Mutations In pncA Gene Research Articles

Investigating Phenotypic and Genotypic Resistance to Pyrazinamide Antibiotic in Multidrug-resistant (MDR) Mycobacterium Tuberculosis Isolates in Khuzestan Province from 2017 to 2022

Background and Objectives Pyrazinamide is one of the effective drugs for treating tuberculosis. Inclusion of this drug in the treatment regimen shortens the duration of tuberculosis treatment. The mutation in pncA gene causes loss of pyrazinamidase activity, the most important resistance mechanism in Mycobacterium tuberculosis isolates. Therefore, the purpose of this study is to investigate the phenotypic and genotypic resistance to pyrazinamide antibiotic in multidrug-resistant (MDR) Mycobacterium tuberculosis isolates in Khuzestan province between 2017 and 2022. Subjects and Methods This study was conducted on 40 isolates of Mycobacterium tuberculosis in Ahvaz TB Regional Laboratory. Drug sensitivity of the isolates was determined by the relative method in the antibiotic pyrazinamide in the isolates. Then, the frequency of pncA gene mutations related to pyrazinamide resistance in MDR isolates was determined using sequencing. Results According to the results of the drug sensitivity to rifampin and isoniazid antibiotics, there were 25 isolates, of which 16 strains were resistant to two drugs, namely isoniazid and rifampin (MDR-TB), and 9 were single-drug resistant isolates (8 isolates resistant to rifampin and 1 isolate resistant to Isoniazid). Of the 17 samples that had the pncA gene and were resistant to pyrazinamide, 13 had mutations in the pncA gene while 4 did not have any mutations. The most common mutation was a non-synonymous mutation in which the amino acid Val had changed to Phe. Conclusion According to the results of this study, there is a high frequency of resistance to pyrazinamide in MDR strains. Also, there is a high percentage of single-resistance mutations in the pncA gene, while there is lower prevalence of mutations in the panD and rpsA genes, which provide quick and accurate information about the sensitivity to pyrazinamide for MDR-TB and mono-resistant isolates. Therefore, the best method for detecting resistance to pyrazinamide is sequencing and whole pncA DNA sequence to confirm pyrazinamide resistance instead of the usual methods covering mutated hotspots.

Pyrazinamide resistance due to pncA gene mutation and its association with treatment outcome among tuberculosis patients of South India- A longitudinal observational study

IntroductionMycobacterium tuberculosis has been extensively studied for mutations leading to drug resistance. Pyrazinamide is a drug acting on the semi-dormant bacteria that is responsible for relapse of tuberculosis. This drug helped reduce the treatment duration of tuberculosis from nine to six months. However, this drug is not being screened for resistance along with Rifampicin and Isoniazid. Aims and objectivesThis study aimed to estimate the proportion of pncA gene mutation among tuberculosis patients and its association between treatment outcomes, clinical characteristics, and phenotypic drug resistance. Methodology: A total of 154 samples included 73 drug-resistant and 81 drug-susceptible isolates. The isolates were subjected to DNA extraction and amplification using conventional PCR. The PCR product was sequenced by the Sanger sequencing method, and phenotypic drug susceptibility testing was done using the broth dilution method. The association of this gene with the treatment outcome was done by following up with the patients till the end of the regimen. ResultsNone of the drug susceptible tuberculosis patients showed significant non-synonymous mutations. Among the drug-resistant TB patients, seven unique significant mutations out of 73 isolates (9.6%) were distributed among Isoniazid-resistant tuberculosis and Multi-Drug Resistant Tuberculosis isolates. No association was found between the mutations and the clinical characteristics of the subjects harboring these isolates. ConclusionThis study estimated seven unique mutations in drug-resistant tuberculosis and none in drug-sensitive tuberculosis. Isolates harboring was not significantly associated with the participant's treatment outcome and other clinical characteristics. The pyrazinamide resistance testing by the phenotypic and genotypic methods was found to be in concordance.

