SOX10 Mutations Research Articles

Generation of a heterozygous SOX10 knockout human embryonic stem cell line using CRISPR/Cas9 technology

SOX10 is one of the master transcription factors in neural crest development. Human SOX10 mutations are associated with Waardenburg syndrome type 4 (Waardenburg-Shah, WS4), which can be inherited in both autosomal dominant and recessive patterns. Here, the human embryonic stem cell (hESC) line, H9, was used to generate a heterozygous SOX10 knockout cell line as the in vitro model of WS4 by CRISPR/Cas9-mediated gene targeting. This cell line may represent a valuable tool for uncovering the pathogenesis of WS4.

SOX10 ablation severely impairs the generation of postmigratory neural crest from human pluripotent stem cells

Animal studies have indicated that SOX10 is one of the key transcription factors regulating the proliferation, migration and differentiation of multipotent neural crest (NC), and mutation of SOX10 in humans may lead to type 4 Waardenburg syndrome (WS). However, the exact role of SOX10 in human NC development and the underlying molecular mechanisms of SOX10-related human diseases remain poorly understood due to the lack of appropriate human model systems. In this study, we successfully generated SOX10-knockout human induced pluripotent stem cells (SOX10−/− hiPSCs) by the CRISPR-Cas9 gene editing tool. We found that loss of SOX10 significantly inhibited the generation of p75highHNK1+/CD49D+ postmigratory neural crest stem cells (NCSCs) and upregulated the cell apoptosis rate during NC commitment from hiPSCs. Moreover, we discovered that both the neuronal and glial differentiation capacities of SOX10−/− NCSCs were severely compromised. Intriguingly, we showed that SOX10−/− hiPSCs generated markedly more TFAP2C+nonneural ectoderm cells (NNE) than control hiPSCs during neural crest differentiation. Our results indicate that SOX10 is crucial for the transition of premigratory cells to migrating NC and is vital for NC survival. Taken together, these results provide new insights into the function of SOX10 in human NC development, and the SOX10-knockout hiPSC lines may serve as a valuable cell model to study the pathogenesis of SOX10-related human neurocristopathies.

Direct Interaction of Sox10 With Cadherin-19 Mediates Early Sacral Neural Crest Cell Migration: Implications for Enteric Nervous System Development Defects

The enteric nervous system, which regulates many gastrointestinal functions, is derived from neural crest cells (NCCs). Defective NCC migration during embryonic development may lead to enteric neuropathies such as Hirschsprung's disease (hindgut aganglionosis). Sox10 is known to be essential for cell migration but downstream molecular events regulating early NCC migration have not been fully elucidated. This study aimed to determine how Sox10 regulates migration of sacral NCCs toward the hindgut using Dominant megacolon mice, an animal model of Hirschsprung's disease with a Sox10 mutation. We used the following: time-lapse live cell imaging to determine the migration defects of mutant sacral NCCs; genome-wide microarrays, site-directed mutagenesis, and whole embryo culture to identify Sox10 targets; and liquid chromatography and tandem mass spectrometry to ascertain downstream effectors of Sox10. Sacral NCCs exhibited retarded migration to the distal hindgut in Sox10-null embryos with simultaneous down-regulated expression of cadherin-19 (Cdh19). Sox10 was found to bind directly to the Cdh19 promoter. Cdh19 knockdown resulted in retarded sacral NCC migration invitro and exvivo, whereas re-expression of Cdh19 partially rescued the retarded migration of mutant sacral NCCs invitro. Cdh19 formed cadherin-catenin complexes, which then bound to filamentous actin of the cytoskeleton during cell migration. Cdh19 is a direct target of Sox10 during early sacral NCC migration toward the hindgut and forms cadherin-catenin complexes which interact with the cytoskeleton in migrating cells. Elucidation of this novel molecular pathway helps to provide insights into the pathogenesis of enteric nervous system developmental defects.

