Myelomonocytic Differentiation Research Articles

Not all hematological malignancies in the gastrointestinal tract are lymphoma

Abstract Introduction/Objective Myeloid sarcoma (MS) is a rare entity that may develop in patients with acute myeloid leukemia (AML). Presentation of MS in the gastrointestinal (GI) tract is uncommon. We describe two cases of MS involving unusual sites: the stomach and appendix. Methods/Case Report A 64-year-old female consulted for fatigue and abdominal pain. A CT scan of abdomen/pelvis revealed appendicitis and CBC showed 76% blasts. An appendectomy was performed. Histologic examination demonstrated the appendiceal wall infiltrated by malignant cells, ultimately demonstrated to be positive for MPO and weak/variable CD117. In the second case, a 50-year-old male presented to the emergency department for nausea, vomiting, and elevated amylase. Esophagogastroduodenoscopy with endoscopic ultrasound demonstrated pancreatic inflammatory changes and a subepithelial nodule in the gastric fundus. Biopsy of the nodule revealed gastric epithelium infiltrated by sheets of malignant cells, ultimately demonstrated to be positive for CD34, myeloperoxidase and CD43. Results (if a Case Study enter NA) NA Conclusion MS is defined as a tumor of myeloid blasts forming outside the bone marrow. Overall, it is an uncommon entity that can occur in patients with known AML, and rarely, as the first sign of AML. Presentation of MS in the GI tract is infrequent (10%), involving primarily the small intestine (63%). The differential diagnosis includes lymphoma, poorly differentiated carcinomas, and melanomas. A review of the clinical history for AML or other myeloproliferative neoplasms should raise suspicion of MS. Expression of lymphoid markers and scant tissue for IHC studies can be diagnostic challenges, rendering B cell lymphoma as the most common misdiagnosis of MS in up to 40-47% of cases. Our two MS cases presented exclusively with GI symptoms without previously known AML and involved unusual GI sites. IHC for myeloid lineage, monocytic or myelomonocytic differentiation should be considered in specific cases. In patients without prior AML diagnosis, especially without hematologic findings, MS is a diagnostic challenge.

Encouraging Outcome of AML with t(8;16) Following Allogeneic Stem Cell Transplantation in First Remission - a Retrospective Analysis on Behalf of the Acute Leukemia Working Party of the EBMT

In the 2022 European Leukemia Net (ELN) risk classification, acute myeloid leukemia (AML) with translocation t(8;16) was newly classified as AML defined by specific cytogenetic abnormalities, associated with unfavorable prognosis. Translocation (8;16)(p11;p13) is a rare abnormality in AML with female preponderance and occurs more frequently in secondary AML (sAML), especially therapy-related, than in de novo disease. Clinically, AML with t(8;16) is associated with high risk of bleeding, occurrence of extramedullary manifestations, myelomonocytic differentiation, and signs of hemophagocytosis in the bone marrow. The translocation leads to the fusion of acetyltransferase KAT6A (also known as MOZ or MYST3) and CREB binding protein ( CREBBP) genes, both of them involved in hematopoiesis. ELN risk stratification of AML with t(8;16) was based on studies that included relatively low numbers of patients receiving allogeneic stem cell transplantation (alloSCT). In the largest report by Kayser et al. ( Br J Haematol 2021) 21 patients (15 transplanted in first complete remission [CR1], median follow-up 5.5 years) were analyzed. A 5-year overall survival (OS) of 38% was achieved after alloSCT compared to 11% in patients who received chemotherapy only. The aim of our study was to evaluate the outcome of patients with AML harboring t(8;16) after alloSCT in a larger cohort from the EBMT registry. All types of donor, conditioning regimen and graft were included. Sixty patients were identified, of whom 44 had been transplanted in CR1. Median follow-up from alloSCT was 72.3 months, median age was 46.3 years, and 73.3% were female. Karnofsky performance status was >80% in 59 patients, one had missing data. At 2 years after alloSCT, OS and leukemia free survival (LFS) of the entire cohort were 42.7% and 42.2%, respectively, (28.6% and 14.3% in patients transplanted in advanced disease). Cumulative incidence of relapse (RI) and non-relapse mortality (NRM) at two years was 36.9% and 15.3%, respectively, in patients transplanted in CR1, and 78.6% and 7.1%, respectively, in patients transplanted in advanced disease. The 44 patients transplanted in CR1 were analyzed in detail. Basic characteristics were comparable to the entire cohort as described above. Twenty-two of the patients had de novo, 22 had sAML. According to the ELN 2017 classification (not yet including t(8;16) as a factor for poor prognosis), 54.5% had an intermediate and 45.5% an adverse cytogenetic risk. Furthermore, 38.8% had a complex karyotype. Donors were matched related in 34%, matched unrelated in 54%, haploidentical in 5% and cord blood in 7%. Conditioning was myeloablative in 52.3%, whereas 47.7% had received reduced intensity conditioning. Among patients transplanted in CR1, 2- and 5-year OS from alloSCT was 48% and 39.9%, the respective LFS was 46.8% and 35.5%. On multivariate analysis (MVA), harboring t(8;16) within a complex karyotype was the major risk factor for outcome, being associated with higher RI (hazard ratio [HR] 3.38, p=0.01), lower LFS (HR 4.17, p=0.016), and lower OS (HR 3.08, p=0.017). In contrast, patients with t(8;16) outside of a complex karyotype achieved excellent results (Figure 1). Besides a complex karyotype, MVA revealed sAML as an additional, independent risk factor with a higher RI (HR 3.73, p=0.026). Age was the major factor for NRM, reaching 5% vs. 26.5% in patients below or above the median (p=0.02). In conclusion, according to the largest series analyzed in this setting so far, overall results after alloSCT in AML with t(8;16) transplanted in CR1 were favorable, especially in patients without multiple additional cytogenetic abnormalities, achieving a low risk of relapse and a 5-year OS >60%. Hence, alloSCT in CR1 appears to abrogate the unfavorable prognostic value of this translocation. Whether or not t(8;16) does have any additional influence on the outcome of patients with a complex karyotype remains to be evaluated. Figure Legend Figure 1: Outcome of AML with t(8;16) with and without complex karyotype

Myelomonocytic/Monocytic Subtypes Are More Resistant to Venetoclax-Based Therapy in Acute Myeloid Leukemia Patients: A Monocentric, Real-Life Retrospective Study