Mutant vary region of pncA gene sequence of pyrazinamide resistance among multidrug resistant Mycobacterium tuberculosis isolates

ABSTRACT Introduction: Pyrazinamide (PZA) is one of the potent front-line drugs that act as antituberculosis (antiTB) for nonresistant or resistant Mycobacterium tuberculosis. Mutation of pncA gene is considered to be main target of PZA resistance mechanism. This study aims to determine the mutant gene sequences, location, and correlation of pncA gene mutations with PZA resistance in MDR Mycobacterium tuberculosis as a base for the rapid molecular examination. Objective: This study aims to determine the mutant gene sequence and location of pncA gene with PZA resistance in multidrug resistant (MDR) Mycobacterium tuberculosis need a rapid molecular examination for consideration of MDR TB therapy management in Indonesia. Methods: MDR Mycobacterium tuberculosis were identified and tested for PZA resistance with BACTEC MGIT 960 as a gold standard, followed by DNA extraction, PCR amplification and pncA gene sequencing. Results: An analysis of 561 bp sequence of nucleotides was performed to determine type and location of mutations. A total of 35 isolates of this study showed 14 isolates of pncA gene mutation (40%), and revealed in 13 resistant and 1 sensitive isolate. The correlation analysis of pncA gene mutation to PZA resistance was significant (p = 0,003 and r = 0,452). Mutations in 3 (three) specific regions of pncA gene are 1 isolate at codons 51-76, 1 isolate at codons 130-142, and 3 isolates at codons 163-180. Conclusion: Types of mutations in the pncA gene include substitution of 11 isolates, insertion of 2 isolates, and no deletion. Insertion of 178 CGCGCTGGAGGAGATGCGCACCGCC and multiple mutations in one isolate.

Investigation of pncA, rpsA and panD Gene Mutations Associated with Resistance in Pyrazinamide-Resistant Mycobacterium tuberculosis Isolates and Spoligotyping

Pyrazinamide (PZA) is one of the first-line anti-tuberculous drugs used in the treatment of tuberculosis (TB). Considering the ability of PZA to shorten the treatment period from 9-12 months to six months by eliminating persistent bacilli, it appears to be an important cornerstone of TB therapy. While the main mechanism causing the PZA resistance is pncA mutations at a rate of 70-97%, it has been determined that rpsA and panD mutations can also cause resistance. In this study, we aimed to investigate the pncA, rpsA and panD gene mutations, the efficiency of the pyrazinamidase (PZAse) enzyme test in determining PZA resistance, the drug susceptibility and their families in PZA-resistant Mycobacterium tuberculosis isolates. Totally 46 PZA resistant M.tuberculosis isolates were included in the study. The pncA, rpsA and panD mutations caused by PZA resistance were investigated by in-house PCR followed by DNA sequencing method. Drug susceptibility was determined with Bactec MGIT 960 (Becton Dickinson, USA) system, the presence of PZAse was evaluated by colorimetric PZAse enzyme assay and the families were determined by the spoligotyping method. Of the 46 PZA-resistant isolates, 24 (52.2%) were identified as PZA monoresistant, 11 (23.9%) multidrug resistant (MDR)-TB and 11 (23.9%) poly drug resistant (PDR)-TB. Gene mutations associated with resistance were detected in 73.9% (34) of PZA-resistant M.tuberculosis isolates. The pncA, rpsA and panD mutations were found in 71.7% (33), 28.2% (12) and 4.3% (2) of the isolates, respectively. The coexistence of pncA/rpsA and pncA/panD gene mutations were determined in 12 and two isolates, respectively. The pncA gene mutations were observed in 3 (33.3%) of 9 (19.6%) isolates whose enzyme presence was detected by the colorimetric PZAse test. In the pncA gene, eight different point mutations in the form of missense mutation;A226C (27.3%), A152C (24.2%), C169G (21.2%) A422C (9.1%), G145A (6.1%), A29G (6.1%), A424G (3%) and T464G (3%) were detected. In the rpsA gene, A636C (42.9%) silent and G1318A (42.9%) missense mutations and in the panD gene, C66G (50%) nonsense and A145G (50%) missense mutations were the most common mutations detected. As a result of genotyping of PZA resistant isolates, the most common genotypes were found in T1 cluster with 17 (36.9%) isolates; followed by the families of Beijing with 7 (15.2%) isolates, H3 with 6 (13%) isolates, TUR with 5 (10.9%) isolates, and LAM 9 with 4 (8.7%) isolates, respectively. In addition, 2 (4.3%) isolates belonging to the ORPHAN family and one isolate belonging to each of LAM TUR, LAM 2, LAM 7, T2, T5-RUS1 families were identified. Our study is the first to investigate all pncA, rpsA and panD gene mutations that have been found to cause PZA resistance in Turkey. Epidemiological studies on PZA resistance will make important contributions to the determination of resistance mechanism and the development of methods that will provide rapid diagnosis for the detection of resistance.