A Model of Waardenburg Syndrome Using Patient-Derived iPSCs With a SOX10 Mutation Displays Compromised Maturation and Function of the Neural Crest That Involves Inner Ear Development.

Waardenburg syndrome (WS) is an autosomal dominant inherited disorder that is characterized by sensorineural hearing loss and abnormal pigmentation. SOX10 is one of its main pathogenicity genes. The generation of patient-specific induced pluripotent stem cells (iPSCs) is an efficient means to investigate the mechanisms of inherited human disease. In our work, we set up an iPSC line derived from a WS patient with SOX10 mutation and differentiated into neural crest cells (NCCs), a key cell type involved in inner ear development. Compared with control-derived iPSCs, the SOX10 mutant iPSCs showed significantly decreased efficiency of development and differentiation potential at the stage of NCCs. After that, we carried out high-throughput RNA-seq and evaluated the transcriptional misregulation at every stage. Transcriptome analysis of differentiated NCCs showed widespread gene expression alterations, and the differentially expressed genes (DEGs) were enriched in gene ontology terms of neuron migration, skeletal system development, and multicellular organism development, indicating that SOX10 has a pivotal part in the differentiation of NCCs. It’s worth noting that, a significant enrichment among the nominal DEGs for genes implicated in inner ear development was found, as well as several genes connected to the inner ear morphogenesis. Based on the protein-protein interaction network, we chose four candidate genes that could be regulated by SOX10 in inner ear development, namely, BMP2, LGR5, GBX2, and GATA3. In conclusion, SOX10 deficiency in this WS subject had a significant impact on the gene expression patterns throughout NCC development in the iPSC model. The DEGs most significantly enriched in inner ear development and morphogenesis may assist in identifying the underlying basis for the inner ear malformation in subjects with WS.

Abstract 2478: Elevating SOX2 inhibits the proliferation of tumor cells independently of DNA binding

Abstract Purpose: The purpose of these studies was to understand how elevated SOX2 affects tumor cell proliferation. The stem cell transcription factor SOX2 has been implicated in ~20 different tumor types. Importantly, several studies have demonstrated that the effects of SOX2 during development and malignancy are dependent on its dosage. High levels of SOX2 in both contexts are associated with a quiescent, stem-like phenotype. SOX2high quiescent tumor cells present a significant clinical challenge as these cells are largely resistant to conventional chemotherapies and, thus, provide a reservoir to drive disease recurrence. Therefore, understanding the mechanisms through which elevated SOX2 inhibits tumor cell proliferation will provide insights into the biology of drug-resistant, quiescent tumor cells. Methods: Tumor cell lines representative of medulloblastoma (MB) and colorectal (CRC) tumor cells were engineered for the doxycycline (Dox)-inducible expression of mutant forms of SOX2 that are unable to bind to DNA. One SOX2 mutant was created by substituting a proline for a glycine in the DNA binding domain of SOX2 [SOX2(G76P)]. A second SOX2 mutant replaces the DNA binding domain of SOX2 with the DNA binding domain of the yeast transcription factor Gal4 (Gal4-SOX2). The effects of elevating mutant forms of SOX2 on cell proliferation and the cell cycle distribution of the cells were compared to the effects of elevating wild-type SOX2. Results: Our studies demonstrate that elevating SOX2, SOX2(G76P) or Gal4-SOX2 decreases the proliferation of MB and CRC cells to similar extents. In contrast, inducible expression of the DNA binding domain of Gal4 had no effect on cell proliferation. We previously reported that while SOX2 elevation inhibits the proliferation of a diverse set of tumor cell lines, it does not significantly alter their cell cycle distribution. Similarly, elevating SOX2(G76P) or Gal4-SOX2 did not significantly alter cell cycle distribution. To extend these findings, we are engineering additional SOX2 mutants to map the location of the domain of SOX2 required for growth inhibition. We recently engineered MB and CRC cells to express a mutant form of SOX2 that lacks the c-terminal R1 transactivation domain [Gal4-SOX2(ΔR1)]. Significantly, removing the R1 transactivation domain eliminated the growth inhibitory effects of Gal4-SOX2 when elevated. Conclusion: Our findings demonstrate that elevating two mutant forms of SOX2 that cannot bind to DNA inhibit the proliferation of tumor cell lines that represent two different forms of cancer, similar to the effects of wild-type SOX2. Equally important, our studies indicate that the c-terminal R1 transactivation domain of SOX2 is necessary, but no sufficient, to inhibit proliferation when SOX2 levels are elevated. Collectively, these findings and our previously published work indicate that elevated levels of SOX2 inhibit cell proliferation independently of DNA binding. Citation Format: Ethan Patrick Metz, Phillip J. Wilder, Angie Rizzino. Elevating SOX2 inhibits the proliferation of tumor cells independently of DNA binding [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2021; 2021 Apr 10-15 and May 17-21. Philadelphia (PA): AACR; Cancer Res 2021;81(13_Suppl):Abstract nr 2478.

