Mycelial Discs Research Articles

First Report of Sclerotinia sclerotiorum Causing Hibiscus rosa-sinensis Stem Rot in Guangxi, China.

Hibiscus rosa-sinensis, native to the south of China, is currently planted as an important landscaping tree species in more than 100 countries around the world. Since 2012, an unknown stem rot disease of H. rosa-sinensis has occurred sporadically in a few green belts of Nanning, Guangxi, China. In February 2023, the incidence rate of the disease in the southern part of the city (108°38'E, 22°77'N) reached 5-8%. The pathogen mainly infected the stems near the soil line and aboveground stems. Initially, brown spots appeared and developed into long strips of large spots around the stem, slightly sunken. Later, the diseased tissue cortex presented longitudinal cracks and the vascular bundle tissue was exposed like silk hemp. White mycelium appeared on the diseased stem surfaces under high humidity conditions, eventually maturing into hard black sclerotia (1.5 to 11.0 mm in length). The leaves turned yellow and the whole plant finally died. For fungal isolation, seven diseased plants distributed within 800 square meters were collected, and 35 symptomatic stem sections were surface disinfect with alcohol for 30s, 0.08% NaClO for 1 min, triple rinsed with sterile distilled water, and cultured in potato dextrose agar (PDA) medium at 28℃. Sclerotinia-like colonies were consistently isolated from all diseased tissues and four isolates (Z1-Z4) were purified (Bolton et al. 2006). Irregular white immature sclerotia were produced after 5 to 7 days on the edges of the plates and turned black after 7 to 14 days, with a size of 1.8 to 4.6 × 1.2 to 3.4 mm (avg. 3.3 × 2.4 mm, n = 20). For molecular characterization, three gene regions (ITS, CaM and Mcm7) were amplified (White et al. 1990; Carbone et al. 1999; Schmitt et al. 2009) and sequenced (GenBank accession nos.: ITS: OR016764 to OR016767; CaM: OR257811 to OR257814; Mcm7: OR345318 to OR345321). The sequences of three analyzed DNA fragments shared 100% identity with sequences of Sclerotinia sclerotiorum strains (accession nos. JN013184, AF341304, KF545468). To fullfill Koch's postulates, healthy H. rosa-sinensis nursery stocks at the six months stage were individually planted in plastic pots at 25±3℃. The base of the stem and upper three branches of each plant were wounded with a sterile needle and inoculated with 5-mm discs of mycelium grown on PDA, then the inoculation sites of stem bases were covered with one layer nursery substrate and those of branches were wrapped with transparent tape to maintain the humidity. Three plants were inoculated with each isolate. As a control, three plants were inoculated with PDA discs. All the inoculated plants with mycelial discs developed characteristic symptoms 5 to 8 days after inoculation. The inoculation sites appeared white mycelium and the leaves sagged and wilted. Later, black sclerotia appeared on the diseased stem and the whole plant withered, while the control plants remained symptomless. Fungal cultures reisolated from symptomatic plants were morphologically identical with the cultures used as inoculum. Sclerotinia sclerotiorum has only been reported from H. rosa-sinensis in Taiwan (Tai 1979). The pathogen is a widely distributed fungus, causing many economically important diseases on various plants (Hossain et al. 2023). To our knowledge, this is the first report of S. sclerotiorum causing H. rosa-sinensis stem rot in Chinese Mainland, laying the foundation for monitoring its occurrence and spread.

First Report of Fruit Rot Caused by Fusarium incarnatum-equiseti species complex on Greenhouse Bell Pepper in Malaysia.

In Malaysia, bell pepper (Capsicum annuum var. grossum), also known as sweet pepper or paprika, is one of the highly imported vegetable crops. In 2021 alone, Malaysia imported nearly 74 thousand metric tons of its chilies, including bell peppers, from other countries (DOSM, 2022). Often, farmers grow the bell peppers in moderate to cool conditions within highland regions for local commercial purposes. In June 2022, the Malaysian Agricultural Research and Development Institute (MARDI) in Serdang, Selangor, conducted a research study to grow lowland bell peppers under a glasshouse rain protection system. A disease inspection carried out found fruit rot on approximately 30% of mature bell pepper fruits in the greenhouse. Symptoms appeared as firm and sunken black lesions covered with white to light pink spore masses on the outer surface, which eventually fell off. Infected fruit parts were disinfected with 10% hypochlorite (NaOCl) for 2 min, followed by double washing with sterile distilled water, air-dried, and placed onto potato dextrose agar (PDA). After 3 days of incubation, the fungal colonies that grew from the symptomatic tissue pieces were transferred onto new PDA to obtain pure cultures. The pure fungal colony appeared dense, whitish aerial mycelium that slowly became cream to pinkish-orange after 7 days of incubation at room temperature (25±2 °C). To examine the morphology features, the pure cultures were subbed onto carnation leaf agar (CLA) and incubated at 25±2°C for 14 days. Macroconidia were abundant, slightly curved with tapered apical cells, 3- to 5-septate, and ranged between 21.8 and 34.0 x 3.0 and 5.1 μm. Microconidia were single-celled, often 1-septate, and ranged between 10.0 and 12.6 x 2.1 and 3.4 μm. Chlamydospores were globose and in chains. The fungus was identified as Fusarium sp. according to Fusarium key by Leslie and Summerell (2006). PCR amplification and DNA sequencing were performed using primers EF1F/EF2R and ITS1/ITS4 (O'Donnell et al., 1998; White et al., 1990) to amplify the partial elongation factor 1-alpha (TEF1-α) gene and internal transcribed spacer region (ITS), respectively. The TEF1-α and ITS sequences of this isolate were deposited in GenBank as OQ672911 and OR349657. BLAST analysis with TEF1-α gene sequences revealed 99.74% and 99.33% sequence identity with F. pernambucanum (accession no. ON330424) and Fusarium isolate NRRL 25134 (accession no. JF740755), respectively; both belonged to the Fusarium incarnatum-equiseti species complex (FIESC). BLAST search of the TEF1-α sequence in the database of the International Mycological Association (www.mycobank.org) showed 99.18% identity with FIESC (NRRL 36548). The ITS sequences were 100% identical to those of F. incarnatum (MT563420, MT563419, and MT563418). Pathogenicity test was conducted on three unwounded and three wounded mature red bell pepper fruits (SP299 Red Masta variety). Two healthy bell peppers were used as controls for each treatment. Prior to inoculation, the fruits were surface-sterilized by dipping in 70% ethanol and rinsed twice with sterile distilled water. Unwounded fruits were inoculated with fungal mycelium disks (5 mm diameter), whereas control fruits were inoculated with sterile PDA agar disks. For wound method, 6 µl of spore suspension (1x106 spores/ml) was obtained from 7-day-old cultures and injected (1 mm depth) into the fruit wall using a sterile syringe needle. Control fruits were inoculated with sterile distilled water only. Each fruit was inoculated with the inoculum at three distinct spots and kept in a humid chamber at a temperature of 25±2 °C. The pathogenicity test was done twice. Five days post-inoculation, the control fruits showed no symptoms, whereas all inoculated wounded and non-wounded fruits developed necrotic lesions with white mycelium growing on the inoculation points. The pathogen was successfully re-isolated from the infected fruits and morphologically identified as FIESC, fulfilling Kochs postulates. It has been reported previously that the members of FIESC are responsible for the fruit rot of bell peppers under greenhouse conditions (Ramdial et al., 2016). To the best of our knowledge, this is the first report of FIESC causing fruit rot on greenhouse bell peppers in Malaysia. This fruit rot disease may impose significant constraints on bell pepper production in Malaysia; hence, effective strategies to control the pathogen and prevent disease dispersal should be implemented.