Drug resistance gene mutations and treatment outcomes in MDR-TB: A prospective study in Eastern China.

Multidrug-resistant tuberculosis (MDR-TB) poses a serious challenge to TB control. It is of great value to search for drug resistance mutation sites and explore the roles that they play in the diagnosis and prognosis of MDR-TB. We consecutively enrolled MDR-TB patients from five cities in Jiangsu Province, China, between January 2013 and December 2014. Drug susceptibility tests of rifampin, isoniazid, ofloxacin, and kanamycin were routinely performed by proportion methods on Lowenstein-Jensen (LJ) medium. Drug resistance-related genes were sequenced, and the consistency of genetic mutations and phenotypic resistance was compared. The association between mutations and treatment outcomes was expressed as odds ratios (ORs) and 95% confidence intervals (CIs). Among 87 MDR-TB patients, 71 with treatment outcomes were involved in the analysis. The proportion of successful treatment was 50.7% (36/71). The rpoB gene exhibited the highest mutation rate (93.0%) followed by katG (70.4%), pncA (33.8%), gyrA (29.6%), eis (15.5%), rrs (12.7%), gyrB (9.9%) and rpsA (4.2%). Multivariable analysis demonstrated that patients with pncA gene mutations (adjusted OR: 19.69; 95% CI: 2.43-159.33), advanced age (adjusted OR: 13.53; 95% CI: 1.46-124.95), and nonstandard treatment (adjusted OR: 7.72; 95% CI: 1.35-44.35) had a significantly higher risk of poor treatment outcomes. These results suggest that Mycobacterium tuberculosis gene mutations may be related to phenotypic drug susceptibility. The pncA gene mutation along with treatment regimen and age are associated with the treatment outcomes of MDR-TB.

High prevalence of phenotypic pyrazinamide resistance and its association with pncA gene mutations in Mycobacterium tuberculosis isolates from Uganda.

IntroductionSusceptibility testing for pyrazinamide (PZA), a cornerstone anti-TB drug is not commonly done in Uganda because it is expensive and characterized with technical difficulties thus resistance to this drug is less studied. Resistance is commonly associated with mutations in the pncA gene and its promoter region. However, these mutations vary geographically and those conferring phenotypic resistance are unknown in Uganda. This study determined the prevalence of PZA resistance and its association with pncA mutations.Materials and methodsUsing a cross-sectional design, archived isolates collected during the Uganda national drug resistance survey between 2008–2011 were sub-cultured. PZA resistance was tested by BACTEC Mycobacterial Growth Indicator Tube (MGIT) 960 system. Sequence reads were downloaded from the NCBI Library and bioinformatics pipelines were used to screen for PZA resistance–conferring mutations.ResultsThe prevalence of phenotypic PZA resistance was found to be 21%. The sensitivity and specificity of pncA sequencing were 24% (95% CI, 9.36–45.13%) and 100% (73.54% - 100.0%) respectively. We identified four mutations associated with PZA phenotypic resistance in Uganda; K96R, T142R, R154G and V180F.ConclusionThere is a high prevalence of phenotypic PZA resistance among TB patients in Uganda. The low sensitivity of pncA gene sequencing confirms the already documented discordances suggesting other mechanisms of PZA resistance in Mycobacterium tuberculosis.

