Mutations In NPHS1 Gene Research Articles

Mutation of NPHS1, NPHS2, WT1, LAMB2, COL4A5 and other genes in children with idiopathic steroid resistant nephrotic syndrome

Background: Many children with idiopathic steroid resistant nephrotic syndrome have been reported worldwide due to mutation of NPHS1, NPHS2, WT1 and LAMB2 genes. This study aimed to determine the frequency of mutation of NPHS1, NPHS2, WT1, LAMB2, COL4A5 and other genes and their association with renal histopathological patterns of idiopathic steroid resistant nephrotic syndrome patients. Methods: This cross-sectional study was conducted on 25 patients with idiopathic steroid resistant nephrotic aged 1-17 years in the Department of Paediatric Nephrology, Bangabandhu Sheikh Mujib Medical University, Bangladesh, from July 2017 to June 2018. Next Generation Sequencing and mutation analysis were performed after DNA extraction from patients' venous blood lymphocytes. Histopathological study of renal tissue was done among 17 patients. Results: A little more than half (56%) of the patients were male. The mean age at the initial attack of nephrotic syndrome was 94.2 months. They mostly had minimal change disease (41%) and IgA nephropathy (12%). One subject had the NPHS2 gene mutation, histopathologically diffuse mesangial proliferative glomerulonephritis, and clinically stage-4 chronic kidney disease. Another subject had the COL4A5 gene mutation and focal segmental glomerulosclerosis. Both were male and had no familial renal disease, consanguinity, or hematuria. Conclusion: Children with idiopathic steroid resistant nephrotic syndrome showed NPHS2 and COL4A5 gene mutations. Histopathologically, they showed diffuse mesangial proliferative glomerulonephritis and focal segmental glomerulosclerosis.

Analysis of the clinical characteristics of arthritis with renal disease caused by a NPHS2 gene mutation.

The co-existence of juvenile idiopathic arthritis (JIA)/rheumatoid arthritis (RA) and focal segmental glomerulosclerosis (FSGS) is rare, and the existence of co-pathogenesis remains unknown. In this study, we analyzed the clinical and gene mutation characteristics of a patient with JIA and FSGS caused by a NPHS2 gene mutation, and evaluated the potential connections between these two diseases. We summarized the clinical manifestations, related examination results, and gene mutation characteristics of the patient who presented at our center and six reported cases of arthritis with renal disease. Most of the cases were polyarticular arthritis with varying degrees of renal damage (hematuria, proteinuria, and renal dysfunction) and different prognoses. Among these patients, two developed end-stage renal disease (ESRD), with one dying as a result, while the other patients had a relatively good prognosis. Patients with a family history of renal disease had a poor prognosis. After excluding occasional factors and drug influences, our analysis indicated the existence of co-pathogenesis of arthritis with renal damage (especially FSGS). NPHS2 mutations might account for the family aggregation. Therefore, evaluation of more clinical cases is necessary to further clarify the underlying co-pathogenesis of these diseases.

First Report of Preimplantation Genetic Diagnosis for Steroid-Resistant Nephrotic Syndrome

Background: Steroid-resistant nephrotic syndrome is a genetic disease with autosomal recessive inheritance pattern and symptoms such as proteinuria and hypoalbuminemia and rapid progress of kidney disease. Preimplantation genetic diagnosis is an option for couples who are at risk of affected pregnancy to have a healthy child. Objectives: This study aimed to develop a new PGD test for a couple who are heterozygous for a mutation in NPHS2 gene and have a son affected to steroid-resistant nephrotic syndrome. Methods: Variant detection by cycle sequencing and Multiplex fluorescent PCR for identification of flanking STR markers were used to investigate the status of the embryos. Results: Three out of six embryos were transferable from which one was transferred and resulted in the birth of a healthy boy. Conclusions: We recommend increasing the number of the STR markers to two at the downstream of the NPHS2 gene especially in cases that direct mutation analysis such as cycle sequencing is not applied.

Generation of an induced pluripotent stem cell (iPSC) line (IMAGINi007) from a patient with steroid-resistant nephrotic syndrome carrying the homozygous p.R138Q mutation in the podocin-encoding NPHS2 gene.

Mutations in the NPHS2 gene, encoding podocin, are responsible for the majority of familial cases of steroid-resistant nephrotic syndrome (SRNS), a rare glomerulopathy that rapidly progresses to end-stage renal disease. We obtained peripheral blood mononuclear cells (PBMCs) from a patient carrying the homozygous c.413G>A substitution (p.R138Q) in NPHS2 gene, which is the most prevalent mutation in the European population. The PBMCs were reprogrammed by non-integrative viral transduction of the Yamanaka's factors. The resulting iPSCs display normal karyotype, express pluripotency hallmarks and are capable of multilineage differentiation, offering a useful tool to study pathological mechanisms of SRNS and perform drug testing.