Fungitoxic effect and phytochemical characteristics of Brazilian Cerrado weeds against Rhizoctonia solani and Macrophomina phaseolina fungi.

The use of natural products obtained from plants, for example, invasive plants, offers a variety of allelochemicals with fungicidal potential. With this in perspective, the objective was to evaluate the fungicidal potential of ethanolic extracts of Cerrado plants on Rhizoctonia solani and Macrophomina phaseolina. The ethanolic hydroalcoholic extract of the 12 plants identified as invaders in the Brazilian Cerrado was prepared (Anacardium humile Saint Hill; Baccharis dracunculifolia DC.; Cenchrus echinatus L; Commelina erecta L.; Erigeron bonariensis L.; Digitaria horizontalis Willd.; Digitaria insularis L.; Porophyllum ruderale Jacq. Cass; Richardia brasiliensis Gomes; Sida rhombifolia L.; Turnera ulmifolia L.; Smilax fluminensis Steud)) and phytochemical screening and determination of total phenols and flavonoids were performed. To evaluate the in vitro antifungal activity, the hydroalcoholic solutions at concentrations of 800, 1200, 1600, 2000, and 2400 µL 100 mL-1 were separately incorporated into BDA agar and poured into Petri dishes, followed by the mycelium disk of the fungus. As a control, two solutions were prepared, one ethanolic solution added to the BDA medium (2400 µg 100 mL-1) and the other with BDA medium only. They were poured into Petri dishes, followed by a 0.5 cm diameter disk of mycelium of the fungus, incubated (23±2 ºC), with a 24-hour photoperiod. Among the constituents found in the plants, 75% are phenolic compounds, 58.3% are cardiotonic heterosides, 50% are steroids, 33.3% are flavonoids, 16.7% are anthraquinones, and 8.3% are alkaloids, saponins, and reducing sugars. Out of the 12 species, only the extracts of C. erecta and R. brasiliensis were active for M. phaseolina and R. solani. Thus, it is concluded that the ethanolic extract of C. erecta has the fungicidal potential to control diseases caused by fungi that are soil inhabitants. Of the other species, A. humille, B. dracuncufolia, D. insulares, C. erecta, D. insulares, P. ruderale, and R. brasiliensis have natural fungitoxic potential because they stand out in the content of polyphenols efficient in reducing the mycelial growth of M. phaseolina and R. solani.

Response surface optimization of cellulase production by Aspergillus stellatus NFCCI 5299 in shake flask submerged fermentation using wheat bran.

The expense of cellulase enzymes is the main barrier to the enzymatic saccharification of biomass. Numerous tactics, such as the utilizing inexpensive lignocellulosic substrates as well as economically feasible fermentation techniques for the production of the enzyme may reduce the cost of cellulases. The present investigation was aimed to improve cellulase production employing potential cellulolytic soil fungi, Aspergillus stellatus NFCCI 5299 using wheat bran as substrate. Employing response surface methodology (RSM) with central composite design (CCD), the most efficient process parameters were determined. The ideal conditions for the synthesis of carboxy methyl cellulase (CMCase) and filter paper cellulase activity (FPase) were 6days of incubation, inoculum size of 4 mycelial disc, 125rpm of agitation, and 3.5% of wheat bran. The significant mycelial development and enzymatic digestion of wheat bran were discovered by scanning electron microscopy (SEM) and fourier transform infrared (FTIR) analysis. The findings suggested that it can be practicable to use wheat bran as substrate under submerged fermentation utilizing Aspergillusstellatus NFCCI 5299 for efficient cellulase production.

First report of Sclerotinia sclerotiorum causing Sclerotinia wilt of hop (Humulus lupulus) in Poland.

The common hop (Humulus lupulus L., Cannabaceae) is a perennial plant cultivated in the temperate climate zone and used in the brewing and pharmaceutical industry. In June 2021, symptoms of wilting and subsequent drying of shoots were observed on hop plants (cv. Lubelski) in Lubelskie Province, in Poland (50°55'30.5"N, 22°10'35.4"E). Wilted shoots showed no symptoms of chlorosis. Usually both healthy and wilted shoots were present on the same plant. Approx. 20% of the plants in the 2 hectare hop garden showed these symptoms. An inspection of the underground parts of the infected shoots revealed a brown necrosis of the tissues partly covered by white mycelium with black sclerotia. These symptoms were characteristic for Sclerotinia sclerotiorum (Lib.) de Bary (Bolton et al. 2006), but this pathogen has never been detected in hop gardens in Poland before. In order to confirm the preliminary diagnosis, shoots from five different plants with symptoms of necrosis were collected, disinfected with 1% sodium hypochlorite for 1 min, rinsed with sterile water and dried. Twelve fragments from partially necrotized tissue were placed on potato dextrose agar (PDA) amended with chlortetracycline hydrochloride. After three days of incubation at room temperature and daylight, 75% of the explants had white or light grey mycelia present. Pure cultures were obtained by transplanting mycelium to fresh PDA. Within 4 days, the mycelium has reached the diameter of Petri dishes (90 mm). On PDA at room temperature and daylight, black spherical or cylindrical sclerotia formed after 6-14 days. Sclerotial size was 1.0 to 10.0 x 1.0 to 5.0 mm (average 2.8 x 2.0 mm; n = 57 from 3 plates). Five isolates were subjected to DNA extraction. Then ITS region was amplified and sequenced using primers ITS1/ITS4 (White et al. 1990). The sequences obtained from the five fungal isolates were identical with each other and BLAST analysis revealed also 100% identity with the GenBank records of S. sclerotiorum (e.g. KT224645, Baturo-Ciesniewska et al. 2017). One representative sequence of isolate Ss5HL was deposited to GenBank (OQ998981). Pathogenicity of the isolate Ss5HL was confirmed in inoculation tests on approx. 30 cm high, young shoots of hop plants (cv. Lubelski) grown from rootstock for 4 weeks in the greenhouse. Five plants were inoculated by placing mycelial discs from a 7-day-old culture on shoots and covering them with wet sterilized cotton pads and aluminum foil. Two control plants were treated in the same way but instead of mycelial discs pure agar discs were placed on the shoots. Then plants were kept in a climate chamber (80% relative humidity, 15-h light at 22°C, 9-h dark at 18°C). All fungal inoculated shoots wilted within 3-4 days, then necrosis developed and spread from the place of inoculation up the shoot. No tissue necrosis was observed below the place of inoculation. The control plants remained asymptomatic. The inoculation test was carried out twice with the same result. Fungal cultures reisolated from the inoculated shoots were morphologically identical with the culture used as inoculum. Isolate Ss5HL was deposited in the collection of the Westerdijk Fungal Biodiversity Institute (CBS 150077).To our knowledge, this is the first case of Sclerotinia wilt of hops in Poland and also in Europe, with the exception of one, nearly 100 years old report from the United Kingdom (Salmon and Ware 1936). S. sclerotiorum rarely occurs on hop but it can cause severe yield reduction if pathogen accumulates in the soil.

