Mutations In Progranulin Gene Research Articles

About a hereditary case of frontotemporal degeneration secondary to a progranulin gene mutation

About a hereditary case of frontotemporal degeneration secondary to a progranulin gene mutation

Characterization of Progranulin Gene Mutations in Portuguese Patients with Frontotemporal Dementia.

In Portugal, heterozygous loss-of-function mutations in the progranulin (GRN) gene account for approximately half of the genetic mediated forms of frontotemporal dementia (FTD). GRN mutations reported thus far cause FTD through a haploinsufficiency disease mechanism. Herein, we aim to unveil the GRN mutation spectrum, investigated in 257 FTD patients and 19 family members from the central/north region of Portugal using sequencing methods. Seven different pathogenic variants were identified in 46 subjects including 40 patients (16%) and 6 relatives (32%). bvFTD was the most common clinical presentation among the GRN mutation patients, who showed a global pattern of moderate-to-severe frontotemporoparietal deficits in the neuropsychological evaluation. Interestingly, two mutations were novel (p.Thr238Profs*18, p.Leu354Profs*16), and five were previously described, although three of them only in the Portuguese population, suggesting a population-specific GRN mutational spectrum. The subjects harboring a GRN mutation showed a significant reduction in serum PGRN levels, supporting the pathogenic nature of these variants. This work broadens the mutation spectrum of GRN and the identification of the underlying GRN mutations provided an accurate genetic counselling and allowed the enrolment of subjects with GRN mutations (both asymptomatic and symptomatic) in ongoing clinical trials, which is essential to test new drugs for the disease.

Mutations in PGRN gene associated with the risk of psoriasis in Pakistan: a case control study

BackgroundPsoriasis is a chronic, autoimmune, papulosquamous skin disorder, characterized by the formation of drop-like papules and silvery-white plaques surrounded by reddened or inflamed skin, existing predominantly on the scalp, knees and elbows. The characteristic inflammation and hyperproliferation of keratinocytes in psoriasis is regulated by progranulin (PGRN), which suppresses the expression and release of inflammatory cytokines, such as TNF-α.MethodologyIn this study mutation analysis of the PGRN gene was performed by extracting the genomic DNA from blood samples of 171 diagnosed psoriasis patients and controls through standard salting-out method, followed by amplification and sequencing of the targeted region of exon 5–7 of PGRN gene.ResultsThree single nucleotide polymorphisms, rs25646, rs850713 and a novel point mutation 805A/G were identified in the PGRN gene with significant association with the disease. The variant alleles of the polymorphisms were significantly distributed among cases and controls, and statistical analysis suggested that the mutant genotypes conferred a higher risk of psoriasis development and progression. Multi-SNP haplotype analysis indicated that the CAA (OR = 8.085, 95% CI = 5.16–12.66) and the CAG (OR = 3.204, 95% CI = 1.97–5.21) haplotypes were significantly associated with psoriasis pathogenesis.ConclusionsThese findings demonstrate that polymorphisms in PGRN might act as potential molecular targets for early diagnosis of psoriasis in susceptible individuals.

Progranulin gene mutation of frontotemporal dementia in China: A case report and literature review

AbstractBackgroundProgranulin (GRN) mutations of Frontotemporal dementia (FTD) were rarely reported in China. This study was to report one novel GRN mutation and summarize the genetic and clinical features of patients with GRN mutations in China.MethodComprehensive clinical, genetic, and neuroimaging examinations were conducted on a 58‐year‐old patient who was diagnosed with semantic variant primary progressive aphasia. A literature review was also conducted and the clinical and genetic features of patients with Progranulin mutations in China were summarized.ResultMarked lateral atrophy and hypometabolism on the left‐side frontal, temporal and parietal lobes of the patient were found on neuroimages, and amyloid and tau positron emission tomography ruled out pathological protein deposition. A novel heterozygous 45‐bp deletion (c.141414_1444delCCCTTCCCCGCCAGGCTGTGTGCTGCGAGGATCGCCAGCACTGCT) was identified through Whole Exon Sequencing of the patient’s genomic deoxyribonucleic acid. Nonsense‐mediated messenger ribonucleic acid decay was implicated in the degradation of the mutated messenger ribonucleic acid, and it was defined as pathogenic by American College of Medical Genetics and Genomics guidelines. In the literature review, we found Chinese reports of 13 patients with Progranulin mutations. A 1.2%–2.6% prevalence, an early disease onset and a female predominance were reported in Chinese patients with GRN mutations.ConclusionOur findings expand the mutational profile of Progranulin mutations in China and provide a basis for potential treatments for Progranulin.