Colorimetric methods for rapid determination of pyrazinamide resistance.

Because pyrazinamide (PZA) is only effective for Mycobacterium tuberculosis at an acidic pH, susceptibility tests are more difficult to perform than those for other anti-tuberculosis (TB) drugs. The purpose of our work was to investigate the effectiveness of colorimetric methods to detect PZA susceptibility and to detect pncA gene mutations in resistant isolates by sequence analysis. In this study, 30 clinical isolates and 2 reference isolates were used, 15 of which were resistant to PZA. The PZA susceptibility of all the isolates was determined by the BACTEC MGIT 960 reference method. As colorimetric methods, Resazurin Microtiter Assay (REMA), Nitrate Reductase Assay (NRA), Malachite Green Decolorization Assay (MGDA), and Crystal Violet Decolorization Assay (CVDA) methods were included in the study. In addition, mutations in the pncA gene were investigated using sequence analysis in PZA-resistant isolates. As a result of the comparison of the colorimetric methods with the reference method, agreement was determined as 93.3% in REMA and NRA, 90% in MGDA, and 93.3% in CVDA. In 13 of 15 resistant isolates, the pncA gene mutation was detected by sequence analysis. As a result of the work, the results from the colorimetric methods were found to be at a high level of concordance with the reference method. They are also inexpensive and easily applicable methods.

Detection of Mutations in Mycobacterium tuberculosis pncA Gene by Modified High-Resolution Melting Curve Analysis of PCR Products.

We developed a protocol for detection of mutations in the pncA gene associated with M. tuberculosis resistance to pyrazinamide by analyzing melting curves of 7 overlapping amplicons with artificial heteroduplex formation (H-HRM) formed by co-amplification of wild-type DNA and test DNA and compared its efficiency and robustness with those of classical HRM analysis. Using HRM and H-HRM, we analyzed 35 PZAR DNA isolates carrying mutations in the pncA gene, 3 PZAR isolates without mutations in the pncA gene, and 20 PZAS isolates without mutations in the pncA gene were analyzed. The sensitivity and specificity of HRM for detection of mutations in the pncA gene were moderate: 88.57% (CI 73.26%-96.80%) and 82.61% (CI 61.22%-95.05%), respectively. The sensitivity of the H-HRM test was 97.14% (CI 85.08%-99.93%) and specificity was 95.65% (CI 78.05%-99.89%), with a significant improvement in accuracy - 96.55% vs. 93.85% for HRM. In general, despite addition stage of equalizing the concentrations of the test and control mycobacterial DNA, H-HRM showed greater stability and reproducibility at standard settings of the melting curve analysis software.

Resistance To First-Line Antituberculosis Drugs And Prevalence Of pncA Mutations In Clinical Isolates Of Mycobacterium tuberculosis From Zunyi, Guizhou Province Of China.

BackgroundChina is one of the high-burden countries for multidrug-resistant tuberculosis (MDR-TB), and pyrazinamide is one of the anti-TB drugs used for the shorter MDR-TB treatment regimen. The aim of this study was to determine the correlation between pncA gene mutations and resistance to four first-line anti-TB drugs as well as treatment history in clinical isolates of Mycobacterium tuberculosis.Patients and methodsM. tuberculosis clinical isolates were collected from 318 in-patients with smear-positive TB between October 2008 and September 2016 at a major hospital in Zunyi, Guizhou Province of China, and used for drug susceptibility testing against four first-line anti-TB drugs. Genomic DNA extracted from clinical isolates was used for PCR amplification and DNA sequencing of the pncA gene.ResultsAmong 318 clinical isolates, 129 (40.6%), 170 (53.5%), 66 (20.8%) and 109 (34.3%) were resistant to rifampicin, isoniazid, ethambutol and streptomycin respectively. In addition, 124 clinical isolates were MDR-TB and 71.8% of them were previously treated cases. Sequencing results showed that 46.8% of MDR-TB and 2.2% of drug susceptible isolates harbored a pncA mutation, and 52 types of pncA mutations were detected from 64 isolates. The prevalence of pncA mutations in isolates resistant to first-line anti-TB drugs and previously treated TB cases was significantly higher than that in drug-susceptible isolates and new cases of TB.ConclusionHigh prevalence of pncA mutations in clinical isolates of M. tuberculosis from Zunyi, Guizhou Province of China, is correlated with resistance to four first-line anti-TB drugs, MDR-TB and previously treated TB cases.