Background： Venetoclax(VEN)-based regimens have seen broad adoption in newly diagnosed patients with acute myeloid leukemia (AML) who are not candidates for intensive induction chemotherapy. Nonetheless, a sizable proportion of AML patients do not respond. Finding biomarkers that can predict treatment results is crucial. FAB (French, American, British) classification system provides a well-described and clinically associated means to segregate AML patients by virtue of myeloid differentiation status. Whether FAB classification can be used as a predictor marker for VE-based therapy is controversial. In the Chinese population of patients with AML, we conducted this single center retrospective study to examine the predictive value of monocytic and myelomonocytic differentiation on the response to VEN-based treatment. Methods: The clinical features, treatment information, and clinical outcomes of AML patients who received at least one dose of VEN treatment at West China Hospital for more than seven days between January 1, 2019, and September 8, 2022 were retrospectively examined in this study. We classified the patients into two groups based on the FAB classification system: the primitive group (includes M0/M1/M2, abbreviated as PRI) and the myelomonocytic/monocytic group (includes M4/M5, abbreviated as M/M). AML response to VEN therapy was determined by the 2017 European Leukemia Net response criteria after one cycle of VEN treatment. The overall response rate (ORR) was defined as the combination of CR, CRi, PR. From the first day of VEN use until the patient dies or the end of follow-up, the overall survival (OS) time is calculated. Logistic regression and COX regression were used to examine the variables that influence ORR and survival. All statistical tests were two-sided, and p-values of 0.05 or lower were considered significant. All statistical analyses were performed using RStudio 4.2.2. Results: There were 267 patients in all, with 162 newly diagnosed (M/M n=69; PRI n=93) and 85 relapsed/refractory (M/M n=44; PRI n=41). The ORR for M/M is 63.77%, while that for PRI is 84.95% among newly diagnosed patients (p=0.018). The ORR for M/M is 40.91% and PRI is 68.29% among relapsed/refractory patients (p=0.0114, Figure1). In addition, we identified (i) FAB classification M/M subtypes, (ii) previously diagnosed MDS/MPN, (iii) IDH1/IDH2 mutations, (iv) relapsed/refractory event, (v) transfusion requirement, and (vi) TP53 mutation as significant factors predicting the response of all patients using univariate logistic regression analysis. M/M subtypes and MDS/MPN also trended toward independent predictors in the multivariate analysis. We identified (i) FAB Classification M/M subtype, (ii) adverse risk AMLs according to the 2022 ELN classification, (iii) CEBPA mutation, and (iv) TP53 mutation as significant factors predicting the risk of all patients using univariate COX regression analysis. M/M subtype and TP53 also trended toward independent predictors in the multivariate analysis (Table1). OS was significantly longer in the PRI than in the M/M(median OS: 621 days vs 266 days, hazard ratio 0.56, 95% CI: 0.39-0.80, p=0.0011). We compared the overall survival of various illness conditions; OS still was significantly longer in the PRI group than in the M/M group among newly diagnosed patients (median OS: newly diagnosed: 1124 days vs 295 days, HR: 0.47, 95% CI: 0.24-0.83, p=0.0017; refractory/relapsed: 204 days vs 266 days, HR 0.68: 95% CI: 0.45-1.97, p=0.72). Conclusion： Our research demonstrates that the response to VEN may differ depending on how advanced the AML is, with PRI patients being more sensitive and M/M patients being more resistant, particularly in newly diagnosed individuals. Previous research has discovered that AML cells with Monocyte/erythroid/Megakaryocyte differentiation are less sensitive to BCL-2 inhibition in vitro, indicating that the differentiation stage of AML may affect its sensitivity to BCL-2 family inhibitors. This is likely due to an increase in MCL1 family expression and a decrease in BCL2 family expression during cell differentiation. In conclusion, M/M subtype may be able to predict VENs resistance and the worse prognosis for patients treated with VEN-based regimens. Legends to figures Figure 1: Differences in ORR and NR (no response) between M/M and PRI in newly diagnosed and relapsed/refractory patients Table1: Regression analysis results

Cebpβ/IL1/TNFα Positive Feedback Loop Drives Drug Resistance of BCL2 and MDM2 Inhibitors in Monocytic Leukemia Cells

Introduction:Ventoclax-based combinations have emerged as a new standard of care for patients with acute myeloid leukemia (AML) who are not suitable for intense chemotherapy. Not all patients respond to these treatments, and those who do may relapse. MDM2 inhibitors are promising therapeutics for treating TP53 wild-type tumors, including most de novo AML cases, with numerous compounds currently in pre-clinical and clinical evaluation. However, clinical trials of MDM2 inhibitors have shown modest and variable clinical activity. Functional genomic data showed that monocytic leukemia (FAB M4/M5) is resistant to venetoclax-based therapies and MDM2 inhibitors. Notably, venetoclax and an MDM2 inhibitor, idasanutlin, demonstrated a strong positive correlation in the Beat AML cohort. We hypothesize that upregulation of certain myeloid transcription factors in monocytic leukemia may confer intrinsic resistance to BCL2 and MDM2 inhibitors, while certain environmental cues upregulated in these cells may confer extrinsic drug resistance. Additionally, there may be crosstalk between these intrinsic and extrinsic mechanisms. Methods: We performed differential expression gene (DEG) analysis of transcription factors (TFs) between M4/M5 and M0/M1 samples in the Beat AML and TCGA AML cohort. We overexpressed seven myeloid TFs (SPI1, CEBPB, CEBPD, JUNB, IRF8, KLF4, and MAFB) that are upregulated in M4/M5 and performed competitive drug assays. We treated M4/M5 and M0/M1 samples with venetoclax and idasanutlin, in the presence of a panel of myeloid cytokines and measured cell viabilities. A Luminex assay on monocyte supernatants from M4/M5 and M0/M1 AML samples were conducted to identify dysregulated cytokines. Furthermore, RNAseq DEG and immunoblot analysis were performed on CEBPB-overexpressing cell lines and IL-1-treated AML samples to elucidate the underlying mechanisms. Results: CEBPB overexpression conferred drug resistance to a broad range of BH3 mimetics, venetoclax combinations, and MDM2 inhibitors. RNA-seq and immunoblot analyses demonstrated that CEBPB overexpression downregulated CASP3, CASP6, BCL2, and TP53 pathway targets (CDKN1A, PMAIP1, BBC3, BMF, TP53), while upregulated MCL1, BCL2A1, and the NF-κB/IL-1/TNF pathway at transcription and/or translation levels. Phenotyping analysis showed that CEBPB overexpression drives myelo/monocytic differentiation. In accordance, CEBPB expression in primary AML correlates with drug responses of idasanutlin, venetoclax, and many venetoclax combinations. Additionally, primary monocytic leukemia expresses significantly higher levels of IL-1/TNF family genes, BCL2A1, and reduced CASP3, CASP6, and BCL2. Abnormal monocytes, but not granulocytes, T cells, or blasts from M4/M5 leukemia, extrinsically protect leukemia blasts from venetoclax and MDM2 inhibition by secreting elevated IL-1 and TNFα. IL-1β/TNFα treatment drove myelo/monocytic differentiation and up-regulated inflammatory cytokines, including an autoregulatory loop, as well as a number of cytokine receptors, such as IL1R1, TNFRSF1R, TNFRSF2R, and CSF2RB. Remarkably, IL-1α/IL-1β and TNFα uniquely upregulated CEBPB expression in M4/M5 cells and protected them from apoptosis induced by venetoclax and MDM2 inhibitors. Conversely, TNFα treatment induced augmented extrinsic apoptosis in M0/M1 leukemia cells. Interestingly, treatment with venetoclax and idasanutlin led to a feedback upregulation of CEBPB, IL-1β, and/or TNFα, along with their respective receptors, and promoted myelomonocytic differentiation. IL-1/TNFα antagonists or an IRAK inhibitor alone did not kill leukemia cells, but they showed synergistic cytotoxicity when combined with venetoclax and idasanutlin. Conclusions: In summary, we have described a positive feedback loop between CEBPB, IL-1/TNFα, and monocytic differentiation in monocytic leukemia that contributes to intrinsic and extrinsic drug resistance against BCL2 and MDM2 inhibitors. This crosstalk and the consequent drug resistance are further reinforced by venetoclax/MDM2 inhibition treatment. Combining venetoclax or idasanutlin with IL-1/TNFα antagonists or an IRAK inhibitor can abrogate the feedback loop and induce synergistic cytotoxic effects, offering promising therapeutic strategies to enhance the treatment efficacy of venetoclax and MDM2 inhibitors for monocytic leukemia.