Targeting Progranulin as an Immuno-Neurology Therapeutic Approach

Immuno-neurology is an emerging therapeutic strategy for dementia and neurodegeneration designed to address immune surveillance failure in the brain. Microglia, as central nervous system (CNS)-resident myeloid cells, routinely perform surveillance of the brain and support neuronal function. Loss-of-function (LOF) mutations causing decreased levels of progranulin (PGRN), an immune regulatory protein, lead to dysfunctional microglia and are associated with multiple neurodegenerative diseases, including frontotemporal dementia caused by the progranulin gene (GRN) mutation (FTD-GRN), Alzheimer’s disease (AD), Parkinson’s disease (PD), limbic-predominant age-related transactivation response deoxyribonucleic acid binding protein 43 (TDP-43) encephalopathy (LATE), and amyotrophic lateral sclerosis (ALS). Immuno-neurology targets immune checkpoint-like proteins, offering the potential to convert aging and dysfunctional microglia into disease-fighting cells that counteract multiple disease pathologies, clear misfolded proteins and debris, promote myelin and synapse repair, optimize neuronal function, support astrocytes and oligodendrocytes, and maintain brain vasculature. Several clinical trials are underway to elevate PGRN levels as one strategy to modulate the function of microglia and counteract neurodegenerative changes associated with various disease states. If successful, these and other immuno-neurology drugs have the potential to revolutionize the treatment of neurodegenerative disorders by harnessing the brain’s immune system and shifting it from an inflammatory/pathological state to an enhanced physiological/homeostatic state.

Progranulin upregulation by antisense oligonucleotides targeting regRNAs for treatment of FTD‐GRN

AbstractBackgroundHeterozygous mutations in progranulin (GRN) gene leading to progranulin protein (PGRN) haploinsufficieny are the major genetic cause of GRN‐related frontotemporal dementia (FTD‐GRN)1, 2 and 3. Decreased levels of PGRN disrupt lysosome homeostasis, cause aberrant microglia activation and neuronal cell death resulting in progressive behavioral changes, language deficits and memory impairment4. We hypothesize that upregulation of PGRN in both neuronal cells and microglia would be effective for treating FTD‐GRN patients.MethodRegulatory RNAs (regRNAs) are a class of noncoding RNAs that modulate gene transcription. We have developed an RNA Actuating Platform (RAPTM) that identified regRNAs and enables tunable upregulation of genes by specific targeting of regRNAs with antisense oligonucleotides (ASOs).ResultOur platform identified shared GRN regRNAs in human iPSC‐derived neuron and microglia like cells (iMGLs). ASOs targeting shared regRNAs were screened in a human neuroblastoma cell line to identify lead ASOs that upregulate GRN at least 2‐fold. We showed that the lead ASOs upregulate GRN in both human iPSC‐derived neurons and iMGL cells. Moreover, this level of GRN upregulation was sufficient to rescue staurosporine‐induced toxicity in FTD‐GRN patient iPSC‐derived neurons.Furthermore, we identified mouse Grn regRNA‐targeting ASOs that upregulate Grn transcription 2.5‐fold in mouse neuroblastoma cell lines and primary neurons. We tested these ASOs for efficacy in an FTD‐GRN mouse model (Grn+/tm1.1Far )5 by intracerebroventricular injection. Grn upregulation is observed across disease‐relevant brain regions, including cortex in the Grn haploinsufficient mice.ConclusionHere, we describe the development of oligonucleotide drug candidates that target regRNAs to upregulate GRN expression as a therapeutic approach for FTD‐GRN. We believe that our strategy will restore secreted and lysosomal PGRN levels in both microglia and neurons thereby decreasing neuroinflammation and neurotoxicity. We are developing these oligonucleotides as a disease modifying treatment for patients with FTD‐GRN.

Pathological 25 kDa C-Terminal Fragments of TDP-43 Are Present in Lymphoblastoid Cell Lines and Extracellular Vesicles from Patients Affected by Frontotemporal Lobar Degeneration and Neuronal Ceroidolipofuscinosis Carrying a GRN Mutation.