Protein analysis in skeletal muscle from gestational diabetes mellitus and their association with insulin signalling during pregnancy.

Mutations in pncA gene contributing to PZA resistance was not clearly elucidated in China. To reveal the correlated mutations of pncA gene on pyrazinamide (PZA) resistance. 148 Mycobacterium tuberculosis clinical isolates were included from multi-drug resistant tuberculosis suspects. The MGIT 960 test and microscopic observation drug susceptibility (MODS) assay were adopted for PZA phenotype drug susceptibility test. 120 isolates with consistent MGIT 960 and MODS results were selected for pncA gene sequencing. 68 samples (56.7%) were resistant to PZA while leaving 52 PZA susceptible samples. Out of the 68 PZA resistant isolates, 49 (72.1%) harbored mutations of pncA, and 4 (7.7%) of the 52 PZA susceptible samples harbored mutations of pncA as well. Compared to the phenotype drug resistant pattern of PZA, the mutations of pncA gene reached a sensitivity of 0.72 to report PZA resistance and a specificity of 0.92 to predict PZA susceptibility. Those mutations, Gln10Pro, Asp12Ala, Tyr41Stop, Gly97Asp, Val128Gly and FSC131(ins) exceeding 5% of the total PZA resistant isolates of each, might be helpful but not adequate in PZA molecular susceptibility test design and development.

Structural and free energy landscape of novel mutations in ribosomal protein S1 (rpsA) associated with pyrazinamide resistance

Resistance to key first-line drugs is a major hurdle to achieve the global end tuberculosis (TB) targets. A prodrug, pyrazinamide (PZA) is the only drug, effective in latent TB, recommended in drug resistance and susceptible Mycobacterium tuberculosis (MTB) isolates. The prodrug conversion into active form, pyrazinoic acid (POA), required the activity of pncA gene encoded pyrazinamidase (PZase). Although pncA mutations have been commonly associated with PZA resistance but a small number of resistance cases have been associated with mutationss in RpsA protein. Here in this study a total of 69 PZA resistance isolates have been sequenced for pncA mutations. However, samples that were found PZA resistant but pncA wild type (pncAWT), have been sequenced for rpsA and panD genes mutation. We repeated a drug susceptibility testing according to the WHO guidelines on 18 pncAWT MTB isolates. The rpsA and panD genes were sequenced. Out of total 69 PZA resistant isolates, 51 harbored 36 mutations in pncA gene (GeneBank Accession No. MH46111) while, fifteen different mutations including seven novel, were detected in the fourth S1 domain of RpsA known as C-terminal (MtRpsACTD) end. We did not detect any mutations in panD gene. Among the rpsA mutations, we investigated the molecular mechanism of resistance behind mutations, D342N, D343N, A344P, and I351F, present in the MtRpsACTD through molecular dynamic simulations (MD). WT showed a good drug binding affinity as compared to mutants (MTs), D342N, D343N, A344P, and I351F. Binding pocket volume, stability, and fluctuations have been altered whereas the total energy, protein folding, and geometric shape analysis further explored a significant variation between WT and MTs. In conclusion, mutations in MtRpsACTD might be involved to alter the RpsA activity, resulting in drug resistance. Such molecular mechanism behind resistance may provide a better insight into the resistance mechanism to achieve the global TB control targets.