Prognostic Value and Functional Consequences of Calcium Signalling in Acute Myeloid Leukaemia

Ca 2+ is a ubiquitous second messenger that regulates a large number of cellular functions by acting on various proteins and signaling pathways. Abnormal expression/function of protein involved in Ca 2+ signaling have been associated with oncogenesis. However, its implication in the mechanisms that drive normal hematopoietic cells to leukemic transformation remain largely unknown. In order to identify actors of Ca 2+ signaling of potential prognosis value in acute myeloid leukemia (AML), , we performed a systematic screening on databases and identified expression of STIM2 as negatively correlated with disease free and overall survival while ORAI2 expression presented the opposite pattern. Interestingly, we noticed that ORAI2 and STIM2 expression differed depending on FAB subtypes. Indeed the 50% of patients in the upper quartile of STIM2 expression presented a myelo-monocytic differentiation while monocytic differentiation was associated with a lower ORAI2 expression. On a series of 407 AML patients from the ALFA 07-02 protocol, we observed that higher STIM2 was found in intermediate and high ELN17 while a lower ORAI2 level was seen in ELN17 high-risk patients. We quantified STIM2 and ORAI2 expression in two AML cell lines with monocytic potential, THP1 and OCI-AML3. When cells were driven into monocytic differentiation, we observed at RNA and protein level a decreased ORAI2 expression while STIM2 increased significantly. We then focused our studies on STIM2. To decipher its function in monocytic cell lines, we chose a shRNA-mediated gene knockdown approach. We first measured the capacitive Ca 2+ entry after STIM2 knockdown and found it increased, due to a predominant downregulation of the 2.1 STIM2 isoform, which has a negative effect on Ca 2+ entry, while 2.2 STIM2 isoform was less impacted. We then performed a transcriptomic analysis using the Nanostring technology, and identified a STIM2 signature characterized by dysregulation of genes involved in apoptosis, cell cycle and chromatin modification. Phenotypically, STIM2 knockdown drastically decreased cell proliferation and viability, through activation of the mitochondrial pathway of apoptosis and blockage of cell cycle at the G2/M phase. We observed that STIM2 knockdown led to a genomic stress with DNA double strand breaks as shown by an increased p-ϒH2AX, followed by activation of the p53 pathway, decreased expression of cell cycle regulators such as CDK1-cyclin B1 and the CDC25c phosphatase, and a decreased apoptosis threshold with a low antiapoptotic/proapoptotic protein ratio. Inhibition of p53 using Pifithrin-α reverted apoptosis and cell cycle blockage whereas p-ϒH2AX induction remained high. Moreover, STIM2 knockdown led to p-ϒH2AX activation but neither apoptosis nor cell cycle blockage in the p53-deficient cell line HL60, highlighting the fact that the genomic stress occurred downstream p53 induction in cells after STIM2 knockdown. At last, using in vitro monocytic differentiation of CD34 + cells, we observed a higher STIM2 expression at RNA level in differentiated cells. Acquisition of monocytic markers was faster after STIM2 forced expression, while STIM2 knockdown impaired CD14 expression and led to a p-ϒH2AX, p53 induction, apoptosis and cell cycle blockage in agreement with data observed in leukemic cell lines. In summary, we describe here STIM2, the “forgotten” member of SOCE, as a new actor in the proliferation, survival and differentiation of human normal and malignant monocytic cells. Considering (i) the association of a high STIM2 expression with an adverse prognosis in AML and (ii) the association of STIM2 with AML harboring monocytic/myelomonocytic differentiation, STIM2 may represent an interesting protein to target in these types of leukemia in the future

Correction to ‘The role of transcriptional coactivator TRAP220 in myelomonocytic differentiation’

Genes to CellsEarly View CORRECTIONFree Access Correction to ‘The role of transcriptional coactivator TRAP220 in myelomonocytic differentiation’ This article corrects the following: The role of transcriptional coactivator TRAP220 in myelomonocytic differentiation Norinaga Urahama, Mitsuhiro Ito, Akiko Sada, Kimikazu Yakushijin, Katsuya Yamamoto, Atsuo Okamura, Kentaro Minagawa, Akio Hato, Kazuo Chihara, Robert G. Roeder, Toshimitsu Matsui, Volume 10Issue 12Genes to Cells pages: 1127-1137 First Published online: October 31, 2005 First published: 06 March 2023 https://doi.org/10.1111/gtc.13012AboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinkedInRedditWechat In the original version of Figure 1B, identical images of stained BFU-E cells were erroneously used for wild-type and knockout panels. Representative data from repeated experiments are now provided in corrected Figure 1B. The errors were in presentation only, and do not affect any results or discussion in the article. FIGURE 1BOpen in figure viewerPowerPoint It was also brought to the attention of the journal and the authors that in the original version of Figure 4A there were closely similar Northern blot images. Specifically, GAPDH lanes of 1,25-(OH)2D3-treated cells and background noises in VDH lanes of DMSO-treated cells were similar to GAPDH lanes and SRC-1 lanes of 1,25-(OH)2D3-treated cells in Figure 3, respectively; and TRAP220 lanes of control, TPA-treated and DMSO-treated cells at 0 hr were similar to each other. The authors have provided new versions of the figures as corrected Figure 4A by repeating experiments and measuring by RT-qPCR, a contemporary method that may be more accurate than Northern blot. This correction does not affect the results or conclusions of the work. The authors apologize for these mistakes. FIGURE 4AOpen in figure viewerPowerPoint Method for corrected Figure 4A: HL-60 cells were used to induce differentiation as described. Total RNAs (0.5 μg), isolated by using Isogen II (Toyobo), were used to reverse-transcribe by ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo) in triplicates. Then mRNAs were quantificated by using KOD SYBR qPCR Mix (Toyobo) and StepOnePlus Real-Time PCR System (Thermo Fisher). Values were normalized by the values for GAPDH, and means ± SD of relative values are shown. The sequences of the primers used for qPCR are as the followings: for TRAP220, GGCGGATCTAGCTTCTCCTC and CTTCTCCATGACTTGACGCAC; for VDH, TGCCAGCGATAATACGCCTC and TGGTGCTGACACAGGTGAAG; for CD38, CGCGATGCGTCAAGTACAC and TGCAAGGTACGGTCTGAGTTC; for gp91, ACTGCATGCTGATTCTCTTGC and TTCGAACTCTTGTTGAGCAGC; and for GAPDH, CAGCAAGAGCACAAGAGGAAG and ACATGACAAGGTGCGGCT. REFERENCE Urahama, N., Ito, M., Sada, A., Yakushijin, K., Yamamoto, K., Okamura, A., Minagawa, K., Hato, A., Chihara, K., Roeder, R.G., & Matsui, T. (2005). The role of transcriptional coactivator TRAP220 in myelomonocytic differentiation. Genes to Cells, 10(12), 1127– 1137. https://doi.org/10.1111/j.1365-2443.2005.00906.x Early ViewOnline Version of Record before inclusion in an issue FiguresReferencesRelatedInformation

Comprehensive Transcriptomic Analysis of VISTA in Acute Myeloid Leukemia: Insights into Its Prognostic Value.

The V-domain Ig suppressor of T-cell activation (VISTA) has been recognized as a critical negative regulator of antitumor immune response and is gaining growing interest as a potential pharmacological target in immunotherapy. This molecule is highly expressed in hematopoietic stem cells and myeloid compartment, and it has been found upmodulated in acute myeloid leukemia (AML). However, VISTA-associated immune features are relatively unexplored in myeloid malignancies. Herein, we aimed to explore whether this immune checkpoint regulator could play a role in the generation of an immune escape environment in AML patients. We characterized VISTA mRNA expression levels in leukemia cell lines and in large publicly available cohorts of specimens from bone marrow of healthy individuals and AML patients at diagnosis by deploying bulk and single-cell RNA sequencing. We also defined the correlations with leukemia-associated burden using results of whole-exome sequencing of AML samples at disease onset. We showed that VISTA expression linearly increased across the myeloid differentiation tree in normal hematopoiesis. Accordingly, its transcript was highly enriched in AML cell lines as well as in AML patients at diagnosis presenting with myelomonocytic and monocytic differentiation. A strong correlation was seen with NPM1 mutations regardless of the presence of FLT3 lesions. Furthermore, VISTA expression levels at baseline correlated with disease recurrence in patients with normal karyotype and NPM1 mutations, a subgroup traditionally considered as favorable according to current diagnostic schemes. Indeed, when compared to patients with long-term remission (>5 years after standard chemotherapy regimens), cases relapsing within 2 years from diagnosis had increased VISTA expression in both leukemia and T cells. Our results suggest a rationale for developing VISTA-targeted therapeutic strategies to treat molecularly defined subgroups of AML patients to prevent disease recurrence and treatment resistance.