Frontotemporal lobar degeneration (FTLD) is a complex disease, characterized by progressive degeneration of frontal and temporal lobes. Mutations in progranulin (GRN) gene have been found in up to 50% of patients with familial FTLD. Abnormal deposits of post-translationally-modified TAR DNA-binding protein of 43 kDa (TDP-43) represent one of the main hallmarks of the brain pathology. To investigate in peripheral cells the presence of the different TDP-43 forms, especially the toxic 25 kDa fragments, we analyzed lymphoblastoid cell lines (LCLs) and the derived extracellular vesicles (EVs) from patients carrying a GRN mutation, together with wild-type (WT) healthy controls. After characterizing EV sizes and concentrations by nanoparticle tracking analysis, we investigated the levels of different forms of the TDP-43 protein in LCLs and respective EVs by Western blot. Our results showed a trend of concentration decreasing in EVs derived from GRN-mutated LCLs, although not reaching statistical significance. A general increase in p-TDP-43 levels in GRN-mutated LCLs and EVs was observed. In particular, the toxic 25 kDa fragments of p-TDP-43 were only present in GRN-mutated LCLs and were absent in the WT controls. Furthermore, these fragments appeared to be more concentrated in EVs than in LCLs, suggesting a relevant role of EVs in spreading pathological molecules between cells.

Overexpression of progranulin increases pathological protein accumulation by suppressing autophagic flux

Progranulin (PGRN) haploinsufficiency from autosomal dominant mutations in the PGRN gene causes frontotemporal lobar degeneration, which is characterized by cytoplasmic inclusions predominantly containing TDP-43 (FTLD-TDP). PGRN supplementation for patients with a PGRN gene mutation has recently been proposed as a therapeutic strategy to suppress FTLD-TDP. However, it currently remains unclear whether excessive amounts of PGRN are beneficial or harmful. We herein report the effects of PGRN overexpression on autophagic flux in a cultured cell model. PGRN overexpression increased the level of an autophagosome marker without promoting autophagosome formation and decreased the signal intensity of an autolysosome marker, indicating the suppression of autophagic flux due to reductions in the formation of autolysosomes. Assessments of lysosome numbers and biogenesis using LysoTracker and cells stably expressing TFEB-GFP, respectively, indicated that PGRN overexpression increased the lysosome numbers without lysosomal biogenesis. These results suggest that PGRN overexpression suppressed autophagic flux by inhibiting autophagosome-lysosome fusion. Moreover, PGRN overexpression enhanced polyglutamine aggregation and aggregate-prone TDP-43 accumulation, indicating that the suppression of autophagic flux by excessive amounts of PGRN worsens the pathology of neurodegenerative diseases.

Progranulin Insufficiency Affects Lysosomal Homeostasis in Retinal Pigment Epithelium.

Homozygous loss-of-function progranulin gene (GRN) mutation carriers develop adult-onset neuronal ceroid lipofuscinosis (NCL), a lysosomal storage disease. Clinically, NCL patients display retinal degeneration and visual dysfunction. However, there is little information about the effects of progranulin dysfunction on lysosomal function of the retinal pigment epithelium (RPE). We performed RNA interference knock down of progranulin in primary human RPE (hRPE) cells and observed RPE function and lysosomal activity. Progranulin localized to the lysosome in RPE cells. Loss of progranulin did not affect the biogenesis of lysosomes in RPE cells, while it was necessary for the activation of lysosomal proteases. Furthermore, progranulin deficiency decreased cell viability and disrupted the cell-cell junctions. Our results demonstrate that progranulin insufficiency disturbs lysosomal activity and physiological functions in RPE cells.

Autosomal Dominant Frontotemporal Lobar Degeneration in a Filipino Family with Progranulin Mutation

Background: Compared to Western populations, familial frontotemporal lobar degeneration (FTLD) is rare among Asians. Progranulin (GRN) gene mutation, which is a major cause of FTLD, is likewise rare. We present a family with FTLD from the Philippines with an autosomal dominant pattern of inheritance and GRN mutation and briefly review reports of GRN mutations in Asia. Case Presentation: The proband is 66 years old with progressive nonfluent aphasia (PNFA)-corticobasal syndrome . We assessed 3 generations of her pedigree and found 11 affected relatives with heterogenous phenotypes, usually behavioral variant frontotemporal dementia (FTD) and PNFA. Neuroimaging showed atrophy and hypometabolism consistent with FTD syndromes. White matter hyperintensities were seen in affected members even in the absence of vascular risk factors. A GRN mutation R110X was found in 6 members, 3 with symptoms and 3 were asymptomatic. Plasma GRN was low (<112 ng/mL) in all mutation carriers. No mutations were found in microtubule-associated protein tau, APP, PSEN1, and PSEN2 genes, and all were APOE3. Conclusion: This is the first Filipino family with autosomal dominant FTD documented with GRN mutation. Identifying families and cohorts would contribute to therapeutic developments in an area with FTD-GRN.

