2,3-butanediol (2,3-BD), a versatile platform bio-chemical and a potential biofuel, is limited due to by-product toxicity. In this study, we aimed to redirect the metabolic flux toward 2,3-BD in Enterobacter aerogenes (E. aerogenes) by increasing the intracellular NADH pool. Increasing the NADH/NAD+ ratio by knocking out the NADH dehydrogenase genes (nuoC/nuoD) enhanced 2,3-BD production by up to 67% compared with wild-type E. aerogenes. When lactate dehydrogenase (ldh) was knocked out, the yield of 2,3-BD was increased by 71.2% compared to the wild type. Metabolic flux analysis revealed that upregulated expression of the sRNA RyhB led to a noteworthy shift in metabolism. The 2,3-BD titer of the best mutant Ea-2 was almost seven times higher than that of the parent strain in a 5-L fermenter. In this study, an effective metabolic engineering strategy for improved 2,3-BD production was implemented by increasing the NADH/NAD+ ratio and blocking competing pathways.

Gene Loss, Pseudogenization in Plastomes of Genus Allium (Amaryllidaceae), and Putative Selection for Adaptation to Environmental Conditions.

Amaryllidaceae is a large family with more than 1,600 species, belonging to 75 genera. The largest genus—Allium—is vast, comprising about a thousand species. Allium species (as well as other members of the Amaryllidaceae) are widespread and diversified, they are adapted to a wide range of habitats from shady forests to open habitats like meadows, steppes, and deserts. The genes present in chloroplast genomes (plastomes) play fundamental roles for the photosynthetic plants. Plastome traits could thus be associated with geophysical abiotic characteristics of habitats. Most chloroplast genes are highly conserved and are used as phylogenetic markers for many families of vascular plants. Nevertheless, some studies revealed signatures of positive selection in chloroplast genes of many plant families including Amaryllidaceae. We have sequenced plastomes of the following nine Allium (tribe Allieae of Allioideae) species: A. zebdanense, A. moly, A. victorialis, A. macleanii, A. nutans, A. obliquum, A. schoenoprasum, A. pskemense, A. platyspathum, A. fistulosum, A. semenovii, and Nothoscordum bivalve (tribe Leucocoryneae of Allioideae). We compared our data with previously published plastomes and provided our interpretation of Allium plastome genes’ annotations because we found some noteworthy inconsistencies with annotations previously reported. For Allium species we estimated the integral evolutionary rate, counted SNPs and indels per nucleotide position as well as compared pseudogenization events in species of three main phylogenetic lines of genus Allium to estimate whether they are potentially important for plant physiology or just follow the phylogenetic pattern. During examination of the 38 species of Allium and the 11 of other Amaryllidaceae species we found that rps16, rps2, infA, ccsA genes have lost their functionality multiple times in different species (regularly evolutionary events), while the pseudogenization of other genes was stochastic events. We found that the “normal” or “pseudo” state of rps16, rps2, infA, ccsA genes correlates well with the evolutionary line of genus the species belongs to. The positive selection in various NADH dehydrogenase (ndh) genes as well as in matK, accD, and some others were found. Taking into account known mechanisms of coping with excessive light by cyclic electron transport, we can hypothesize that adaptive evolution in genes, coding subunits of NADH-plastoquinone oxidoreductase could be driven by abiotic factors of alpine habitats, especially by intensive light and UV radiation.

Effect of Short-Term Cold Treatment on Carbohydrate Metabolism in Potato Leaves.

Plants are often challenged by an array of unfavorable environmental conditions. During cold exposure, many changes occur that include, for example, the stabilization of cell membranes, alterations in gene expression and enzyme activities, as well as the accumulation of metabolites. In the presented study, the carbohydrate metabolism was analyzed in the very early response of plants to a low temperature (2 °C) in the leaves of 5-week-old potato plants of the Russet Burbank cultivar during the first 12 h of cold treatment (2 h dark and 10 h light). First, some plant stress indicators were examined and it was shown that short-term cold exposure did not significantly affect the relative water content and chlorophyll content (only after 12 h), but caused an increase in malondialdehyde concentration and a decrease in the expression of NDA1, a homolog of the NADH dehydrogenase gene. In addition, it was shown that the content of transitory starch increased transiently in the very early phase of the plant response (3–6 h) to cold treatment, and then its decrease was observed after 12 h. In contrast, soluble sugars such as glucose and fructose were significantly increased only at the end of the light period, where a decrease in sucrose content was observed. The availability of the monosaccharides at constitutively high levels, regardless of the temperature, may delay the response to cold, involving amylolytic starch degradation in chloroplasts. The decrease in starch content, observed in leaves after 12 h of cold exposure, was preceded by a dramatic increase in the transcript levels of the key enzymes of starch degradation initiation, the α-glucan, water dikinase (GWD-EC 2.7.9.4) and the phosphoglucan, water dikinase (PWD-EC 2.7.9.5). The gene expression of both dikinases peaked at 9 h of cold exposure, as analyzed by real-time PCR. Moreover, enhanced activities of the acid invertase as well as of both glucan phosphorylases during exposure to a chilling temperature were observed. However, it was also noticed that during the light phase, there was a general increase in glucan phosphorylase activities for both control and cold-stressed plants irrespective of the temperature. In conclusion, a short-term cold treatment alters the carbohydrate metabolism in the leaves of potato, which leads to an increase in the content of soluble sugars.

MCT4 is induced by metastasis-enhancing pathogenic mitochondrial NADH dehydrogenase gene mutations and can be a therapeutic target

Pathogenic mitochondrial NADH dehydrogenase (ND) gene mutations enhance the invasion and metastasis of various cancer cells, and they are associated with metastasis in human non-small cell lung cancer (NSCLC). Moreover, monocarboxylate transporter 4 (MCT4) is overexpressed in solid cancers and plays a role in cancer cell proliferation and survival. Here, we report that MCT4 is exclusively expressed in mouse transmitochondrial cybrids with metastasis-enhancing pathogenic ND6 mutations. A high level of MCT4 is also detected in human NSCLC cell lines and tissues predicted to carry pathogenic ND mutations and is associated with poor prognosis in NSCLC patients. MCT4 expression in the cell lines is suppressed by N-acetyl-L-cysteine. Phosphatidylinositol-3 kinase (PI3K), AMP-activated protein kinase (AMPK) and mechanistic target of rapamycin (mTOR) are involved in the regulation of MCT4 expression in the transmitochondrial cybrid cells. An MCT1/4 inhibitor effectively kills NSCLC cells with predicted pathogenic ND mutations, but an MCT1/2 inhibitor does not have the same effect. Thus, MCT4 expression is augmented by pathogenic ND mutations and could be a biomarker and a therapeutic target in pathogenic ND mutation-harbouring metastatic tumours.