Proteomic Characterization of Acute Myeloid Leukemia

Introduction: Acute myeloid leukemia (AML) is a disease characterized by the expansion of myeloid blasts in the bone marrow. Recently, we published the results of the first proteogenomic characterization of bone marrow blasts from 177 adult patients with AML (10.1016/j.ccell.2022.02.006) that were uniformly treated with intensive induction chemotherapy. Using mass spectrometry (MS) and next-generation sequencing we curated a multi-omics data set with global protein and gene expression, DNA mutations and chromosomal aberrations. We identified a proteomic subtype characterized by enhanced expression of mitochondrial proteins, significantly poorer overall survival and high sensitivity to inhibitors targeting mitochondrial respiration (Mito-AML). We have now expanded the proteomic data set with bone marrow biopsies from 90 additional adult patients with AML in order to facilitate the proteomic characterization of individual genetic subtypes of AML including nucleophosmin 1 (NPM1)-mutated AML. Methods: We used a label-free (LF), data-independent (DIA) MS-based proteomic workflow to profile protein expression in bone marrow-derived leukemic blasts from 90 additional patients with AML. The patient cohort was similar to our initial cohort with regard to demographic-, disease- and clinical characteristics. We applied stringent filtering, missing value imputation and batch correction to merge the two cohorts. We were able to validate the proteomic Mito-AML subtype in this merged cohort by our previously published machine-learning model. Next, we investigated proteomic differences between NPM1mut (n=89) and NPM1wt (n= 172) patients using linear models; we identified differentially regulated biological processes from the gene ontology (GO) and REACTOME gene sets as well as gene expression signatures of healthy and malignant cellular subtypes (van Galen et al.) using a gene set enrichment analysis (GSEA) and gene set variation analysis (GSVA). Clustering of the NPM1mut proteome was done using a consensus approach on the Euclidean distances and kmeans with k = 2 was chosen based on a set of metrices, including silhouette and concordance score. Results: The global protein expression structure, represented by inter-sample Euclidean distance, was largely independent of blast maturity, genetic risk groups and mutations. In our combined cohort of 267 patients, we identified 33 Mito-AML patients, confirming a frequency of 12 % of this proteomic AML subtype. As published by us previously, Mito-AML showed poor overall survival and independent, significant risk of death in the combined cohort as well as in the 90 patient sub-cohort. Mutations in NPM1 are frequently found in de novo AML and are characterized by a more chemo-sensitive disease. In addition to proteins previously described as being differentially expressed we identified a number of previously unreported proteins including surface proteins (e.g. DmX-like protein 2 (DMXL2)), to be significantly higher expressed in NPM1mut AML. Together with our proteomic data for CD34+ progenitor cells from healthy donors our resource data set might reveal potential target structures for cellular therapies. Among the gene sets differentially enriched between NPM1mut and NPM1wt were terms associated to mitochondrial respiration and metabolism. Interestingly, Mito-AML was enriched among NPM1mut AML (48.5% in NPM1mut vs. 32% in NPM1wt), indicating that Mito-AML is a high-risk subset within NPM1mut AML. Furthermore, we identified regulation of chromosomal and nucleosome architecture amongst the top down-regulated processes in NPM1mut which is in accordance with the role of wild-type NPM1 to chaperone these structural processes. Interestingly, we observed among NPM1mut AML two sub-clusters that were either enriched for blasts with myelo-monocytic differentiation or for progenitor- and stem cell-like blasts indicating a cell-of-origin phenotype. Conclusion: We report the expansion of our previously published proteomic characterization of AML with bone marrow-derived AML blasts from 90 additional patients. We confirm the proteomic Mito-AML subtype and its poor outcome under intensive chemotherapy. We furthermore elucidate the proteomic landscape of NPM1mut AML and identifie two subgroups of NPM1mut AML that are characterized by either myelo-monocytic differentiation or a progenitor and stem cell-like blast state. Figure 1View largeDownload PPTFigure 1View largeDownload PPT Close modal

IL1R1 Expression Predicts the Benefit from Allogeneic Hematopoietic Stem Cell Transplantation in Patients with Acute Myeloid Leukemia and Intermediate-Risk Cytogenetics

Introduction: Acute myeloid leukemia (AML) is a heterogeneous hematological malignancy with variable clinical outcomes depending on baseline patient and disease characteristics. After achieving complete remission (CR) with induction chemotherapy, eligible patients are treated with consolidation chemotherapy or allogeneic hematopoietic stem cell transplantation (HSCT) to prevent relapse. In patients with intermediate-risk cytogenetics (IRC) without adverse-risk mutations, the decision for post-remission therapy is challenging because of the significant risks of morbidity and mortality associated with HSCT which can offset its benefit in preventing relapse. Therefore, novel biomarkers are needed to support the decision to recommend HSCT in first CR (CR1) in patients with IRC AML. Methods: We used the Leucegene AML prognostic cohort composed of patients diagnosed with de novo IRC AML and treated with intensive induction chemotherapy (N = 316) to identify biomarkers that are predictive for the benefit of HSCT in CR1. Whole-transcriptome sequencing was performed on diagnostic patients' samples. Gene expression data was normalized in transcripts per million (TPM) then log transformed and standardized into Z-scores. We used univariable and multivariable Cox proportional hazards (CPH) regression models for overall survival (OS) and relapse-free survival (RFS) to evaluate the association between gene expression and clinical outcomes. For multivariable analyses (MVA), we included age and white blood cell (WBC) count at diagnosis and NPM1, FLT3-ITD, DNMT3A, biallelic CEBPA, ASXL1 and RUNX1 mutations as covariables. To identify genes predictive of the benefit of HSCT in CR1, we evaluated interaction terms between gene expression and HSCT in CR1 as a time-dependent variable (HSCT-TD) in extended CPH regression models for OS and RFS. We dichotomized the expression of genes based on optimal cutoffs for p value and hazard ratio (HR) for OS and RFS while optimizing their clinical utility to predict the benefit of HSCT. Results: We identified IL1R1 as the top gene associated with RFS in MVA and with a significant interaction with HSCT-TD (p < 0.05). Based on an optimal cutoff of 2.0 TPM, 193 (61%) and 123 (39%) patients had low (< 2.0 TPM, IL1R1low) and high (≥ 2.0 TPM, IL1R1high) expression of IL1R1, respectively. Patients with IL1R1high were older (median age 59 years with IL1R1high vs 54 years with IL1R1low, p < 0.01), had a higher WBC count (44 vs 31 x 109/L, p = 0.06), and a higher frequency of myelomonocytic or monocytic differentiation (43% vs 25%, p < 0.01). FLT3-ITD (54% vs 33%, p < 0.01) and RUNX1 (18% vs 9%, p = 0.04) mutations were more frequent in patients with IL1R1high whereas biallelic CEBPA mutations (1% vs 6%, p=0.04) were more frequent in patients with IL1R1low. High expression of IL1R1 was associated with worse clinical outcomes. The CR rate was 74% and 85% in patients with IL1R1high and IL1R1low, respectively (p = 0.02). The 5-year OS rate was 10% in patients with IL1R1high vs 38% in patients with IL1R1low (HR 2.27, p < 0.01). The 5-year cumulative incidence of relapse (CIR) was 17% higher in patients with IL1R1high (76% vs 59%, p < 0.01). In MVA, high expression of IL1R1 was independently associated with OS (HR 1.80, p < 0.01) and RFS (HR 1.81, p < 0.01). HSCT in CR1 significantly improved OS in patients with IL1R1high (HR for HSCT-TD 0.26, p < 0.01), but not in patients with IL1R1low (HR 0.70, p = 0.17). With a 6-month landmark analysis, the 5-year OS rates were 67% vs 27% among patients with IL1R1high and 62% vs 54% among patients with IL1R1low in patients who underwent HSCT in CR1 or not, respectively (Figure 1). Specifically among patients without FLT3-ITD mutations, patients with IL1R1high benefited from HSCT in CR1 (HR 0.41, p = 0.04) whereas patients with IL1R1low did not (HR 1.03, p = 0.92). Among patients who have undergone HSCT in CR1, the 5-year post-HSCT OS was 60% vs 56% in patients with IL1R1high and IL1R1low, respectively (HR 0.85, p = 0.68), confirming that HSCT may abrogate the adverse impact of high IL1R1 expression. Conclusion: In patients with IRC AML, high expression of IL1R1 is independently associated with worse OS and RFS which may be overcome by HSCT in CR1. Among patients without FLT3-ITD mutations who account for ~60% of IRC AML, those with IL1R1high benefit from HSCT in CR1, as opposed to those with IL1R1low. IL1R1 expression may guide the decision to proceed with HSCT in CR1 in these patients. Figure 1View largeDownload PPTFigure 1View largeDownload PPT Close modal