The Rise of the GRN C157KfsX97 Mutation in Southern Italy: Going Back to the Fall of the Western Roman Empire.

Frontotemporal lobar degeneration (FTLD) designates a group of neurodegenerative diseases with remarkable clinical, pathological, and genetic heterogeneity. Mutations in progranulin gene (GRN) are among the most common causes of familial FTLD. The GRN C157KfsX97 mutation is the most frequent mutation occurring in Southern Italy and has been already described in a previous work. In this study, we reported on additional cases carrying the same mutation and performed a genetic study on the whole cohort, aiming at demonstrating the existence of a founder effect and estimating the age of this mutation. Based on the haplotype sharing analysis, a founder effect was highly probable, while the age of the mutation, estimated by means of DMLE+ software, resulted in a range between 52 and 82 generations, with the highest frequency at about 62 generations, 1,550 years ago. This is the first study that reports the age estimation of the most recent common ancestor for the GRN C157KfsX97 mutation recurring in Southern Italy. Mutation dating in a geographically restricted population may be useful in order to plan genetic counseling and screening programs in the field of public health.

Loss of TMEM106B potentiates lysosomal and FTLD-like pathology in progranulin-deficient mice.

Single nucleotide polymorphisms (SNPs) in TMEM106B encoding the lysosomal type II transmembrane protein 106B increase the risk for frontotemporal lobar degeneration (FTLD) of GRN (progranulin gene) mutation carriers. Currently, it is unclear if progranulin (PGRN) and TMEM106B are synergistically linked and if a gain or a loss of function of TMEM106B is responsible for the increased disease risk of patients with GRN haploinsufficiency. We therefore compare behavioral abnormalities, gene expression patterns, lysosomal activity, and TDP‐43 pathology in single and double knockout animals. Grn −/−/Tmem106b −/− mice show a strongly reduced life span and massive motor deficits. Gene expression analysis reveals an upregulation of molecular signature characteristic for disease‐associated microglia and autophagy. Dysregulation of maturation of lysosomal proteins as well as an accumulation of ubiquitinated proteins and widespread p62 deposition suggest that proteostasis is impaired. Moreover, while single Grn −/− knockouts only occasionally show TDP‐43 pathology, the double knockout mice exhibit deposition of phosphorylated TDP‐43. Thus, a loss of function of TMEM106B may enhance the risk for GRN‐associated FTLD by reduced protein turnover in the lysosomal/autophagic system.

One novel GRN null mutation, two different aphasia phenotypes

Progranulin gene (GRN) mutations are among the leading causes of frontotemporal lobar degeneration, a group of neurodegenerative diseases characterized by remarkable clinical heterogeneity. In this article, we report the new GRN 708+4A>T splicing mutation, identified in 2 siblings of a family with several members affected by cognitive, behavioral, and motor disorders. Plasma progranulin dosage and GRN expression analysis, together with in silico prediction studies, supported the pathogenicity of the mutation. Both the patients displayed a clinical syndrome in which language impairment was largely predominant. However, motor speech deficits were the major feature in one case, diagnosed as progressive nonfluent aphasia, whereas marked semantic alterations were present in the other, whose clinical phenotype was in favor of a mixed aphasia. The profile of neuroanatomical alterations from imaging studies was in line with the clinical phenotypes. Therefore, also this novel GRN mutation is associated with haploinsufficiency and phenotypic heterogeneity, which are both typical features of progranulinopathies.

Generation of an induced pluripotent stem cell line (UBCi001-A) from a presymptomatic individual carrying the R418X progranulin gene mutation.

Induced pluripotent stem cells (iPSCs) were generated from peripheral blood-derived erythroid progenitor cells obtained from a presymptomatic female carrying the heterozygous R418X progranulin (GRN) nonsense mutation, known to cause autosomal dominant frontotemporal lobar degeneration. Erythroid progenitor cells were reprogrammed into iPSCs using integration free episomal plasmids which enables exogenous expression of the Yamanaka factors. The pluripotent potential of the iPSCs was validated through expression of pluripotency factors and their capacity to differentiate into the three primary germ layers. The cells were confirmed to carry the described mutation and shown to have a normal karyotype.