First Report of Diaporthe tulliensis Causing Necrotic Spots and Leaf Blight on Rambutan in Puerto Rico.

Rambutan (Nepehelium lappaceum) is a tropical exotic fruit belonging to the Sapindaceae family. Several pathogens have been identified in rambutan causing different diseases on fruits, inflorescences, and branches (Serrato-Diaz et al., 2015, 2017, 2020) but few on leaves. From 2015 to 2021, a disease survey was conducted in one greenhouse in Mayaguez, Puerto Rico and experimental rambutan field orchards of the USDA-ARS Tropical Agriculture Research Station located at Isabela, Corozal, Santa Isabel, and Adjuntas, Puerto Rico (Latitude: 18°12'28"N, 18°34'10'' N, 18°00'47''N, 18°16'35''N and Longitude: 67°08'17"W, 66°31'74'' W, 66°38'98''W, 66°72'32''W, respectively). Varieties Benjai, Gula Batu, Jitlee, R-134, R-156Y, R-162, R-167 and Rongren were sampled. Necrotic spots and leaf blight were commonly observed with a disease incidence of 80%. Diseased leaves showed necrosis starting from the apex and spreading through the lamina. Ten diseased leaves were collected from each location and sections of symptomatic tissue (5mm2) were disinfected and plated on potato dextrose agar (PDA) and oatmeal agar (OA). Two representative isolates of Diaporthe tulliensis, A3 and A4, were obtained, purified, and identified morphologically and by PCR amplifications of three nuclear genes of the Internal Transcribed Spacer ITS1-5.8S-ITS2 region of the ribosomal DNA primers ITS5/ITS4, portions of the β tubulin (BT) primers Bt2a/Bt2b and the translation elongation factor 1-α (TEF1-α) primers EF1728F/EF1986R. On PDA and OA colonies of isolates A3 and A4 were initially white and flat with sparse mycelia that turned yellowish-white to grey with age. Pycnidia were black with cream to pale yellow conidial droplets that exuded from ostioles. Hyaline, unicellular alpha conidia were oval to cylindrical, rounded at apex and obconically truncate at base. Alpha conidia (n = 50) for isolates of D. tulliensis were 4.9 to 5.9 μm long by 2.2 - 2.5 μm wide. DNA sequences of the ITS region and partial sequences of TEF1-α and BT genes were compared by BLASTN with Diaporthe sequences deposited in GenBank. ITS, BT and EF1-α sequences of isolates A3 and A4 (OP219651 and OP161553 for ITS region; OP222137 and OP168832 for TEF1-α; OP222136 and OP168831 for BT, respectively) were grouped to the holotype BRIP 62248a (Bootstrap BS=100) of Diaporthe tulliensis R.G. Shivas, Vawdrey & Y.P. Tan. Pathogenicity tests were conducted on six of six-months-old rambutan seedlings of R-167 variety. Three unwounded healthy non-detached leaves were inoculated per isolate with one 5mm mycelial disk from pure cultures grown on PDA. Rambutan seedlings were kept in a humid chamber using plastic bags for 8 days under greenhouse conditions. Two of six seedlings were used as controls and inoculated with PDA disks only. Eight and 14 days after inoculation (DAI), D. tulliensis isolates caused necrotic spots and leaf blight, on leaves. Diseased leaves turned from light to dark brown starting from the apex and spreading through the lamina with necrotic lesions ranging in size from 5 - 10 mm. Untreated controls showed no symptoms, and no fungi were re-isolated from tissue. D. tulliensis was re-isolated from diseased leaves, fulfilling Koch's postulates. D. tulliensis has been reported in Taiwan causing Diaporthe leaf spot in Boston Ivy (Huang, C. et al., 2021) and Bodhi trees (Li, K.Y. et al., 2022), as well as Jasmin stem canker (Ching Hsu, C. et al., 2022). It has been reported as causing leaf blight of coffee (Gong, J. L., et al., 2019), kiwifruit stem canker in China (Bai et al., 2017), and most recently causing cacao pod rot in Puerto Rico (Serrato-Diaz, L.M. et al., 2022). To our knowledge, this is the first report of Diaporthe tulliensis causing necrotic spots and leaf light on rambutan in Puerto Rico and often associated with a potassium deficiency in many parts of the world. It will be important to establish an adequate and effective control management of this disease in rambutan producing countries worldwide. References and doi hyperlinks: 1. Huang, C. et al. Plant Dis. 105:2718, 2021 https://doi.org/10.1094/PDIS-12-20-2652-PDN 2. Li, K.Y. et al. Plant Dis. 0:ja, 2022 https://doi.org/10.1094/PDIS-01-22-0211-PDN 3. Ching Hsu, C. et al. Plant Dis. 0:ja, 2022 https://doi.org/10.1094/PDIS-09-21-1908-PDN 4. Gong, J. L., et al. Plant Dis. 104:570, 2019 https://doi.org/10.1094/PDIS-09-19-1833-PDN 5. Bai et al. Plant Dis. 101:508, 2017 https://doi.org/10.1094/PDIS-10-16-1445-PDN 6. Serrato-Diaz L.M., et al. 2015. Plant Dis. 99: 1187. https://doi.org/10.1094/PDIS-09-14-0923-PDN 7. Serrato-Diaz L.M. et al. 2017. Plant Dis. 101: 1043. https://doi.org/10.1094/PDIS-11-16-1557-PDN 8. Serrato-Diaz, L.M., et al. 2020. Plant Dis. 104: 105-115. https://doi.org/10.1094/PDIS-02-19-0295-RE 9. Serrato-Diaz, L.M. et al. 2022 Plant Dis. 106: 2530. https://doi.org/10.1094/PDIS-12-21-2634-PDN.

Essential Oils in the Control of Fusarium solani

Fusarium solani is a soil pathogen and causes disease in several economically important crops. The development of research with essential oils is important. These present a diversity of active substances, with fungicidal properties. This study aimed to evaluate the effect of essential oils from Copaifera reticulata, Cymbopogon nardus, Origanum majorana, Allium sativum, Rosmarinus officinalis, Piper nigrum and Cymbopogon citratus on Fusarium solani. The oils were extracted using the technique of steam dragging, in a Clevenger apparatus. In Petri dishes containing essential oils and PDA medium, a fungal mycelium disc was added. After seven days, the mycelial growth, germination and sporulation of the fungus were evaluated. The essential oils of C. nardus, C. citratus and A. sativum were more efficient in controlling F. solani.