The Menin Inhibitor Ziftomenib (KO-539) Synergizes with Agents Targeting Chromatin Regulation or Apoptosis and Sensitizes AML with MLL Rearrangement or NPM1 Mutation to Venetoclax

MLL1-rearranged (MLL-r) leukemias are dependent on the interaction of the adaptor protein menin with the oncogenic MLL (KMT2A) fusion protein. We previously demonstrated that NPM1 mutant (NPM1mut) acute myeloid leukemias (AMLs) exhibit a similar dependency on the menin interaction with wildtype MLL, a histone 3 lysine 4 methyltransferase. Pharmacologic inhibition of the menin-MLL interaction reverses MEIS1/HOX-driven leukemic gene expression, induces differentiation, and has anti-leukemic activity in preclinical NPM1mut and MLL-r AML models. Ziftomenib is currently assessed in clinical phase I/II trials and explorative efficacy against relapsed / refractory AML has been demonstrated. Here, we characterized the effects of ziftomenib on MLL-r and NPM1mut AML in detail and systematically screened for synergistic drug combination partners. First, we assessed the single-agent effects of ziftomenib on MLL-r (MOLM13, MV411, OCI-AML2) and NPM1mut (OCI-AML3) AML cell lines. Cellular assays demonstrated profound dose-dependent killing after seven days of treatment with IC50 values<25nM. HL60 and NB4 cells that are both wildtype for NPM1 and MLL served as negative controls and were not affected. Similar to previously characterized menin inhibitors (menin-i), ziftomenib uniformly induced transcriptional downregulation of MEIS1, PBX3, FLT3, and BCL2 in these leukemias, while genes upregulated upon ziftomenib were enriched for myelomonocytic differentiation processes. Ziftomenib-induced differentiation was also evidenced by cytology and upregulation of cell surface CD14 and CD11b. To identify synergistic combinations, we designed a screen assessing single and combined effects of ziftomenib and 37 targeted compounds (selected by confirmed preclinical or clinical activity against AML), each at four different concentrations and in a constant 1:4 ratio. We observed significant synergistic effects (combination index<0.5) of ziftomenib in MLL-r and NPM1mut AML, particularly pronounced for agents targeting chromatin regulation & DNA damage (e.g., LSD1, PRMT5, and PARP) as well as apoptosis & cell cycle (e.g. BCL2, MCL1, and CDK4/6). As we have demonstrated with other menin-i, ziftomenib induced transcriptional downregulation of FLT3 in the FLT3-mutant AML setting and also exhibited synergistic activity with the FLT3 inhibitor gilteritinib. As ziftomenib also uniformly downregulated BCL2, we assessed its combination with venetoclax in more detailed response assays and found synergistic growth inhibition compared to single treatment or vehicle control in all tested MLL-r and NPM1mut AMLs. While OCI-AML3 cells are not sensitive to venetoclax, the combination with ziftomenib was synergistic when using prolonged combined agent exposure (5 days) but not with standard 24-48h venetoclax treatment. shRNA-based knockdown of MEN1 (menin) also sensitized MOLM13 to venetoclax. Next, we found by Annexin V staining that the combination enhanced apoptosis compared to single agent treatment. Also, BCL2 homology (BH) 3 profiling revealed that ziftomenib treated MLL-r and NPM1mut AML cells exhibited a significantly enhanced cytochrome c release in response to BIM, PUMA, BAD, and MS1 peptides. These findings suggest that ziftomenib-induced apoptotic priming may contribute to synergistic effects with venetoclax in these leukemias. Next, we assessed the combination in a human MV411-derived leukemic xenograft model in vivo. We found significantly reduced leukemia burden defined by bone marrow engraftment after 14 days of treatment compared to the single agent or vehicle control animals. Single agent and combination assessment of four primary human NPM1mut AML patient samples in a human stroma cell co-culture model also showed the most pronounced anti-leukemic effects for the ziftomenib-venetoclax combination compared to all other controls. In summary, we demonstrated that ziftomenib has significant activity against MLL-r and NPM1mut AML and synergizes with certain agents targeting chromatin regulation and apoptosis. The combination of ziftomenib with venetoclax is particularly synergistic and already available for clinical trial assessment.

Development of a 23-color flow cytometry panel for the characterization of myelomonocytic differentiation with applications for MRD testing.

Abstract It is well agreed that measurable residual disease (MRD) testing in acute leukemia patients following induction chemotherapy has profound prognostic implications. Flow cytometry is well suited to be the mainstay for MRD testing due to the heterogenous immunophenotypic and molecular natures of leukemia. Current flow cytometry MRD testing involves examination of more than 15 antigens, requiring multiple tubes to be run for each patient as current clinical flow cytometers are limited to examining 12 parameters per tube. Because multiple tubes are required, hematopathologists must infer antigen expression between tubes, which can be difficult. As MRD testing has such prognostic implications and defines treatment stratifications and outcomes, MRD testing requires very high sensitivity. While several groups have improved sensitivity by increasing the number of cells analyzed, we propose that increasing the antigenic targets in a single immunophenotyping assay will improve sensitivity by enhancing our ability to differentiate normal from abnormal hematopoietic cells. To test this, we utilized spectral flow cytometry, which allows for targeting more parameters with the same number of lasers for a single instrument. We developed a 23-color flow cytometry panel which was designed to thoroughly examine myelomonocytic differentiation and included multiple other antigenic targets which are known to be aberrantly expressed on leukemia cells. The panel also included a live-dead stain to exclude dead cells from analysis. All data was collected with a 3-laser Cytek Northern Lights spectral flow cytometer, which can analyze 10 million events in ~10 minutes. We tested this panel on more than 50 bone marrow aspirate samples, including normal samples, multiple myeloid leukemias, myelodysplastic samples, as well as more than 20 aspirate samples which also had MRD testing completed at a reference laboratory. Our results for MRD testing had excellent concordance with results from the gold-standard reference laboratory method. As our method only required one tube to be run per sample, we were routinely able to analyze at least 10 million cells per sample. Using in silico modelling from our data, we determined the sensitivity of our assay to be an average of 0.005% (range 0.002 – 0.015%) depending on the specific immunophenotype, when analyzing 10 million cells. As we examined all marker expression in a single tube, we were able to model sensitivity as if only 10-parameters were collected per tube and inference was required between tubes for analysis as is the current standard practice. We found that our 23-color assay was significantly more sensitive (p =0.02) compared to running multiple 10-color tubes and inferring between samples. Overall, higher parameter flow cytometric assays (&amp;gt;20 markers) allow for a more sensitive and robust MRD analysis than current gold-standard methods and should be explored for utilization in the clinical setting.