PncA gene mutations in reporting pyrazinamide resistance among the MDR-TB suspects

Mutations in pncA gene contributing to PZA resistance was not clearly elucidated in China. To reveal the correlated mutations of pncA gene on pyrazinamide (PZA) resistance. 148 Mycobacterium tuberculosis clinical isolates were included from multi-drug resistant tuberculosis suspects. The MGIT 960 test and microscopic observation drug susceptibility (MODS) assay were adopted for PZA phenotype drug susceptibility test. 120 isolates with consistent MGIT 960 and MODS results were selected for pncA gene sequencing. 68 samples (56.7%) were resistant to PZA while leaving 52 PZA susceptible samples. Out of the 68 PZA resistant isolates, 49 (72.1%) harbored mutations of pncA, and 4 (7.7%) of the 52 PZA susceptible samples harbored mutations of pncA as well. Compared to the phenotype drug resistant pattern of PZA, the mutations of pncA gene reached a sensitivity of 0.72 to report PZA resistance and a specificity of 0.92 to predict PZA susceptibility. Those mutations, Gln10Pro, Asp12Ala, Tyr41Stop, Gly97Asp, Val128Gly and FSC131(ins) exceeding 5% of the total PZA resistant isolates of each, might be helpful but not adequate in PZA molecular susceptibility test design and development.

Characterization of novel Mycobacterium tuberculosis pncA gene mutations in clinical isolates from the Ukraine

Multidrug-resistant (MDR) and extensively drug-resistant (XDR) Mycobacterium tuberculosis cases in the Ukraine are increasing. Pyrazinamide (PZA) is critically important for first- and second-line tuberculosis (TB) treatment regimes. However, PZA drug susceptibility testing is time consuming and technically challenging. The present study utilized Next-generation sequencing (NGS) to identify mutations in the pncA gene from clinical isolates and to assess the prevalence of pncA gene mutations in MDR/XDR-TB patients. Clinical isolates were inactivated in molecular transport media and shipped from Kharkiv, Ukraine, to San Antonio, TX. Whole-genome and targeted pncA gene sequencing was carried out using Illumina MiSeq instrumentation. Mutations were noted in 67 of 91 (74%) clinical isolates comprising substitutions, insertions, and deletions in the pncA coding and upstream promoter region. Of 45 mutation types, there were 11 novel, i.e., to date unknown, pncA mutations identified of which 3 were confirmed PZA resistant. Seven isolates contained mixed base mutations, whereas 4 harbored doubled mutations. Data reported here further support use of NGS for pncA gene characterization and may contribute in significant fashion to PZA therapy, especially in MDR- and XDR-TB patients.

The Effect of pncA Gene Mutation of Mycobacterium Tuberculosis to Transaminase and Uric Acid Serum in MDR TB Patient

Bacground: The common side effects of PZA treatment is the occurrence of hepatotoxicity and blocking the secretion of uric acid. This
 study aims to determine the effect of the pncA gene mutation of Mycobacterium tuberculosis to serum transaminase and serum uric acid in
 patients with MDR TB who had receive therapy with PZA.
 Methods: Quasi-experimental test was conducted at MDR TB polyclinic in H. Adam Malik Medan Hospital of 25 patients with MDR TB.
 Mutations of genes was assessed by PCR-RFLP method and data of serum transaminase and serum uric acid retrieved from the medical
 records, between February until June 2015
 Result: Thirtysix percent pncA gene mutation founded. Significance statistic test between mutation of pncA gene and SGOT serum in
 baseline Vs 4 weeks (P=0,007), baseline Vs 8 weeks (P=0,023) and uric acid serum baseline Vs 4 weeks (P=0,011). No statistically
 difference in SGPT serum. No correlation between pncA gene (mutation and no mutation) with transaminase serum and uric acid serum.
 Conclusion: Transaminase serum and uric acid elevated in MDR TB patient with mutation in pncA gene.Mutation in pncA gene have a
 correlation with elevated SGOT serum compared between baseline, 4 and 8 weeks. No correlation between pncA gene mutation and SGPT.
 Mutation in pncA gene have a correlation with uric acid serum elevated in 4 weeks. No correlation between pncA gene (mutation and no
 mutation) with transaminase serum and uric acid serum elevated.