Evaluation of Lacc134 Oxidoreductase of Ganoderma multistipitatum in Detoxification of Dye Wastewater under Different Nutritional Conditions

In the present study, we investigated the effects of different carbon sources (glucose, sucrose, and maltose) on laccase production from mycelium of Ganoderma multistipitatum grown on malt extract agar plates. The preliminary screening test was performed on the guaiacol plate, where a maroon brown zone formed after laccase oxidation. A few pure mycelial discs of Ganoderma species were transferred into submerged fermentation nutrient broth. The nutrient medium of submerged fermentation at 20 g of glucose revealed the highest laccase activities (2300 U/L) than other carbon sources. The interesting results also shown by inorganic NaNO3 in the production of maximum laccase (7800 ± 1.1 U/L). The organic nitrogen inducer, namely yeast extract, exhibited 5834 U/L laccase activity and a potential source of laccase secretion. The results concluded that C and N inducers enhanced the laccase production. This production process is eco-friendly and effective in the removal of dye from water. Laccase from the cultural broth was partially purified by SDS-PAGE for molecular weight determination, while Native-PAGE confirmed the laccase band after staining with guaiacol. The Km and Vmax values of Lacc134 were 1.658 mm and 2.452 mM min−1, respectively. The Lacc134 of this study effectively removed the Remazol Brilliant Blue R (RBBR) dye (extensively used in textile industries and wastewater). For dye removal capacity, 2.0 mg, 4.0 mg, 5.0 mg, and 6.0 mg were used, from which 6.0 mg was most effective in removal (85% and 88%) dye concentration in 1st and 2nd h interval treatment, respectively. Total organic carbon (TOC) quantity after dye removal percentage in the first- and second-hour time interval was 62% and 89%, respectively, at 30 g glucose. According to the experimental finding of this study, the breakdown products catalyzed by Lacc134 are less hazardous due to lower molecular weight than the dye itself.

Occurrence of Postharvest Fruit Rot of Mango Caused by Fusarium pernambucanum in China.

Mango (Mangifera indica L.) is one of the most important tropical fruits in the world, thanks to its pleasant taste, aroma and high nutritional value (Ibarra et al. 2015). In June 2021, Surveys were conducted in three agricultural markets (113°36'E, 23°11'N) of the Yuancun district in Guangzhou, China. Postharvest fruit rot was observed on mango (about 25% of the fruits showed disease symptoms). Black rot symptomatic lesions were observed on the fruit surface and eventually penetrated the mesocarp of mango fruits. To isolate and identify the pathogen, fruits (n=35) were surface disinfected with 1% NaOCl (1 min), 70% ethanol (30 s) and then washed twice with sterile distilled water. Thirty small pieces (3-5 mm2) were excised from the lesion margins. The excised tissue pieces were cultured on potato dextrose agar (PDA). Pure cultures were obtained by transferring hyphal tips onto fresh PDA. Fungal isolates XTM-5 and XTM-8 were isolated from diseased fruits. All isolates grown on PDA had abundant, fluffy, whitish to yellowish aerial mycelia, and the colony reverse was pale brown. Macroconidia were falcate, slightly curved with 5-7 septa, 29.5-42.2 × 4.3-6.2 μm. Spindle-shaped mesoconidia were abundantly produced, straight to slightly curved with 3-4 septa, 20.3-24.5 × 4.6-4.8 μm. Microconidia were pyriform to obovate with 0-2 septa, 7.3-11.7 × 2.4-3.2 μm. Chlamydospores were globose or irregular, in chains and, hyaline to light brown. Based on the morphological characteristics, the fungus was tentatively identified as Fusarium pernambucanum (Santos et al. 2019). The molecular identity of the isolates was confirmed by sequencing the internal transcribed spacer (ITS), translation elongation factor 1 alpha (TEF1) and RNA polymerase subunit II gene region (RPB2) genes (White et al. 1990; O'Donnell et al. 2022). Sequences of isolate XTM-8 were deposited in GenBank (ITS: ON413679.1, TEF1:ON420221.2, RPB2: ON420222.2). A maximum-likelihood phylogenetic tree based on the concatenated sequences confirmed the isolates as F. pernambucanum (Xia et al. 2019). A pathogenicity test was conducted on mango. Six healthy fruits were inoculated with F. pernambucanum mycelial discs (5 mm in diameter) after being wounded with a needle or unwounded, six control fruits were inoculated with PDA agar. All inoculated fruits were incubated in the dark at 26°C and 95% relative humidity for 7 days post inoculation. Control fruits remained asymptomatic, whereas inoculated fruit developed symptoms on the fruit surface at the point of inoculation. The pathogenicity test was performed three times. The original isolates were confirmed morphologically and molecularly after they were reisolated from the symptomatic fruit, thus confirming Koch's postulates. F. pernambucanum is a widespread pathogen that causes diseases across a wide range of plant hosts in China, such as muskmelon fruit rot (Zhang et al. 2022); mango leaf spots (Guo et al. 2021) and plum leaf blight (Lu et al. 2022). To our knowledge, this is the first report of F. pernambucanum causing fruit rot of mango in China. As mango contamination with Fusarium mycotoxins poses a health risk for consumers, the occurrence of this disease needs to be carefully monitored to ensure effective disease management strategies are implemented in mango production.

First Report of Epicoccum latusicollum Causing Leaf Spot Disease on Banana in China.

Banana (Musa acuminata) is one of the most important fruit crops in the world. In June 2020, a leaf spot disease was detected on M. acuminata (AAA Cavendish cv. Williams B6) in a commercial plantation (∼1.2 ha), Nanning, Guangxi province, China. The disease occurred on ~30% of plants. The first symptoms were round or irregular dark brown spots on the leaf surface, which progressively expanded into large, suborbicular or irregular-shaped dark brown necrotic areas. Finally, the lesions coalesced and resulted in leaf abscission. Fragments of tissues (~5 mm) were cut from six symptomatic leaves, surface disinfected (2 min in 1% NaOCl, and rinsed three times in sterile water), and incubated on potato dextrose agar (PDA) at 28°C for 3 days. The hyphal tips from emerging colonies were transferred onto fresh PDA plates to obtain pure cultures. From the 23 isolates, 19 exhibited similar morphology. The colonies on PDA and Oatmeal agar (OA) were villose, dense, white to grey. NaOH spot test resulted in a dark green discolouration on malt extract agar (MEA) cultures. After 15 days of incubation, pycnidia were observed, which were dark, spherical or flat spherical, 67.1 to 173.1 µm (n = 64) in diameter. Conidia were oval mostly, aseptate, hyaline, guttulate, 4.1 to 6.3 × 1.6 to 2.8 µm (n = 72). Morphological features were similar to Epicoccum latusicollum (Chen et al. 2017, Qi et al. 2021). The internal transcribed spacer (ITS), the partial 28S large subunit rDNA (LSU), beta-tubulin (TUB), and RNA polymerase II second largest subunit (RPB2) genes of the three representative isolates (GX128.6.3, GX132.14.1, GX140.4.3) were amplified and sequenced using the primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), TUB2-Ep-F/TUB2-Ep-R (GTTCACCTTCAAACCGGTCAATG/AAGTTGTCGGGACGGAAGAGCTG), and RPB2-Ep-F/RPB2-Ep-R (GGTCTTGTGTGCCCCGCTGAGAC/TCGGGTGACATGACAATCATGGC), respectively. The ITS (OL614830-32), LSU (OL739128-30), TUB (OL739131-33), and RPB2 (OL630965-67) sequences were 99% (478/479, 478/479, and 478/479 bp), 99% (881/882, 867/868, and 877/878 bp), 99 to 100% (332/333, 333/333, and 333/333 bp), and 100% (556/556, 559/559, and 555/555 bp) identical to those of the ex-type E. latusicollum LC5181 (KY742101, KY742255, KY742343, KY742174) (Chen et al. 2017). A phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular data, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on 1.5 months old banana plants (cv. Williams B6) were stab-wounded using a needle and inoculated with either mycelial discs (5 mm) or aliquots of 10 μl conidial suspension (106 conidia/ml). Three leaves on each of six plants were inoculated. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free PDA discs or sterile water served as controls. All plants were incubated in a greenhouse at 28°C (12-h photoperiod, 80% humidity). After seven days, leaf spot appeared on the inoculated leaves. No symptoms were detected on controls. The experiments were repeated three times showed similar results. To fulfill Koch's postulates, the Epicoccum isolates were consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing. To our knowledge, this is the first report of E. latusicollum causing leaf spot on banana in China. This study may provide the basis for control of the disease.