High Genetic Heterogeneity in Chinese Patients With Waardenburg Syndrome Revealed by Next-Generation Sequencing.

ObjectiveThis study aimed to explore the genetic causes of probands who were diagnosed with Waardenburg syndrome (WS) or congenital sensorineural hearing loss.MethodsA detailed physical and audiological examinations were carried out to make an accurate diagnosis of 14 patients from seven unrelated families. We performed whole-exome sequencing in probands to detect the potential genetic causes and further validated them by Sanger sequencing in the probands and their family members.ResultsThe genetic causes for all 14 patients with WS or congenital sensorineural hearing loss were identified. A total of seven heterozygous variants including c.1459C > T, c.123del, and c.959-409_1173+3402del of PAX3 gene (NM_181459.4), c.198_262del and c.529_556del of SOX10 gene (NM_006941.4), and c.731G > A and c.970dup of MITF gene (NM_000248.3) were found for the first time. Of these mutations, we had confirmed two (c.1459C > T and c.970dup) are de novo by Sanger sequencing of variants in the probands and their parents.ConclusionWe revealed a total of seven novel mutations in PAX3, SOX10, and MITF, which underlie the pathogenesis of WS. The clinical and genetic characterization of these families with WS elucidated high heterogeneity in Chinese patients with WS. This study expands the database of PAX3, SOX10, and MITF mutations and improves our understanding of the causes of WS.

Phenotypic continuum between Waardenburg syndrome and idiopathic hypogonadotropic hypogonadism in humans with SOX10 variants

Purpose:SOX10 mutations previously implicated in Waardenburg syndrome (WS), have now been linked to Kallmann Syndrome [KS], the anosmic form of idiopathic hypogonadotropic hypogonadism (IHH). We investigated whether SOX10-associated WS and IHH represent elements of a phenotypic continuum within a unifying disorder or if they represent phenotypically distinct allelic disorders.Methods:Exome sequencing from 1309 IHH subjects (KS: 632; normosmic idiopathic hypogonadotropic hypogonadism [nIIHH:677) were reviewed for SOX10 rare sequence variants (RSVs). The genotypic and phenotypic spectrum of SOX10-related IHH (this study & literature) and SOX10-related WS cases (literature) were reviewed and compared with SOX10-RSV spectrum in gnomAD population.Results:Thirty-seven SOX10-associated IHH cases were identified: Current study:16 KS; 4 nIHH; literature:16 KS; 1 nIHH. Twenty-three IHH cases (62%; all KS), had ≥1 known WS-associated feature(s). Moreover, five previously reported SOX10-associated WS cases showed IHH-related features. Four SOX10 missense RSVs showed allelic overlap between IHH-ascertained and WS-ascertained cases. The SOX10-HMG domain showed an enrichment of RSVs in disease-states vs. gnomAD.Conclusions:SOX10 mutations contribute to both anosmic (KS) and normosmic (nIHH) forms of IHH. IHH and WS represent SOX10-associated developmental defects that lie along a unifying phenotypic continuum. The SOX10-HMG domain is critical for the pathogenesis of SOX10-related human disorders.