Peripheral GRN mRNA and Serum Progranulin Levels as a Potential Indicator for Both the Presence of Splice Site Mutations and Individuals at Risk for Frontotemporal Dementia.

Progranulin (GRN) gene mutations are a major cause of frontotemporal dementia (FTD). Most mutations identified to date are null mutations, which are predicted to cause the pathology via haploinsufficiency. Decreased peripheral progranulin protein (PGRN) levels are associated with the presence of GRN null mutations and are accepted as reliable biomarkers. In this study, our aim was to test whether the presence of specific GRN splice site mutations (c.- 8+2T>G and c.708+6_9del), could be predicted by peripheral mRNA or protein GRN levels, by studying affected and asymptomatic individuals from FTDfamilies. We also tested four missense GRN variants to assess if altered GRN levels depended on the type of mutation.Our results confirmed a reduction in both mRNA and protein PGRN levels in the splice site mutation carriers, which is consistent with previous reports for null mutations. Our results also suggested that both decreased peripheral GRN mRNA and serum PGRN levels indicate the presence of pathogenic mutations in affected individuals, and identify the asymptomatic individuals at risk, without previous knowledge of genetic status. Both inferences suggest a potential use of peripheral GRN mRNA or serum PGRN levels as biomarkers for families with FTD.

Expression of Progranulin in a Mouse Model of Newborn Hypoxic-ischemic Brain Damage

Neonatal hypoxic ischemic encephalopathy (HIE) is one of the main reasons of death and disability in neonatal, for lack of blood and oxygen during the time of birth. Progranulin (PGRN) as a neurotrophic factor is extensively expressed in the brain can regulate neurite growth and promote neuronal survival. The mutations of PGRN gene may contribute to frontotemporal dementia (FTD). However, the role of PGRN in neonatal HIE remains unclear. We designed this study to investigate the changes of PGRN expression in the brain of newborn mice at different time points after hypoxic -ischemic brain damage (HIBD). Postnatal 7day (P7) mouse pups were induced HIBD model by the method of Rice with some improvement. TTC was used to detect the ischemic lesion volume. The localization of PGRN brain cells was detected by immunofluorescence. We also used Western blotting to measure the expression level of PGRN at different days (1, 3, 7 days) following HIBD. The results showed that we established the HIIBD model successfully. PGRN was primarily expressed in neurons and microglia, but rarely in astrocytes. In addition, PGRN expression in the brain of HIBD mice markedly increased at 1 day and 3 days and was restored at 7 days after HIBD. The results indicated that increased PGRN levels may be involved in the pathological mechanism and neural repair process of HIBD.

SA44WHAT CPGS CAN TELL: AN APPROACH TO THE METHYLATION PATTERN OF BDNF PROMOTER IV IN MAJOR DEPRESSION DISORDER AND ITS RELATION TO STRESS

Progranulin gene (GRN) mutations are among the leading causes of frontotemporal lobar degeneration, a group of neurodegenerative diseases characterized by remarkable clinical heterogeneity. In this article, we report the new GRN 708+4A>T splicing mutation, identified in 2 siblings of a family with several members affected by cognitive, behavioral, and motor disorders. Plasma progranulin dosage and GRN expression analysis, together with in silico prediction studies, supported the pathogenicity of the mutation. Both the patients displayed a clinical syndrome in which language impairment was largely predominant. However, motor speech deficits were the major feature in one case, diagnosed as progressive nonfluent aphasia, whereas marked semantic alterations were present in the other, whose clinical phenotype was in favor of a mixed aphasia. The profile of neuroanatomical alterations from imaging studies was in line with the clinical phenotypes. Therefore, also this novel GRN mutation is associated with haploinsufficiency and phenotypic heterogeneity, which are both typical features of progranulinopathies.

Serum C-Peptide, Visfatin, Resistin, and Ghrelin are Altered in Sporadic and GRN-Associated Frontotemporal Lobar Degeneration.