Molecular investigation of mutation in PncA gene for pyrazinamide resistance in Mycobacterium tuberculosis: an in silico approach

Molecular investigation of mutation in PncA gene for pyrazinamide resistance in Mycobacterium tuberculosis: an in silico approach

Novel Mutations in pncA Gene of Pyrazinamide Resistant Clinical Isolates of Mycobacterium tuberculosis

In clinical isolates of Mycobacterium tuberculosis (MTB), resistance to pyrazinamide occurs by mutations in any positions of the pncA gene (NC_000962.3) especially in nucleotides 359 and 374. In this study we examined the pncA gene sequence in clinical isolates of MTB. Genomic DNA of 33 clinical isolates of MTB was extracted by the Chelex100 method. The polymerase chain reactions (PCR) were performed using specific primers for amplification of 744 bp amplicon comprising the coding sequences (CDS) of the pncA gene. PCR products were sequenced by an automated sequencing Bioscience system. Additionally, semi Nested-allele specific (sNASP) and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) methods were carried out for verification of probable mutations in nucleotides 359 and 374. Sequencing results showed that from 33 MTB clinical isolates, nine pyrazinamide-resistant isolates have mutations. Furthermore, no mutation was detected in 24 susceptible strains in the entire 561 bp of the pncA gene. Moreover, new mutations of G→A at position 3 of the pncA gene were identified in some of the resistant isolates. Results showed that the sNASP method could detect mutations in nucleotide 359 and 374 of the pncA gene, but the PCR-RFLP method by the SacII enzyme could not detect these mutations. In conclusion, the identification of new mutations in the pncA gene confirmed the probable occurrence of mutations in any nucleotides of the pncA gene sequence in resistant isolates of MTB.

Non-pncA Gene-Mutated but Pyrazinamide-Resistant Mycobacterium tuberculosis: Why Is That?

Pyrazinamide (PZA) is a key component for the effective treatment of drug-susceptible and PZA-susceptible multidrug-resistant (MDRPZA-S) tuberculosis (TB). pncA gene mutations are usually detected in a clear majority (>90%) of PZA-resistant strains but obviously not in all. Rapid and reliable PZA drug susceptibility testing (DST) is critical whenever PZA is to be used in a treatment regimen, not least for the treatment of MDRPZA-S TB. In this study, we selected 26 PZA-resistant isolates reported to carry a wild-type pncA gene. To confirm resistance, susceptibility testing was repeated using 100 mg/liter and 200 mg/liter PZA for all the 26 isolates and Sanger sequencing was repeated on the 18 isolates that remained PZA resistant. Apart from the eight isolates initially misclassified as PZA resistant, the retests identified three factors responsible for the phenotype-genotype discrepancy: panD or rpsA mutations identified by whole-genome sequencing (WGS) (n = 7), heteroresistance (n = 8), and mixed populations with Mycobacterium avium (n = 3). Additionally, we performed WGS on 400 PZA-susceptible isolates and 15 consecutive MDRPZA-R clinical isolates. Of the 400 PZA-susceptible isolates, only 1 harbored a nonsynonymous pncA mutation (Thr87Met), whereas a nonsynonymous rpsA mutation was found in 17 isolates. None of these isolates carried a nonsynonymous panD mutation, while all 15 of the MDRPZA-R isolates harbored a nonsynonymous pncA mutation. Our findings indicate that it is necessary to consider the occurrence of panD mutations in PZA-resistant isolates, as well as heteroresistance, for the development and evaluation of new molecular techniques to ensure high-quality DST performance. The identification of nonsynonymous rpsA mutations in both PZA-susceptible and PZA-resistant isolates also implies that further studies are needed in order to determine the role of rpsA in PZA resistance.