A novel SOX10 nonsense mutation in a patient with Kallmann syndrome and Waardenburg syndrome.

SummaryThe underlying genetic drivers of Kallmann syndrome, a rare genetic disorder characterized by anosmia and hypogonadotropic hypogonadism due to impairment in the development of olfactory axons and in the migration of gonadotropin-releasing hormone (GNRH)-producing neurons during embryonic development, remain largely unknown. SOX10, a key transcription factor involved in the development of neural crest cells and established as one of the causative genes of Waardenburg syndrome, has been shown to be a causative gene of Kallmann syndrome. A 17-year-old male patient, who was diagnosed with Waardenburg syndrome on the basis of a hearing impairment and hypopigmented iris at childhood, was referred to our department because of anosmia and delayed puberty. As clinical examination revealed an aplastic olfactory bulb and hypogonadotropic hypogonadism, we diagnosed him as having Kallmann syndrome. Incidentally, we elucidated that he also presented with subclinical hypothyroidism without evidence of autoimmune thyroiditis. Direct sequence analysis detected a nonsense SOX10 mutation (c.373C>T, p.Glu125X) in this patient. Since this nonsense mutation has never been published as a germline variant, the SOX10 substitution is a novel mutation that results in Kallmann syndrome and Waardenburg syndrome. This case substantiates the significance of SOX10 as a genetic cause of Kallmann syndrome and Waardenburg syndrome, which possibly share a common pathway in the development of neural crest cells.Learning pointsKallmann syndrome and Waardenburg syndrome possibly share a common pathway during neural crest cell development. SOX10, a key transcription factor involved in the development of neural crest cells, is a common causative gene of Kallmann syndrome and Waardenburg syndrome.Careful evaluation about various phenotypic features may reveal the unknown genetic drivers of Kallmann syndrome.

Genetic insights, disease mechanisms, and biological therapeutics for Waardenburg syndrome.

Waardenburg syndrome (WS), also known as auditory-pigmentary syndrome, is the most common cause of syndromic hearing loss (HL), which accounts for approximately 2-5% of all patients with congenital hearing loss. WS is classified into four subtypes depending on the clinical phenotypes. Currently, pathogenic mutations of PAX3, MITF, SOX10, EDN3, EDNRB or SNAI2 are associated with different subtypes of WS. Although supportive techniques like hearing aids, cochlear implants, or other assistive listening devices can alleviate the HL symptom, there is no cure for WS to date. Recently major progress has been achieved in preclinical studies of genetic HL in animal models, including gene delivery and stem cell replacement therapies. This review focuses on the current understandings of pathogenic mechanisms and potential biological therapeutic approaches for HL in WS, providing strategies and directions for implementing WS biological therapies, as well as possible problems to be faced, in the future.

Four mutations in MITF, SOX10 and PAX3 genes were identified as genetic causes of waardenburg syndrome in four unrelated Iranian patients: case report