Frontotemporal lobar degeneration (FTLD) is a group of complex neurodegenerative disease characterized by progressive deterioration of the frontal and anterior temporal lobes of the brain resulting in different heterogeneous conditions, mainly characterized by personality changes, behavioral disturbances, such as binge eating, and deficits in language and executive functions. Null mutations in progranulin gene (GRN) are one of the most frequent genetic determinants in familial frontotemporal dementia. Recently, progranulin was recognized as an adipokine involved in diet-induced obesity and insulin resistance revealing its metabolic function. Increasing evidence suggests that neurodegenerative dementias are associated with a higher prevalence of metabolic changes than in the general population. According to these findings, the aim of this study is to investigate putative alterations in markers linked to metabolic functions (i.e., C-peptide, ghrelin, glucose-dependent insulinotropic polypeptide, glucagon-like peptide-1, glucagon, insulin, resistin, and three adipokines as visfatin, leptin, and plasminogen activator inhibitor-1 total) in sporadic and GRN-related FTLD. We found that 1) C-peptide is increased in sporadic and GRN-mutated FTLD patients; in addition, we demonstrated an anticipation of the disease in patients with the highest C-peptide concentrations; 2) visfatin is slightly reduced in the whole FTLD group; 3) resistin, an adipokine involved in inflammatory-related diseases, is specifically increased in FTLD due to GRN null mutations; 4) ghrelin concentration is specifically increased in pre-symptomatic subjects and FTLD patients with GRN mutations. These findings support the hypothesis that alterations in metabolic pattern are involved in FTLD progression highlighting novel putative targets for the development of preventive and personalized therapies.

GENETIC MUTATIONS IN EARLY-ONSET DEMENTIA: REPORT FROM THE MEMORY CLINIC FROM SERBIA

Monogenetic forms of early onset Alzheimer disease (EAOD) are very rare approximately 2.5 % of all dementia cases with three well known mutations in APP gene, Presenilin 1(PSEN1), and Presenilin 2 (PSEN2). Fronto-temporal dementia (FTD) is the second most common cause of early onset dementia (EOD), characterized by behavioral changes (behavioral variant; bvFTD) or language deficits. Frontotemporal dementia is a highly heritable neurodegenerative disorder. In about a third of patients, the disease is caused by autosomal dominant genetic mutations usually in one of three genes: progranulin (GRN), microtubule-associated protein tau (MAPT), or chromosome 9 open reading frame 72 (C9orf72). The aim of this study was to assess the genetic mutations in a cohort of 322 Serbian patients with EOD and to report phenotypic features of identified carriers. PSEN1 was recorded in 2.42%, APP in 1.2 %, and PSEN2 in 1.21%. A family history of dementia is found in 30% of cases of FTD and about 10% have a clear autosomal-dominant inheritance. Some patients have an associated movement disorder, either parkinsonism, as in progressive supranuclear palsy and corticobasal syndrome, or motor neuron disease (FTD–MND). There was no MAPT mutation in our cohort. Four patients have been diagnosed with mutation in progranulin gene (GRN). Three patients were classified in the FTD spectrum and one with possible Alzheimer disease. We identified 4 patients with EOD to have C9orf72 hexanucleotide expansions. All patients were classified in the FTD disease spectrum group (8.2%): 3 patients fulfilled the criteria for bvFTD, and 1 patient had FTD-MND. None of the patients with the C9orf72 hexanucleotide expansion fulfilled the diagnostic criteria for language variants of FTD, FTD-progressive supranuclear palsy overlap syndrome, dementia with Lewy bodies or Alzheimer's dementia. Mutations in valosin-containing protein (VCP) was found in 3 patients with isolated bvFTD, and no inclusion body myopathy or Paget disease. Patients often present with an extensive phenotypic variability, even among different members of the same kindred carrying an identical disease mutation.

GRN deletion in familial frontotemporal dementia showing association with clinical variability in 3 familial cases

Progranulin (GRN) gene mutations have been genetically associated with frontotemporal dementia (FTD) and are present in about 23% of patients with familial FTD. However, the neurobiology of this secreted glycoprotein remains unclear. Here, we report the identification of 3 pedigrees of Southern Italian extraction in whom FTD segregates with autosomal dominant inheritance patterns. We present evidence that all the available patients in these 3 familial cases are carrying the rare GRN gene exon 6 deletion g10325_10331delCTGCTGT (relative to nt 1 inNG_007886.1), alias Cys157LysfsX97. This mutation was previously described in 2 sporadic cases but was never associated with familial cases. Our patients demonstrate heterogeneous clinical phenotypes, such as the behavioral variant (bvFTD) in the affected men and the nonfluent/agrammatic variant of primary progressive aphasia (nfvPPA) in the affected woman. Haploinsufficiency was revealed by both quantitative real-time PCR of the gene and protein analyses. These findings provide further support for a previously proposed role for the GRN gene in the genetic etiology of FTD and its phenotypic variability.