First Report of Epicoccum latusicollum Causing Leaf Blight on Curcuma kwangsiensis in China.

Curcuma kwangsiensis S. G. Lee et C. F. Liang is a traditional Chinese medicinal plant distributed in Guangxi and Yunnan Province, China. In May 2021, a leaf blight disease on C. kwangsiensi was observed in a plantation (~ 2 ha) in Lingshan county (21°51'00″N, 108°44'00″E), Guangxi Province. Disease incidence was up to 30% (n = 200). Initially, yellow to brown, irregular, water-soaked spots appeared at the tips or margins of leaves. As the disease progressed, the lesions gradually enlarged, merged. Finally, the entire leaf wilted, leading to defoliation. To isolate the pathogen, eighteen small pieces ( ~ 5 mm2) were cut from the margin of the necrotic lesions, surface disinfected with 1% NaOCl solution for 2 min, and rinsed three times in sterile water. Then the tissues were plated onto potato dextrose agar (PDA) and incubated for 3 days at 28°C. Hyphal tips from recently germinated spores were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which ten isolates with similar morphological characterization. Two single-spore isolates (CK45.1 and CK45.2) were subjected to further morphological and molecular characterization. Colonies on PDA were villose, had a dense growth of aerial mycelia, and appeared white to grayish eventually. Pycnidia were brown, predominantly spheroidal, and 45.0 to 205.4 μm in diameter (n = 60). Conidia were ellipsoidal, aseptate, and 3.8 to 6.1 × 1.8 to 3.6 μm (n = 90). Morphological characteristics are similar to those of Epicoccum latusicollum (Chen et al. 2017).For molecular identification, primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), RPB2-Ep-F (GGTCTTGTGTGCCCCGCTGAGAC)/RPB2-Ep-R TCGGGTGACATGACAATCATGGC), and TUB2-Ep-F (GTTCACCTTCAAACCGGTCAATG)/TUB2-Ep-R (AAGTTGTCGGGACGGAAGAGCTG) were used to amplify the internal transcribed spacer (ITS), partial nuclear large subunit rDNA (LSU), RNA polymerase II second largest subunit (rpb2), and β-tubulin (tub2) genes, respectively. The obtained ITS (OP788080-81), LSU (OP811325-26), rpb2 (OP811267-68) and tub2 (OP811269-70) sequences showed 99.8% (478/479, and 478/479 bp), 99.9% (881/882, and 870/871 bp), 99.8 to 100% (429/431, and 429/430 bp), and 99.7% (332/333, and 332/333 bp) identity with those of ex-type strain E. latusicollum CGMCC 3.18346 (KY742101, KY742255, KY742174, KY742343). In addition, a phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular characteristics, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on nine plants (1 leaf per plant) were inoculated with mycelial discs from 5-day-old water-agar medium (WA) cultures of the strain CK45.1. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free WA discs served as control. Plants were covered with transparent plastic bags and maintained in a greenhouse at 25°C with a 12 h photoperiod. Six days post-inoculation, the inoculated sites of leaves showed brown lesions, while the control remained healthy. The experiments repeated three times showed similar results. Koch's postulates were fulfilled by re-isolation of E. latusicollum from the lesions. To our knowledge, this is the first report of E. latusicollum causing leaf blight of C. kwangsiensi in China. This report might provide important information for growers to manage this disease.

In Vitro Compatibility of Entomopathogenic Fungi Beauveria Bassiana (Bals.) Vuill. with Different Fungicides

Beauveria bassiana (Balsamo) Vuillemin is one of the entomopathogenic fungi used against broad host insects and plant pathogens. Fungicides have side effects on entomopathogenic fungi. In vitro assay was performed to examine the compatibility of B. bassiana with eight commonly used fungicides (Azoxystrobin 75 g/l+Metalaxyl-m 37.5 g/l+ Fludioxonil 12.5 g/l FS, Boscalid 25%+ Pyraclostrobin 12% WG, Copper Hydroxide 361.1 g/l SC, Azoxystrobin 250 g/l SC, Triticonazole 80 g/l + Pyraclostrobin 40 g/l FS, Fludioxonil 12.5 g/l + Metalaxyl 10 g/l SC, Captan 50% WP, Tebuconazole 250 g/l EC) using contact application technique. Fungicides at various concentrations (Recommend Dose-RD, half of the Recommend Dose-0.5 x RD and twice the Recommend Dose-2 x RD) were mixed in Potato Dextrose Agar (PDA) media post-autoclaving. Approximately 25 ml of the mixture was poured into a Petri dish (90 mm) and allowed to cool. Mycelium disc (5 mm in diameter) was taken from 14-days-old B. bassiana grown on PDA using a sterile cork borer and placed in the center of each Petri dish containing fungicide + PDA. PDA plates without fungicide were used as a control. Petri dishes were incubated in the dark at 25±1 °C for 14 days. In vitro experiments were carried out with three replicates depending on a completely randomized plots design. In the study, the compatible fungicide with B. bassiana ET 10 isolate was found to be Copper Hydroxide at 0.5 x RD concentration. Azoxystrobin and Copper Hydroxide were compatible with Bb 18 isolate. Only two (Azoxystrobin + Metalaxyl-m + Fludioxonil and Tebuconazole) of the eight fungicides completely inhibited the mycelial growth of ET 10 isolate and were found harmful. Azoxystrobin + Metalaxyl-m + Fludioxonil completely inhibited the growth of Bb 18 isolate and was not found compatible. This study clearly shows that fungicides have the potential to inhibit the mycelial growth of entomopathogenic fungi under in vitro conditions. However, these results need to be further verified in vitro under both greenhouse and open-field conditions.

First report of Lasiodiplodia iraniensis causing crown rot on banana fruits in Brazil.