BackgroundWaardenburg syndrome (WS) is a rare genetic disorder. The purpose of this study was to investigate clinical and molecular characteristics of WS in four probands from four different Iranian families.Case presentation The first patient was a 1-year-old symptomatic boy with congenital hearing loss and heterochromia iridis with a blue segment in his left iris. The second case was a 1.5-year-old symptomatic girl who manifested congenital profound hearing loss, brilliant blue eyes, and skin hypopigmentation on the abdominal region at birth time. The third patient was an 8-month-old symptomatic boy with developmental delay, mild atrophy, hypotonia, brilliant blue eyes, skin hypopigmentation on her hand and foot, Hirschsprung disease, and congenital profound hearing loss; the fourth patient was a 4-year-old symptomatic boy who showed dystopia canthorum, broad nasal root, synophrys, skin hypopigmentation on her hand and abdomen, brilliant blue eyes, and congenital profound hearing loss. Whole exome sequencing (WES) was used for each proband to identify the underlying genetic factor. Sanger sequencing was performed for validation of the identified mutations in probands and the available family members. A novel heterozygous frameshift mutation, c.996delT (p.K334Sfs*15), on exon 8 of the MITF gene was identified in the patient of the first family diagnosed with WS2A. Two novel de novo heterozygous mutations including a missense mutation, c.950G > A (p.R317K), on exon 8 of the MITF gene, and a frameshift mutation, c.684delC (p.E229Sfs*57), on the exon 3 of the SOX10 gene were detected in patients of the second and third families with WS2A and PCWH (Peripheral demyelinating neuropathy, Central dysmyelinating leukodystrophy, Waardenburg syndrome, Hirschsprung disease), respectively. A previously reported heterozygous frameshift mutation, c.1024_1040del AGCACGATTCCTTCCAA, (p.S342Pfs*62), on exon 7 of the PAX3 gene was identified in the patient of the fourth family with WS1.ConclusionsAn exact description of the mutations responsible for WS provides useful information to explain the molecular cause of clinical features of WS and contributes to better genetic counseling of WS patients and their families.

SOX9-COL9A3–dependent regulation of choroid plexus epithelial polarity governs blood–cerebrospinal fluid barrier integrity

The choroid plexus (CP) is an extensively vascularized neuroepithelial tissue that projects into the brain ventricles. The restriction of transepithelial transport across the CP establishes the blood-cerebrospinal fluid (CSF) barrier that is fundamental to the homeostatic regulation of the central nervous system microenvironment. However, the molecular mechanisms that control this process remain elusive. Here we show that the genetic ablation of Sox9 in the hindbrain CP results in a hyperpermeable blood-CSF barrier that ultimately upsets the CSF electrolyte balance and alters CSF protein composition. Mechanistically, SOX9 is required for the transcriptional up-regulation of Col9a3 in the CP epithelium. The reduction of Col9a3 expression dramatically recapitulates the blood-CSF barrier defects of Sox9 mutants. Loss of collagen IX severely disrupts the structural integrity of the epithelial basement membrane in the CP, leading to progressive loss of extracellular matrix components. Consequently, this perturbs the polarized microtubule dynamics required for correct orientation of apicobasal polarity and thereby impedes tight junction assembly in the CP epithelium. Our findings reveal a pivotal cascade of SOX9-dependent molecular events that is critical for construction of the blood-CSF barrier.

An early Sox2-dependent gene expression programme required for hippocampal dentate gyrus development.

The hippocampus is a brain area central for cognition. Mutations in the human SOX2 transcription factor cause neurodevelopmental defects, leading to intellectual disability and seizures, together with hippocampal dysplasia. We generated an allelic series of Sox2 conditional mutations in mouse, deleting Sox2 at different developmental stages. Late Sox2 deletion (from E11.5, via Nestin-Cre) affects only postnatal hippocampal development; earlier deletion (from E10.5, Emx1-Cre) significantly reduces the dentate gyrus (DG), and the earliest deletion (from E9.5, FoxG1-Cre) causes drastic abnormalities, with almost complete absence of the DG. We identify a set of functionally interconnected genes (Gli3, Wnt3a, Cxcr4, p73 and Tbr2), known to play essential roles in hippocampal embryogenesis, which are downregulated in early Sox2 mutants, and (Gli3 and Cxcr4) directly controlled by SOX2; their downregulation provides plausible molecular mechanisms contributing to the defect. Electrophysiological studies of the Emx1-Cre mouse model reveal altered excitatory transmission in CA1 and CA3 regions.

Functional Role of the RNA-Binding Protein Rbm24a and Its Target sox2 in Microphthalmia.