PncA mutations are associated with slower sputum conversion during standard treatment of multidrug-resistant tuberculosis

Despite the strong association between drug resistance and genetic mutations, the value of molecular diagnosis of drug resistance to guide the treatment of multidrug-resistant tuberculosis (MDR-TB) remains unclear. This is particularly relevant in resource-limited areas where it is difficult to perform drug susceptibility testing (DST). Here we investigated the association between drug susceptibility phenotypes and genotypes and treatment outcomes in patients with MDR-TB. This study enrolled 74 consecutive patients with confirmed MDR-TB between 2010 and 2011, and outcomes were followed-up over the 24-month treatment course. All of the isolates were tested for phenotypic susceptibility to second-line drugs using the Mycobacteria Growth Indicator Tube (MGIT)-based system, and genotypic mutations were assessed by DNA sequencing. Among the 74 MDR-TB isolates, 29 (39.2%) were resistant to fluoroquinolones and/or second-line injectable drugs, of which 21 (72.4%) harboured a mutation in drug resistance-related genes (gyrA, rrs or eis). In addition, 32 individuals (43.2%) also had pyrazinamide (PZA)-resistant isolates, with 28 (87.5%) containing the pncA mutation. By backward selection in the multivariate logistic regression and Cox proportional hazard models, PZA resistance and its related pncA gene mutation demonstrated a correlation with a lower likelihood of culture conversion at 8 weeks and treatment success. Meanwhile, the fluoroquinolone resistance-related gyrA gene mutation was negatively correlated with treatment success. DST for PZA and fluoroquinolones together with genetic information appears to provide a clinically useful indicator of the treatment outcome of MDR-TB in China.

Shortening of Amino Acids from C-terminal of PZase as Basis of Pyrazinamide Resistance in P14 Isolate of Mycobacterium Tuberculosis Strain

Pyrazinamide (PZA) is one of the mainstays WHO-recommended drugs for therapy of tuberculosis (TB). The emergence of PZA resistance in clinical isolates of M. tuberculosis is often associated with pncA gene mutations encoding PZase. A local clinical isolate of Mycobacterium tuberculosis strain showed phenotipe resistant to PZA at concentration of 10μg/mL. The ORF of pncA gene of the isolate showed deletion of guanine base at position 81, then followed by shortening of 70 amino acids from C-terminal of PZAse which has 186 amino acid residues. The mutant of PZase took frame shift of amino acids after the residue at position 27. The pncA gene mutation at the level of genotype, that produced a physical-chemical alteration of the active site or the metal-binding site of PZase, in this case perturbing or lossing its activity was proposed as trigering the PZA resistance in P14 clinical isolate of M. tuberculosis strain.

Pyrazinamide resistance among multidrug-resistant tuberculosis clinical isolates in a national referral center of China and its correlations with pncA, rpsA, and panD gene mutations

Our study was aimed to identify the phenotypic and genotypic pyrazinamide (PZA) resistance features among multidrug-resistant (MDR) isolates in a national tuberculosis (TB) referral center of China. PZA susceptibility test was performed for a total of 142 MDR-TB clinical isolates using the MGIT 960 PZA kits, and the pncA, rpsA, and panD genes were sequenced. Extensively drug-resistant (XDR) and pre-XDR strains had higher PZA resistance rate than that of MDR strains which were still sensitive to fluoroquinolone and aminoglycoside (42.9%, 24/56) (χ2=8.922, P=0.012). No panD mutation was detected among the PZA resistant strains with wild-type pncA and rpsA genes. Our study indicates that PZA-resistant frequency increases with TB drug resistance level; pncA, rpsA, and panD mutations had strong, low, and no correlation with PZA resistance, and rapid molecular assay will facilitate the timely identification of the PZA-sensitive MDR-TB.