Banana is a fruit of great importance in Brazil and crown rot cause considerable damage and losses (Ploetz et al. 2003). The disease is associated with fungal complexes, especially the Lasiodiplodia theobromae sensu lato (Kamel et al. 2016; Renganathan et al. 2020; Waliullah et al. 2022). Three asymptomatic bunches of banana cv. 'Prata Catarina' were collected in Russas, Brazil (04°58'11.6"S, 38°01'44.5"W), in 2017. The samples were disinfected (NaClO, 200 ppm), and incubated in a moist chamber at 28 °C, with 12 h light/12 h dark for 3 days. With the appearance of the symptoms (32% of severity), the isolation was conducted in potato dextrose agar (PDA). A monosporic culture (BAN14) was obtained from a typical crown rot lesion, which was subjected to morphological characterization, showing abundant aerial mycelium of olivaceous grey color on the surface and greenish grey on the back (Rayner 1970) in PDA after 15 days at 28 °C. The growth rate was 28.2 mm. day-1. The fungus produced pycnidia and conidia on water agar medium containing pine needles, with 3-4 weeks at 28 °C, presenting conidia initially aseptate, subglobose to subcylindrical, becoming pigmented with 1-central transverse septum and longitudinal striations 23.5 (18.7) 26.0 x 12.7 (9.7) 14.8 µm (n=50). Paraphyses, hyaline, cylindrical, thin-walled, apparently coenocytic with rounded apex, with length and width dimensions of 34 (43.8) 53.2 x 2.1 (2.5) 3.2 µm (n=30). Conidiophore absent, conidiogenous cells hyaline, smooth and with thin walls. The genomic DNA was extracted and amplified by PCR with primers TEF1-688F/TEF1-1251R, ITS1/ITS4, and Bt2a/Bt2b, and sequenced in both directions (O'Donnell et al. 1998; O'Donnell et al. 2010) (GenBank accession ON975017 [TEF1], ON986403 [TUB2], and ON921398 [ITS]). BLASTn analysis of TEF1, TUB2 and ITS sequences in NCBI database showed 99 to 100% nucleotide identity to a representative isolate of Lasiodiplodia iraniensis (IRAN921). Phylogenetic analysis using maximum parsimony based on the combined TEF1, TUB2 and ITS sequences indicated that the BAN14 formed a supported clade (82% bootstrap value) to L. iraniensis. The pathogenicity was evaluated in 20 banana fruit cv. 'Prata Catarina', at the point of harvest. For inoculation, the bananas were washed with water and soap, and disinfected with NaClO (200 ppm). Posteriorly, two wounds were made on the extremities of the fruits, in which were deposited mycelial discs of 5 mm in diameter, with 7 days of the growth on PDA. After inoculation, the fruits were incubated in plastic boxes in a wet chamber at 25 °C, with 12 h light/12 h dark for 5 days. The control fruits were not inoculated with the pathogen, only with PDA discs. The experiments were repeat twice. The BAN14 isolate was pathogenic to the banana cv. 'Prata Catarina'. The BAN14 was grouped with the species L. iraniensis described by Abdollahzadeh et al. (2010) in Iran. This species is distributed in Asia, South and North America, Australia, and Africa. In Brazil it was reported in association to Anacardium occidentale, Annona muricata, A. squamosa, Annona ×cherimola-squamosa, Citrus sp., Eucalyptus sp., Jatropha curcas, Mangifera indica, Manihot esculenta, Nopalea cochenillifera, Vitis sp. and V. vinifera. Until the moment, there is not description of the relation between banana crown rot and L. iraniensis (Farr and Rossman 2022). Our work is the first report on the pathogenicity of this species on banana fruit cv. 'Prata Catarina' worldwide.

First report of Colletotrichum siamense as a causal agent of anthracnose on wax apple (Syzygium samarangense) in China.

Wax apple (Syzygium samarangense) is an important fruit tree widely cultivated in China. Yield losses are usually serious due to different diseases among which anthracnose (Colletotrichum spp.) is one of the most damaging (He et al, 2019). This disease was found in Yunnan, China and an average incidence of 56.7% diseased leaves was recorded in21 orchards surveyed in July2021. The disease lesions on leaves were circular, angular or oval (7.2-15.6 mm), with whitish center and brown outer area surrounded by a yellow halo; irregular spots or blight areas formed later. It can also infect fruits forming pale-brown, circular and sunken spots before harvest and rot of stored fruits. Diseased leaves were sampled from orchards in Ximeng (N117.78oE39.89o) and Ninger (E101.04oN23.05o) counties of Yunnan for fungal isolation; three and five pure isolates were recovered from Ximeng (LWTJ1-LWTJ3) and Ninger (LB4-LB8) samples, respectively, by plating disinfested tissue (surface-sterilized with 2% NaClO3) on potato dextrose agar (PDA) followed by hyphal tip purification and incubation at 25oC. Two repeated tests following Koch's postulates were conducted to verify pathogenicity of the eight isolates. In each test, three healthy seedlings per isolate were sprayed with conidia suspenson (2.26×105cfu/mL) until runoff from leaves while control plants were sprayed with sterile water. The plants were kept in the dark at RH100 for 24 h in a black box and then in a growth chamber (28oC, RH>90% and lighting 12h/d). Detached fruits were inoculated with mycelial discs on the puncture-wound surface. Anthracnose symptoms developed on all seedlings and fruits inoculated with LWTJ2 or LB4 isolates, which were re-isolated from lesions of inoculated leaf/fruit, completing Koch's postulates. Control plants were healthy and symptomless. LWTJ2 and LB4 isolates were morphologically the same: the colonies on PDA were circular, pale-white, with cottony surface and readily forming orange conidium masses. The hyphae were hyaline, septate, branched mostly in near right angles. The conidia were hyaline, one-celled, smooth-walled, cylindrical with round ends, 9.8-17.5 (av.13.8) μm×4.4-6.5 (5.6) μm. The teleomorph was not observed in culture or on orchard trees. The morphological characters were consistent with those of C. siamense described by Weir et al (2012). The internal transcribed spacer region (ITS) was amplified from the two isolates by PCR and sequenced (1990) and were 545 bp in length (OL963924 & OL413460). BLAST analysis showed that both were 100% identical and they shared 99.08% identity with C. siamense WZ-365 from the ITS region (MN856443).The Tub2 (788 bp, ON637119) and Cal (768 bp, ON622249) genes (Weir et al, 2012) of LB4 were also obtained and they shared closest identity (99.45% & 100%) with those of C. siamense WZ-365 as well. Phylogenetic tree (neighbor-joining) analysis of the concatenated sequence of ITS, Tub2 and Cal genes of LB4 and those of related Colletotrichum spp. showed that LB4 clustered IN the same end-branch with C. siamense ICMP18578 (Bootstrap sup. = 98%). Thus, C. siamense was identified as the pathogen of wax apple anthracnose in Yunnan. It caused anthracnose on other crops as oranges and cacao (Azad et al, 2020). Also, C. fructicola and C. syzygicola were identified as pathogens of wax apple anthracnose in Thailand (Al-Obaidi et al, 2017). To our knowledge, this is the first report of C. siamense causing wax apple anthracnose in China.

First report of Fusarium oxysporum causing stem spots on Polygonatum odoratum in China.

First report of Fusarium oxysporum causing stem spots on Polygonatum odoratum in China.