A Rare Case of Therapy Related Monoblastic Leukemia with t(8;16)(p11.2;p13.3)/KAT6A-CREBBP Fusion and Hemophagocytosis

Abstract Introduction/Objective Therapy related leukemias are often myeloid and occur as a late complication of cytotoxic therapy or radiotherapy. Most common etiologies are alkylating agents and topoisomerase II inhibitors leading to inaccurate base pairing and chromosomal breakages resulting in complex karyotypes. We describe an extremely rare case of therapy related monobalstic leukemia with t(8;16)(p11.2;p13.3)/KAT6A-CREBBP Fusion and hemophagocytosis. Methods/Case Report An 81-year-old female with history of mixed cellularity Hodgkin’s lymphoma status post chemotherapy with AVD (Adriamycin, Vinblastine and Dacarbazine) and in remission presented with a complaint of newly developed skin rash on her chest. Punch biopsy showed a diffuse infiltrate of blastoid mononuclear cells with a component of monocytic differentiation present throughout the dermis. Complete blood count revealed bicytopenia (Hemoglobin 8.4 g/dl, platelets 32 x 109 per liter) and peripheral blood smear examination showed 54% blasts. Bone marrow biopsy was remarkable for infiltration by 79.2% blasts with monocytic differentiation and prominent hemophagocytosis. Immunophenotypic analysis was notable for weak positivity for p53 and a Ki67 proliferation index of 20%. These results led to the diagnosis of monobasic leukemia with hemophagocytosis. Cytogenetic analysis was abnormal with 19 out of 20 metaphases showing t(8;16)(p11.2;p13.3). Interestingly, FISH revealed the rare KAT6A- CREBBP fusion gene. The patient was hospitalized for induction chemotherapy and started on Decitabine. Her hospital course was complicated with acute kidney injury and pulmonary edema with rapid deterioration along with persistent elevation of blasts in the blood. The patient opted for hospice due to lack of improvement and died thereafter. Results (if a Case Study enter NA) NA. Conclusion AML with t(8,16) is an extremely rare entity accounting for 0.2 to 0.4% of AML cases. AML with t(8,16)/KAT6-CREBBP is frequently associated with monocytic or myelomonocytic differentiation, leukemia cutis and hemophagocytosis. While spontaneous remission can occur in a subset of neonatal t(8;16)(p11.2;p13.3), the majority of cases are therapy-related and carry a poor prognosis as seen in our patient.

Recommendations for laboratory testing of UK patients with acute myeloid leukaemia.

Recommendations for laboratory testing of UK patients with acute myeloid leukaemia.

3'CBFB deletion in CBFB-rearranged acute myeloid leukemia retains morphological features associated with inv(16), but patients have higher risk of relapse and may require stem cell transplant.

Fluorescence in situ hybridization analysis (FISH) using a CBFB breakapart probe is widely used to detect CBFB rearrangement (CBFBr) in cases of acute myeloid leukemia (AML). However, detection of 3'CBFB deletion (3'CBFBdel) often poses a challenge for interpretation, and the clinical importance of 3'CBFBdel associated CBFBr remains largely unknown. We identified 16 AML patients with 3'CBFBdel, 11 (69%) of which were confirmed to have CBFB::MYH11 fusion. These 11 patients presented with de novo AML; 10 showed myelomonocytic differentiation, 8 had a prominent eosinophilic component, and 7 showed characteristic eosinophils with basophilic granules. Next generation sequencing showed mutations in 7/8 patients, 5 with KRAS/NRAS, 3 with FLT3-TKD, but none with KIT mutations. Except for one patient who died 5days after diagnosis of AML, all 10 patients received chemotherapy and achieved remission initially. However, within 3years, 5 (50%) patients had relapsed, of whom, 1 died and 4 received hematopoietic stem cell transplant. After a median follow-up of 76months, 3 patients died and 8 were alive in complete remission. Our study shows that detection of 3'CBFBdel is not equivalent to unbalanced CBFB rearrangement, and therefore, an alternative confirmatory test is warranted. AML with 3'CBFBdel/CBFBr often shows similar pathological features to AML with inv(16), but appears to have different mutation profiles and a higher risk of relapse requiring hematopoietic stem cell transplant.

Comprehensive immunophenotypic study of acute myeloid leukemia with KMT2A (MLL) rearrangement in adults: A single-institution experience.

Acute myeloid leukemia (AML) with KMT2A (MLL) rearrangement is known for monocytic or myelomonocytic differentiation, but the full immunophenotypic spectrum and dynamic changes of the immunophenotype in this genetically defined disease have not been systematically studied. We reviewed the immunophenotype, karyotype, and mutations at the time of initial diagnosis and relapse of adults with AML with KMT2A rearrangement in our institution between 2007 and 2020. We identified 102 patients: 44 men and 58 women with a median age of 52 years (range, 18-87). Forty-three patients were considered to be therapy-related. Twenty-four out of 64 patients relapsed from complete remission after induction therapy, 34 had persistent/progressive disease, and 58 patients died with a median overall survival of 17 months. We detected five immunophenotypes: immature monocytic (38%); myelomonocytic (22%); myeloblastic (22%); mature monocytic (10%); and acute promyelocytic (APL)-like (8%). By chromosomal breakpoints, we presumed 11 different partners; t(9;11) (p22;q23)/MLLT3-KMT2A was the most common rearrangement (n=56, 55%), followed by t(6;11) (q27;q23)/AFDN-KMT2A (n=13,13%). Patients with t(6;11) (q27;q23)/AFDN-KMT2A preferentially showed a myeloblastic phenotype (p=0.026). Mutations were detected in 39/64 (61%) cases, and RAS pathway (NRAS/KRAS/PTPN11) was involved in 26/64 (41%) cases. None of the APL-like cases had mutations detected. At the time of disease relapse, 10/24 (42%) showed major immunophenotypic change, and 7/10 cases gained additional cytogenetic and/or molecular alterations. The immunophenotype of AML with KMT2A rearrangement is more diverse than previously recognized, with a substantial subset showing no evidence of monocytic differentiation. Major immunophenotype change is common at the time of relapse.