Congenital eye defects represent a large class of disorders affecting roughly 21 million children worldwide. Microphthalmia and anophthalmia are relatively common congenital defects, with approximately 20% of human cases caused by mutations in SOX2. Recently, we identified the RNA-binding motif protein 24a (Rbm24a) which binds to and regulates sox2 in zebrafish and mice. Here we show that morpholino knockdown of rbm24a leads to microphthalmia and visual impairment. By utilizing sequential injections, we demonstrate that addition of exogenous sox2 RNA to rbm24a-deplete embryos is sufficient to suppress morphological and visual defects. This research demonstrates a critical role for understanding the post-transcriptional regulation of genes needed for development.

Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis.

Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung’s disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung’s disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung’s disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype–phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype–phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

Phenotypic similarities in pigs with SOX10c.321dupC and SOX10c.325A>T mutations implied the correlation of SOX10 haploinsufficiency with Waardenburg syndrome

SOX10 is a causative gene of Waardenburg syndrome (WS) that is a rare genetic disorder characterized by hearing loss and pigment disturbance. More than 100 mutations of SOX10 have been found in patients with Type 2 WS (WS2), Type 4 WS (WS4), and more complex syndromes. However, no mutation hotspot has been detected in SOX10, and most cases are sporadic, making it difficult to establish a correlation between the high phenotypic and genetic variability. In this study, a duplication of the 321th cytosine (c.321dupC) was introduced into SOX10 in pigs, which induced premature termination of the translation of SOX10 (p.K108QfsX45). The premature stop codon in Exon 3 triggered the degradation of mutant mRNA through nonsense-mediated mRNA decay. However, SOX10c.321dupC induced a highly similar phenotype of WS2 with heterogeneous inner ear malformation compared with its adjacent missense mutation SOX10c.325A>T. In addition, a site-saturation mutation analysis of the SOX10 N-terminal nuclear localization signal (n-NLS), where these two mutations located, revealed the correlation between SOX10 haploinsufficiency and WS by an in vitro reporter assay. The analysis combining the in vitro assay with clinical cases may provide a clue to clinical diagnoses.

Distinct Genomic Profiles are Associated With Conversion to Resection and Survival in Patients With Initially Unresectable Colorectal Liver Metastases Treated With Systemic and Hepatic Artery Chemotherapy.

To examine genomic correlates of conversion to resection (CTR and overall survival (OS) in patients with initially unresectable colorectal liver metastasis (IU-CRLM) treated with combination systemic and hepatic artery infusion (HAI) chemotherapy. In patients presenting with IU-CRLM, combination systemic and HAI chemotherapy enables CTR with associated long-term OS in a subset of patients. Genomic correlates of CTR and OS in IU-CRLM have not been previously explored. Specimens from IU-CRLM patients receiving systemic/HAI chemotherapy (2003-2017) were submitted for next-generation sequencing. Fisher Exact test assessed associations with CTR, and Kaplan-Meier/Cox methods assessed associations with OS from HAI initiation. Of 128 IU-CRLM patients, 51 (40%) underwent CTR at median 6 months (range: 3-35) from HAI initiation. CTR and persistently unresectable cohorts differed significantly in preoperative systemic chemotherapy exposure, node-positive primary status, and size of largest liver metastasis. Median and 5-year OS was 66 months and 51%. CTR was associated with prolonged survival (time-dependent HR 0.23,95% CI: 0.12-0.46, P < 0.001). The most frequently altered genes were APC (81%), TP53 (77%), and KRAS (37%). Oncogenic mutations in SOX9 and BRAF were associated with CTR. BRAF mutations, any RAS pathway alterations, and co-altered RAS/RAF-TP53 mutations wereassociated with worse survival. Classification and regression tree analysis defined prognostically relevant clusters of genomic risk to reveal co-altered RAS/RAF-TP53 as the highest risk subgroup. Co-altered RAS/RAF-TP53 remained independently associated with worse survival (HR 2.52, 95% CI: 1.37-4.64, P = 0.003) after controlling for CTR, number of liver metastases, and preoperative extrahepatic disease. Distinct genomic profiles are associated with CTR and survival in patients with IU-CRLM treated with HAI/systemic chemotherapy. Presence of SOX9, BRAF , and co-altered RAS/RAF- TP53 mutations are promising biomarkers that, when validated in larger datasets, may impact treatment of IU-CRLM patients.