Evaluation of Partial Substitution of Cocoyam Starch as Alternative Gelling Agent in Culture Media for Cultivation of Fungi

Aim: In view of high cost of agar in Nigeria, the study evaluated the suitability of cocoyam starch and cocoyam starch-agar blends as alternative gelling agents in mycological culture media. Methodology: Media characteristics and ability of the media to support growth and sporulation of the test fungi A. niger and A. flavus were determined using standard procedures. Potato dextrose agar (PDA) served as the control medium. Results: Addition of cocoyam starch to the media did not significantly affect media clarity, viscosity, and ease of pouring. Media in which cocoyam starch made up 57% or less of the gelling agent solidified while those with higher contents of starch were either semi solid or watery. Mean radial growth ranges were 75.00 ± 0.70 – 84.00 ± 1.00 mm and 77.50 ± 0.50 – 86.50 ± 0.50 mm for A. niger and A. flavus respectively. Cocoyam starch-agar blend (4:3) medium produced significantly higher mean radial growth (84.00 ± 1.00 mm and 86.00 ± 0.50 mm for A. niger and A. flavus respectively) than all the other treatments (P = .05). Mean spore counts per mycelial disc of the various media ranged from 8.6×103 to 9.3×103 for A. niger and 7.9×103 to 9.5×103 for A. flavus. Though both fungi sporulated well on all the media, the PDA medium and the 2 g of cocoyam starch + 4 g of agar medium had significantly higher mean spore counts compared to the other media. Conclusion: The findings show that cocoyam starch can partially substitute agar as gelling agent in mycological culture media.

Morphological and molecular characterization of Lasiodiplodia theobromae associated with leaf spot and blight disease of Coscinium fenestratum (Gaertn.) Colebr.-a new host record from India.

Coscinium fenestratum is a medicinally significant critically endangered plant found in Western Ghats of India. The leaf spot and blight was observed in Kerala during 2021 with disease incidence of 40% in 20 assessed plants in 0.6hectare. The associated fungus was isolated on potato dextrose agar medium. A total of six morpho-culturally identical isolates were isolated and morphologically identified. Based on morpho-cultural features, the fungus was identified at genus level as Lasiodiplodia sp., which was further authentically confirmed as Lasiodiplodia theobromae by molecular identification with a representative isolate (KFRIMCC 089) using multigene (ITS, LSU, SSU, TEF1-α, and TUB2) sequence analysis and concatenated phylogenetic analysis (ITS-TEF1-α-TUB2). Pathogenicity tests were also assessed in vitro and in vivo using mycelial disc and spore suspension of L. theobromae, and the isolated fungus's pathogenic behaviour was confirmed after re-isolation and morpho-cultural features. Literature survey reveals that there are no reports of L. theobromae on C. fenestratum from all over the world. Hence, C. fenestratum is being firstly reported as a new host record for L. theobromae from India.

Post-harvest Anthracnose of Carambola (Averrhoa carambola) Caused by Colletotrichum fructicola in China.

Carambola (star fruit), a popular fruit of Averrhoa carambola in many parts of the world, is considered to have many beneficial nutritional and medicinal effects (Lakmal, K., et al,2021). In March 2020, anthracnose disease was observed on carambola (about 15% of the fruit showed similar symptoms) in multiple local agricultural markets (113°36'E, 23°11'N) of the Yuancun district in Guangzhou, China. Initial symptoms of infected fruit samples appeared as water-soaked, brown lesions. As the disease progressed, numerous acervuli appeared on fruit surfaces. Salmon-colored spore masses were observed on some fruit. To isolate and identify the pathogen, small pieces (3-5 mm2) were excised from the lesion margins of the fruit, which were surface disinfested by 1% NaOCl (60 s), 70% ethanol (30 s) and then washed twice with sterile distilled water. After surface disinfestation, the tissues were cultured on potato dextrose agar (PDA). Pure cultures were obtained by transferring hyphal tips onto fresh PDA. Fungal isolates (YT-5/6/9) were obtained and the strain YT-5 was selected for further study. The colony of strain YT-5 grown on PDA for 7 days appeared to be cottony, white to pale gray with the presence of multiple masses of conidia. Conidia 13.5-20 × 4.8-6.5 μm (n = 50), hyaline, aseptate, straight and cylindrical with rounded ends. Perithecia were thick-walled and globose with a prominent, narrow neck. Asci 37.1-60.2 × 7.1-11.3 μm (n = 25), 4-8 spored, clavate to cymbiform. Ascospores 7.1-17.2 × 4.5-6.5 μm (n = 35), hyaline, large guttulate at the center, slightly curved with rounded ends. Based on the morphological characteristics, the strain was identified as Colletotrichum fructicola (Prihastuti et al. 2009). The molecular identity of the isolates was confirmed by sequencing the internal transcribed spacer (ITS) rDNA region, chitin synthase (CHS-1), actin (ACT), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and beta-tubulin (TUB2) genes (Prihastuti et al. 2009, Weir et al. 2012). BLASTN analysis of isolate YT-5 sequences, which were deposited in GenBank (ON428449, ON462353, ON886225, ON886224, ON462354) showed 100% identity with those of Colletotrichum fructicola (MW513778.1, MT918417.1, MW426526.1, MN525875.1, MT941526.1), respectively. A phylogenetic tree analysis based on the concatenated sequences confirmed the isolate YT-5 as C. fructicola. Pathogenicity tests were conducted on fresh fruit of carambola with the isolate YT-5. Healthy fruit was surface disinfested and inoculated with 5 mm mycelial discs of the strain YT-5 after being wounded with a needle or unwounded. Control fruit was inoculated with sterilized PDA plugs. All inoculated fruit was incubated at 26°C for 10 days post inoculation. Control fruit remained asymptomatic, whereas inoculated fruit developed symptomatic at the point of inoculation. The pathogenicity test was performed in duplicate. The pathogenic isolate of C. fructicola was successfully re-isolated on PDA from the symptomatic fruit, thus confirming Koch's postulates. C. fructicola has also been reported as a dominant and aggressive causal agent of anthracnose on sandy pear and avocado in China (Zhang et al. 2015; Li et al. 2022). To our knowledge, this is the first study to isolate and characterize C. fructicola causing carambola anthracnose and evaluate its pathogenicity in China, which will provide a better strategy for accurate diagnosis and effective management of anthracnose disease on carambola.

First Report of Neoscytalidium dimidiatum Causing Stem Canker of Dragon fruit (Hylocereus spp.) in India.