Single-Cell Transcriptomics Study of Human Hematopoietic Progenitors Reveals Alterations Associated with Aging and Myeloid Malignancies

Hematopoietic stem and progenitor cells (HSPCs) comprise a continuum of cells with varying differentiation potential and priming toward specific lineages. During both healthy aging and myeloid malignancies, changes occur in the composition and regulation of HSPCs. In this study, we evaluated human HSPCs obtained from young and elderly healthy donors using single-cell RNA sequencing to identify the transcriptional and regulatory alterations associated with aging at single cell resolution. We then applied this knowledge to the study of specific perturbations associated with the development of myeloid pathologies.We isolated >90,000 bone marrow CD34+ cells from 5 young (18-20 y/o), 3 elderly (>65 y/o) healthy donors, 1 patient with myelodysplastic syndrome (MDS) and 1 patient with acute myeloid leukemia (AML), using fluorescence-activated cell sorting. scRNA libraries were prepared with the 10X chromium platform and sequenced. Finally, bioinformatic analysis was performed using available R and Python algorithms such as Seurat, Palantir and Scenic.First, we characterized HSPC subpopulations in young donors by unsupervised clustering and manual annotation. Taking the previous findings as reference, we then classified the elderly and pathological HSPC using elastic-net regularization prediction models (Figure 1A).Comparison of subpopulations in young and elderly donors confirmed the age-related increase in HSC, as well as reduction of lymphoid progenitors and myelomonocytic compartments. Next, we performed differential expression and pathways analysis to uncover age-associated alterations in the transcriptional profile of cells with the same identity. We found a generalized enrichment in elderly HSPC of pathways activated upon stress and inflammation, such as p53, hypoxia and TNF alpha response. This suggests an age-related increased response to the more inflammatory microenvironment of elderly individuals. On the other hand, young HSPC were enriched for cell cycle activation and proliferation pathways, as well as metabolic processes (Figure 1B).Using trajectory analysis, we recovered 6 differentiation paths present in our young donor's data. When compared to the elderly, the greatest changes occurred along the monocytic trajectory. For some genes, expression differed through the whole trajectory, indicating the existence of original transcriptional alterations already at the HSC compartment. On the other hand, expression of myelomonocytic differentiation markers, such as MPO and CD74, reached lower levels in our elderly HSPC data, pointing towards a loss of capacity for monocytic differentiation in progenitors from elderly individuals.Finally, to identify key transcription factors regulating the progression of differentiation routes, we built gene regulatory networks. Overall, we found lower activation levels for transcriptional programs in the early progenitors from elderly donors. In addition, gene ontology enrichment analysis showed that the active networks in the young were enriched for differentiation-related terms, while networks from the elderly were not. These results also indicate an age-associated loss of differentiation capability.We then applied the same computational tools to analyze aberrant hematopoiesis in samples from 2 patients suffering from myeloid malignancies (MDS and AML). On one hand, we subjected the MDS sample to trajectory analysis, focusing on the erythroid lineage. We observed perturbations in the expression dynamics of genes playing a role in erythropoiesis. In the AML sample, we encountered a significant expansion of the most immature cell compartments (HSC, LMPP and MEP). In addition, GRN reconstruction showed up the specific activity of transcription programs activated by factors deregulated during leukemia, such as ZSCAN18 and GFI1.In conclusion, our work described the transcriptional alterations that occur in early hematopoiesis, both during healthy aging and myeloid pathology. We used multiple approaches, such as the study cellular proportions, differentiation trajectories and GRNs. The inclusion of samples from patients with myeloid pathology provided insights into the potential role of single-cell technologies for understanding and treating hematological malignancies. [Display omitted] DisclosuresSanchez-Guijo: Gilead: Consultancy, Honoraria; Celgene/Bristol-Myers-Squibb,: Consultancy, Honoraria; Incyte: Consultancy, Honoraria; Pfizer: Consultancy, Honoraria; Takeda: Honoraria, Research Funding; Roche: Consultancy, Honoraria; Amgen: Consultancy, Honoraria; Novartis: Consultancy, Honoraria, Research Funding. Diez-Campelo: Novartis: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding, Speakers Bureau; BMS: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding, Speakers Bureau; Takeda Oncology: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding, Speakers Bureau. Valcarcel: BMS: Consultancy, Honoraria, Speakers Bureau; CELGENE: Consultancy, Honoraria, Speakers Bureau; ASTELLAS: Consultancy, Honoraria, Speakers Bureau; AMGEN: Consultancy, Honoraria, Speakers Bureau; NOVARTIS: Consultancy, Honoraria, Speakers Bureau; TAKEDA: Consultancy, Honoraria, Speakers Bureau; JAZZ: Consultancy, Honoraria, Speakers Bureau; SOBI: Consultancy, Honoraria, Speakers Bureau; SANOFI: Consultancy, Honoraria, Speakers Bureau. Romero: 10X Genomics: Current Employment. Prosper: Janssen: Honoraria; Oryzon: Honoraria; BMS-Celgene: Honoraria, Research Funding.

Single-Cell RNA Sequencing Analysis Reveals Mechanisms of Initiation and Progression in Chronic Myelomonocytic Leukemia

Despite advances in the genetic characterization of chronic myelomonocytic leukemia (CMML), the molecular mechanisms that drive the disease during its distinct phases remain unclear. To uncover vulnerabilities in CMML that could be therapeutically targeted to halt its evolution, we sought to dissect at the single-cell level the cellular and transcriptomic changes that occur in the hematopoietic system at the time of CMML's initiation and its progression after hypomethylating agent (HMA) therapy.To evaluate the molecular mechanisms underlying CMML maintenance, we performed single-cell RNA sequencing (scRNA-seq) analysis of lineage-negative (Lin -)CD34 + hematopoietic stem and progenitor cells (HSPCs) and bone marrow (BM) mononuclear cells (MNCs) isolated from untreated CMML patients (n=5 and 6, respectively) and age-matched healthy donors (HDs; n=2 and 3, respectively). Our integrated analysis revealed that CMML Lin -CD34 + HSPCs had a predominant granulomonocytic differentiation route with an increased frequency of early and committed myeloid-monocytic progenitors at the expense of HSCs and megakaryocyte/erythroid progenitors (Fig. 1a). Differential expression analysis among the clusters revealed that most transcriptomic differences occurred in CMML HSCs, which were characterized by the upregulation of genes involved in oxidative phosphorylation, type I interferon (IFN) and IFNγ response, myeloid development, and inflammatory signaling and had downregulated expression of genes involved in TNFα-mediated NF-κB activation (Fig. 1b). These data suggest that CMML HSCs undergo metabolic reprogramming and demand a higher level of mitochondrial activity to maintain activated monocytic differentiation in response to inflammatory signaling.Consistent with these results, scRNA-seq analysis of MNCs isolated from the same HD and CMML BM samples showed that monocytes were significantly increased at the expense of erythroid precursors and B cells in CMML (Fig. 1c). CMML monocytes had upregulated genes involved in IFNγ response, oxidative phosphorylation, MYC targets, NF-κB activation, and inflammation (e.g., S100A9, CCL3, IL1B). Interestingly, among the anti-apoptotic BCL2 family members, only the NF-κB transcriptional target BCL2A1 was significantly overexpressed.To investigate the mechanisms of resistance to HMA therapy, we performed integrated scRNA-seq analysis of sequential Lin -CD34 + cells and BM MNCs isolated from CMML patients at the time of disease initiation and progression after HMA therapy failure. CMML progression was driven by a significant expansion of lympho-myeloid progenitors (LMPPs) at the expense of earlier HSCs , which exacerbated myelomonocytic differentiation in the HSPC compartment (Fig. 1d). Expanded LMPPs were characterized by higher levels of IFNγ response, NF-κB survival signaling, and cell cycle regulators. Accordingly, scRNA-seq analysis of MNCs cells from the same patients showed significantly increased frequencies of monocytes and a reduction of naïve CD4 +/CD8 + T cells and effector memory CD8 + T cells. Differential expression analysis of the 2 sample groups in the monocyte population identified five different cellular clusters, one of which emerged only at progression (Fig. 1e). This population was characterized by high expression levels of inflammatory cytokines and the anti-apoptotic modulators MCL1 and BCL2A1. Together, these data suggest that CMML progression arises from immature myeloid progenitors at the stem cell level and that downstream monocytes undergo transcriptomic rewiring and acquire survival mechanisms that induce therapy resistance and further accelerate disease progression.In conclusion, our results elucidate the differentiation hierarchies and transcriptional programs associated with CMML's initiation and its progression after HMA therapy. Our data suggest that therapies targeting downstream effectors of NF-kB-mediated survival signaling could overcome treatment failure. [Display omitted] DisclosuresWei: Daiichi Sanko: Research Funding. Kantarjian: AbbVie: Honoraria, Research Funding; Immunogen: Research Funding; KAHR Medical Ltd: Honoraria; Jazz: Research Funding; Ipsen Pharmaceuticals: Honoraria; Astellas Health: Honoraria; NOVA Research: Honoraria; Pfizer: Honoraria, Research Funding; Novartis: Honoraria, Research Funding; Astra Zeneca: Honoraria; Ascentage: Research Funding; Aptitude Health: Honoraria; Daiichi-Sankyo: Research Funding; Amgen: Honoraria, Research Funding; BMS: Research Funding; Precision Biosciences: Honoraria; Taiho Pharmaceutical Canada: Honoraria.