Clinical and genetic characteristics of Chinese patients with Waardenburg syndrome

Waardenburg syndrome (WS), also known as auditorypigmentary syndrome, is characterized by non-progressive sensorineural hearing loss and anomalous pigmentation. Its mode of inheritance is either autosomal dominant or autosomal recessive. So far only PAX3, MITF, SOX10 and EDNRB mutations have been identified among Chinese patients with WS. This review has provided an update for WS-related genes, mutation databases, molecular and functional data, and a discussion over the molecular diagnosis of WS.

KIT ligand produced by limbal niche cells under control of SOX10 maintains limbal epithelial stem cell survival by activating the KIT/AKT signalling pathway.

Homeostasis and function of limbal epithelial stem cells (LESCs) rely on the limbal niche, which, if dysfunctional, leads to limbal epithelial stem cell deficiency (LSCD) and impaired vision. Hence, recovery of niche function is a principal therapeutic goal in LSCD, but the molecular mechanisms of limbal niche homeostasis are still largely unknown. Here, we report that the neural crest transcription factor SOX10, which is expressed in neural crest‐derived limbal niche cells (LNCs), is required for LNCs to promote survival of LESCs both in vivo and in vitro. In fact, using mice with a Sox10 mutation and in vitro coculture experiments, we show that SOX10 in LNCs stimulates the production of KIT ligand (KITL), which in turn activates in LESCs the KIT‐AKT signalling pathway that protects the cells against activated CASPASE 3‐associated cell death. These results suggest that SOX10 and the KITL/KIT‐AKT pathway play key roles in limbal niche homeostasis and LESC survival. These findings provide molecular insights into limbal niche function and may point to rational approaches for therapeutic interventions in LSCD.

A Novel Spontaneous Mutation of the SOX10 Gene Associated with Waardenburg Syndrome Type II.

Waardenburg syndrome (WS), also known as auditory-pigmentary syndrome, is the most common cause of syndromic hearing loss. It is responsible for 2–5% of congenital deafness. WS is classified into four types depending on the clinical phenotypes. Currently, pathogenic mutation of PAX3, MITF, EDNRB, EDN3, SNAI2, or SOX10 can cause corresponding types of WS. Among them, SOX10 mutation is responsible for approximately 15% of type II WS or 50% of type IV WS. We report the case of a proband in a Chinese family who was diagnosed with WS type II. Whole exome sequencing (WES) of the proband detected a novel heterozygous spontaneous mutation: SOX10 c.246delC. According to analysis based on nucleic acid and amino acid sequences, this mutation may produce a truncated protein, with loss of the HMG structure domain. Therefore, this truncated protein may fail to activate the expression of the MITF gene, which regulates melanocytic development and plays a key role in WS. Our finding expands the database of SOX10 mutations associated with WS and provides more information regarding the molecular mechanism of WS.

Generation of an iPSC line (IMAGINi022-A) from a patient carrying a SOX10 missense mutation and presenting with deafness, depigmentation and progressive neurological impairment.

Mutations of SOX10 result in a broad range of phenotypes including Waardenburg syndrome (WS types 2 and 4) that can be found in association with peripheral demyelinating neuropathy and/or central dysmyelinating leukodystrophy. Here, we generated induced pluripotent stem cells (iPSCs) from a patient carrying a de novo heterozygous missense mutation in the SOX10 gene (MIM* 602229, NM006941.3c.523C>G; p.Pro175Ala) presenting with deafness, depigmentation and progressive neurological impairment. Cells were reprogrammed by non-integrative viral transduction from blood sample, have normal karyotype, express pluripotency markers and are able to differentiate into the three germ cell layers.