Dragon fruit (Hylocereus spp.) is a tropical perennial plant (Family Cactaceae) that is popular for consumption in India. Originated from Central and South America and currently became popular in India. Hylocereus undatus and H. polyrhizus are the most commonly cultivated species in India. During August to December, 2021, stem cankers were observed in commercial orchards within the Satara, Pune and Solapur districts of Maharashtra. The disease incidence across four orchards was approx. 40% and severity ranged between 30 and 80%. Initial symptoms on infected cladodes were minute, circular, depressed chlorotic spots often with a brick red flecks followed by elevation of the centre of the lesion. Later the lesions turned necrotic and contained black, erumpent pycnidia, followed by chlorosis and stem rot. Twelve diseased cladodes from different orchards were collected and isolations were conducted. Edges of the lesions (5 to10 mm2) were excised and surface sterilized by exposure to 1% sodium hypochlorite (2 min) followed by triple rinsing with sterilized distilled water. Excess moisture was removed with sterilized blotter paper and pieces were plated on potato dextrose agar (PDA) amended with streptomycin sulphate (30 mg/L) for 3 days at 27 ± 2°C with a 12 h photoperiod. All twelve isolation attempts yielded uniform fungal colonies and out of these, purified colonies from each location viz., SLNeo, LNeo, MGNeo and KNeo were selected for etiology study. On PDA, initially white mycelial colonies turned to olive green to grayish with dark gray to black pigmentation. Colony growth was rapid (30 mm/day). Brown, branched septate hyphae fragmented to produce abundant arthroconidia in chains that were hyaline to dark brown, thick walled, 0 to 1 septate, ellipsoid to ovoid (10.1 ± 1.4 × 4.88 ± 1.1 μm), rod (9.0 ± 0.8 μm × 5.3 ± 0.8 μm), round (7.9 ± 1.6 μm) and capsule (14.2 ± 3.1 × 6.1 ± 0.8 μm) shape. Conidia from pycnidia developed on host tissues were aseptate, hyaline and ellipsoid-cylindrical (8.2 ± 0.8 × 2.2 ± 0.3 μm) in shape. Based on morphological characteristics, the isolates were identified as Neoscytalidium dimidiatum (Penz.) Crous & Slippers (Crous et al. 2006). Molecular characterization was done by amplifying the partial internal transcribed spacer (ITS) region, and translation elongation factor 1-α and β-tubulin genes of four isolates using ITS1/ITS4, EF1-728F/EF1-986R and BT2A/BT2B primers (White et al. 1990, Glass and Donaldson 1995, Carbone and Kohn 1999). Sequences were deposited in GenBank accesions (ITS: OM884028, OM884029, OM884030, OM899800; TUB2: OM927962, OM927963, ON099066; TEF1-α: OM927965, OM927966, OM927964, OM984744) showed 99 to 100% identity with the epitype CBS 499.66 accession numbers KF531820 for ITS and KF531798 for TEF1-α and KF531800 for TUB2. N. dimidiatum isolate designated as SLNeo has been deposited at Microbial Type Culture Collection (MTCC), Chandigarh, India with MTCC 13250. Phylogenetic analysis using maximum likelihood (ML) revealed these isolates were clustered with N. dimidiatum clade. To evaluate pathogenicity, stems of one year old dragon fruit plants were wounded with a sterilized needle and inoculated with 7 mm fresh mycelial discs. For each isolate three replications were kept. Non-inoculated controls were plants receiving only non-colonized PDA discs. Inoculated and control plants were kept separately at ambient temperature (35 ± 2°C during day and 22 ± 2°C at night). Symptom started to develop at 2 days after inoculation (DAI) and canker lesions with chlorotic halos and rotting were observed at 15 DAI. No symptoms were observed on the negative control. Pathogenicity testing was repeated twice and the pathogen was re-isolated from symptomatic tissues with 100% re-isolation frequency and found identical with N. dimidiatum. N. dimidiatum has been reported on H. undatus and H. polyrhizus in subtropical and tropical countries worldwide (Chuang et al. 2012; Ezra et al. 2013; Lan et al. 2012; Sanahuja et al. 2016; Serrato-Diaz and Goenaga 2021). To our knowledge, this is the first report of dragon fruit stem canker caused by N. dimidiatum from India. Since the disease poses a major threat to dragon fruit plantations, additional epidemiological studies may assist in developing management strategies.

First report of Aspergillus niger causing fruit rot of bilimbi in Malaysia.

In July 2019 to November 2021, symptoms of fruit rot of Averrhoa bilimbi (commonly known as bilimbi) fruits were observed in Serdang (3°00'05.8"N 101°42'18.4"E) and Tanjong Karang (3°25'55.3"N 101°12'55.7"E), Selangor, Malaysia. External decay showed some yellowish to brownish-red discoloration and inside the fruit there was black powdery sporulation and a brownish decay that measured between 8 - 15 mm wide. Twenty random symptomatic fruits were collected from each location. Small pieces (5 mm) of infected tissues from the fruit rot were surface sterilized for 1 min in 0.5% NaOCl, washed twice with sterile distilled water and cultured onto potato dextrose agar (PDA) and peptone pentachloronitrobenzene agar (PPA). The plates were incubated at 28 ± 1oC under 12 hours light/dark for 7 days. The fungal colonies growing from the plates were purified using hyphal tip technique (Leyronas et al. 2012). A total of 42 fungal isolates were obtained, and the morphology characteristics of six isolates were matched that of Aspergillus niger. The A. niger isolates were further identified based genus and species-specific Internal Transcribed Spacer (ITS) sequencing. Primers ITS1/ITS4, were used to amplify and subsequently sequenced the ITS1-5.8S-ITS2 region (White et al. 1990). Primer ASAP1 (5'-CAGCGAGTACATCACCTTGG-3'), ASAP2 (5'-CCATTGTTGAAAGTTTTAACTGATT-3') was used for Aspergillus species confirmation, primer ASPU (5'-ACTACCGATTGAATGGCTCG-3') / Ni1r (5'-ACGCTTTCAGACAGTGTTCG-3') for A. niger species-specific, ASPU / Af3r (5'-CATACTTTCAGAACAGCGTTCA-3') for A. fumigatus specific-specific and ASPU / Fl2r (5'-TTCACTAGATCAGACAGAGT-3') for A. flavus specific-specific (Sugita et al. 2004). In general, Aspergillus niger isolates grew rapidly on PDA and were visibly white initially then appearing black and powdery on the second day of incubation (Figure 1A). Some isolates grew rapidly (0.71-0.85 cm/day) and have a cottony appearance. The conidia were appeared brown to black, globose and rough with diameter ranging between 4.1-5.2 µm (Figure 1B). The vesicles were hyaline, globose, and brown in color with measurement of 30-75 µm in diameter with uniseriate sterigmata (Figure 1C). The conidial head was brownish black in color and split into several irregular and regular columns of conidial chains (Figure 1D-E). The conidiophores were hyaline, and brown in color. Phylogenetic trees of ITS (Figure 2A) and ASAP sequences (Figure 2B) were constructed using a Neighbor-Joining method showing isolates Aspergillus niger #11, #15, #32, #33, #41 and #42 were grouped into the same clade as A. niger (accession no. MT446087). To examine virulence of A. niger, pathogenicity tests were performed three times by inoculating an asymptomatic fruit with six isolates of A. niger (isolate #11, #15, #32, #33, #41 and #42) and a single isolate for each species of Aspergillus aculeatus, Lasiodiplodia theobromae and Penicillium gerundense. Ten fruits were inoculated by placing a mycelial disc (6 mm) (Kouame et al. 2010) from a 5-day-old culture of each fungal colony while control fruits were non-inoculated with any fungal colony (10 fruits were inoculated with a sterile agar disc and 10 were non-inoculated, respectively). After 3 days, typical symptoms of Aspergillus fruit rot were observed on A. niger inoculated fruits, whereas the control fruits remained asymptomatic (Figure 1F-P). Aspergillus niger was reisolated and reidentified based on morphological and molecular characterization from the inoculated, symptomatic fruits, thus confirming Koch's postulates. A. niger causing widespread diseases in various plant and it is a common contaminant of food. This study shows A. niger to be highly virulent on bilimbi fruits and leads to reduction of fruit quality and its production. To our knowledge, this is the first report of A. niger causing fruit rot on bilimbi and future work on its pathogenesis may provide strategies for disease control against the pathogen.