Differential expression and regulation of MS4A family members in myeloid cells in physiological and pathological conditions.

The MS4A gene family encodes 18 tetraspanin‐like proteins, most of which with unknown function. MS4A1 (CD20), MS4A2 (FcεRIβ), MS4A3 (HTm4), and MS4A4A play important roles in immunity, whereas expression and function of other members of the family are unknown. The present investigation was designed to obtain an expression fingerprint of MS4A family members, using bioinformatics analysis of public databases, RT‐PCR, and protein analysis when possible. MS4A3, MS4A4A, MS4A4E, MS4A6A, MS4A7, and MS4A14 were expressed by myeloid cells. MS4A6A and MS4A14 were expressed in circulating monocytes and decreased during monocyte‐to‐Mϕ differentiation in parallel with an increase in MS4A4A expression. Analysis of gene expression regulation revealed a strong induction of MS4A4A, MS4A6A, MS4A7, and MS4A4E by glucocorticoid hormones. Consistently with in vitro findings, MS4A4A and MS4A7 were expressed in tissue Mϕs from COVID‐19 and rheumatoid arthritis patients. Interestingly, MS4A3, selectively expressed in myeloid precursors, was found to be a marker of immature circulating neutrophils, a cellular population associated to COVID‐19 severe disease. The results reported here show that members of the MS4A family are differentially expressed and regulated during myelomonocytic differentiation, and call for assessment of their functional role and value as therapeutic targets.

Long Non Coding RNA BALR2-CDK6 Axis Influences Cell Differentiation and Metabolic Status of Acute Myeloid Leukemia

Purpose: Non-coding RNA (ncRNAs) genes are at least as frequent as protein-coding genes in the human genome; however, our knowledge on their function is still preliminary. Long ncRNAs are arbitrarily defined as transcripts that are over 200 nucleotides in length, and demonstrate great heterogeneity in their molecular mechanisms. Their emerging role as new players in cancer development and therapy response is widely supported by several scientific reports, and we recently found the LncRNA BALR-2 expression significantly correlated with a decreased response to prednisone treatment in B-cell precursor acute lymphoblastic leukemia (Bcp_ALL). Given its association with mixed lineage leukemia (MLL) rearrangements in Bcp-ALL, we investigated BALR-2 involvement in acute myeloid leukemia (AML) leukemogenic pathways.Methods: We retrospectively analyzed by RQ-PCR bone marrow samples of 132 children with de novo AML harboring different genetic abnormalities (CBF,MLL, and NUP98 rearrangements, FLT3-ITD , other rare translocations and patients without any recurrent molecular abnormality) diagnosed between 2002-2014 in one of the AIEOP centers and treated according to AML-2002/01 protocol. We correlated the expression of BALR-2 with patient event-free survival (EFS) and gene expression profile (GEP, HTA affymetrix 2.0). Using gene set and single sample enrichment analysis (GSEA, ssGSEA), we compared the gene expression signatures of patients with either high (4th quartile) or low expression (1st+2nd+3rd quartiles) of BALR-2. SHI-1 cell line was used to perform in vitro experiments aimed at examining the function of BALR2.Results: The expression of BALR-2 was found higher in all AML samples as compared with those collected from healthy volunteers. Moreover, we did not find any correlation between BALR-2 expression and any specific genetic abnormality. We subdivided patients by using BALR-2 expression quartiles and found that that patients with higher BALR-2 expression (4th quartile, n=32) had worse, although not statistically significant, EFS when compared to that of patients allocated to the 1st+2nd+3rd quartiles (n=100; EFS= 53% versus 61%). We discovered that the 4th quartile was enriched for patients who did not reach complete remission (CR) after induction therapy (28% vs 12%, p=0.03). Supervised clustering analyses of GEP performed in 58 samples showed that cases belonging to the 4th quartile (n=18) clustered separately from the remaining quartiles (n=40), irrespectively of the underlining genetic abnormality shown by these patients. In particular, we found that 57 coding and 12 non-coding RNAs were significantly differentially expressed (Fold Change|2|, p<0.01), and CDK6 , being chromosomally adjacent to BALR2, was overexpressed in the 4th quartile. We further investigated this putative BALR2-CDK6 relationship and found a positive correlation between BALR-2 and CDK6 expression in the whole cohort analyzed (Pearson correlation>0.7, p<0.05). We silenced BALR-2 in vitro and found this induces lower CDK6 mRNA and protein levels, as well as phospho-RB, its direct target. In line with what seen in Bcp-ALL, BALR2-CDK6 knockdown decreased cell proliferation, increased apoptosis, and sensitivity to etoposide treatment. Of note, BALR-2 depletion increased myelomonocytic differentiation, as evidenced by CD11 and PU.1 markers, both of which are Runt-related transcription factor (RUNX1 ) targets. In agreement with studies demonstrating that CDK6 acts as RUNX1 inhibitor, we found that additional 81 RUNX1 target genes showed marked down-regulation in patients with high BALR-2-CDK6 expression. Through ssGSEA, an aberrant regulation of processes regulating mitochondrial mass and activity was found in patients with the 4th quartile of BALR-2 expression (p<0.05).Conclusions: Taken together, our data suggest that BALR-2 expression is associated with worse outcome in AML. Furthermore, our data suggest a cis-regulatory transcriptional relationship between BALR-2 and CDK6, which, in turn, antagonizes RUNX1 and enhances myeloid differentiation. Lastly, in vitro approaches are ongoing to define the mitochondrial signaling events involved in BALR-2's ability to alter the metabolic status in AML, which in turn could lead to novel approaches for inducing anti-leukemic effects. DisclosuresNo relevant conflicts of interest to declare.

C/EBP\u03b2 is a MYB- and p300-cooperating pro-leukemogenic factor and promising drug target in acute myeloid leukemia

Transcription factor MYB has recently emerged as a promising drug target for the treatment of acute myeloid leukemia (AML). Here, we have characterized a group of natural sesquiterpene lactones (STLs), previously shown to suppress MYB activity, for their potential to decrease AML cell proliferation. Unlike what was initially thought, these compounds inhibit MYB indirectly via its cooperation partner C/EBPβ. C/EBPβ-inhibitory STLs affect the expression of a large number of MYB-regulated genes, suggesting that the cooperation of MYB and C/EBPβ broadly shapes the transcriptional program of AML cells. We show that expression of GFI1, a direct MYB target gene, is controlled cooperatively by MYB, C/EBPβ, and co-activator p300, and is down-regulated by C/EBPβ-inhibitory STLs, exemplifying that they target the activity of composite MYB-C/EBPβ-p300 transcriptional modules. Ectopic expression of GFI1, a zinc-finger protein that is required for the maintenance of hematopoietic stem and progenitor cells, partially abrogated STL-induced myelomonocytic differentiation, implicating GFI1 as a relevant target of C/EBPβ-inhibitory STLs. Overall, our data identify C/EBPβ as a pro-leukemogenic factor in AML and suggest that targeting of C/EBPβ may have therapeutic potential against AML.