A descriptive study of NPHS1 and NPHS2 mutations in children with congenital nephrotic syndrome

IntroductionCongenital nephrotic syndrome (CNS) is a rare disorder characterized by proteinuria, hypoalbuminemia, edema and hyperlipidemia at birth or within the first 90 days of life. NPHS1 and NPHS2 gene mutations encoding the slit diaphragm components: nephrin and podocin account for 78% of CNS cases. MethodsOur study was carried out to assess NPHS1 and NPHS2 gene mutations in 16 CNS Egyptian patients descending from 16 different families. Demographic, clinical, laboratory and pathological data of included patients were collected. The whole coding region of NPHS2 and nine exons of NPHS1 were sequenced. ResultsThe study showed a homozygous nonsense mutation c.3478C > T (p.R1160X) within exon 27 of NPHS1 gene in two patients. By comparing clinic-laboratory data of these two patients with other included CNS patients; a significant association between c.3478C > T (p.R1160X) and low free T3 serum level was noted. Patients with c.3478C > T (p.R1160X) had more proteinuria than others but did not reach the level of significance (p = .073). Moreover, five NPHS2 mutations were detected in five different patients; two homozygous mutations [23 bp duplication c.104–126 dup GCCGCGGGCGCCAGGAGGCTGG (p. P43Afs*64), and c.59C > T (p.P20L)], and three novel heterozygous missense mutations: c.345 G > A (M115I), c.346A > T (p.T116S), and c.732 T > A (p.D244E). ConclusionNPHS1 and NPHS2 gene mutations were found in 43.75% of Egyptian CNS children. NPHS2 contributed for 31% of the studied Egyptian CNS cohort. A phenotype–genotype correlation was noticed regarding c.3478C > T (p.R1160X) mutation in NPHS1 gene as it was significantly associated with decreased serum free T3 and increased levels of proteinuria compared to other CNS patients.

NPHS2 gene mutations in azerbaijani children with steroid-resistant nephrotic syndrome.

Nephrotic syndrome (NS) is characterized by proteinuria in children. Steroid- resistant NS (SRNS) is defined by resistance to standard steroid therapy, and it continues to be one of the most common causes of chronic renal failure. Molecular studies have revealed specialized molecules in different regions of the podocytes that play a role in proteinuria. Mutations in NPHS2 that encode for podocin constitute a frequent cause of SRNS worldwide. This study aimed to screen for podocin mutations in Azerbaijani patients with SRNS. Our study included 21 pediatric patients with SRNS aged between 0 and 18 years and the same number of healthy control groups. Mutational analysis of the NPHS2 gene was performed using direct sequencing methods. Disease-causing mutations in the NPHS2 gene were detected in eight patients (38%). Thirteen patients (62%) had NPHS2 mutations without causing the disease. Two patients had p.Val290Met homozygous mutation; two had p.Arg229Gln homozygous mutations; and one each had p.Pro20Leu homozygote, p.Leu169Pro homozygote, p.Arg138Gln homozygote, and p.Arg168His homozygous mutations. When we correlated the NPHS2 mutation status with disease progression, there was a statistically significant increase in serum creatinine, proteinuria, and serum albumin values in patients with NPHS2 gene mutations compared to the group without mutation (P <0.05). Our study concludes that mutations of the NPHS2 gene (38%) are heterogeneous in Azerbaijani SRNS patients. Based on our results, we support a model in which ethnicity plays an important role in certain NPHS2 mutations. NPHS2 mutation analysis may help to better predict the course of the disease, remove unnecessary long-term immunosuppressive therapy, and develop specific treatment.

Analysis of NPHS2 Gene Mutations in Egyptian Children with Nephrotic Syndrome.

BACKGROUND:Mutations in the NPHS2 genes are the main aetiology of early-onset and familial steroid-resistant nephrotic syndrome (SRNS). The pathogenic NPHS2 mutation together with the p.R229Q variant has been less described among Egyptian children.AIM:This study aims to determine the mutation of NPHS2 in children with NS and discover the role of p.R229Q variant in SRNSMETHODS:The study included 53 children with NS, and 53 healthy volunteers matched in age and sex controls. The median age at disease onset was 7.3 years. Among NS cases, 31 cases had steroid-sensitive nephrotic syndrome (SSNS) and 22 children with steroid-resistant nephrotic syndrome (SRNS). Polymerase chain reaction amplification of the whole coding region of NPHS2 gene was carried out for its mutational analysis. Restriction digestion testing was carried out after PCR to determine the presence of R229Q polymorphism. Randomly selected samples were re-genotyped by two independent technicians for assessment of Quality controlRESULTS:NS patients showed a significant higher frequency of heterozygous genotype GA (89.5%) compared to control group (10.5%) with increased risk of NS (OR, 12.04; 95% CI, 2.61 to55.38; p < 0.0001). Moreover, SRNS showed a significant higher frequency of GA genotype (68.2%) than the SSNS group (6.5%). The GA genotype was associated with increased risk of SRNS (OR, 31.1; 95% CI, 5.73 to 168.48; P < 0.001) and the A allele was associated with increased risk of SRNS (OR, 15.52; 95% CI, 3.325 to 72.422; P < .001).CONCLUSION:R229Q polymorphisms are associated with SRNS, and any child with SRNS should be searched for mutations in the NPHS2 gene.

Early or Late Transplantation in Congenital Nephrotic Syndrome: Which is Effective for Optimal Growth?

Congenital nephrotic syndrome (CNS) is a genetic disease that is present in the antenatal period or during the first 3 months of life. In this study, we aimed to compare growth parameters of patients with CNS who received kidney transplants and either (1) had a normal glomerular filtration rate (GFR) at the time of transplant or (2) chronic kidney disease (CKD) at the time of transplant. Patients with a diagnosis of CNS who had a minimum follow-up period of 6 months were evaluated retrospectively. Children at stages 4 or 5 CKD or patients receiving dialysis during the pretransplant period were defined as group 1; patients with normal GFR at the time of transplantation were classified as group 2. Short stature and low weight were defined as less than −2 standard deviation scores (SDS) for height and weight according to their age. A total of 17 patients were included in the study. Thirteen of 17 patients had NPHS1 gene mutations. Group 1 and group 2 consisted of 8 and 9 patients, respectively. Mean height SDS and mean weight SDS in group 2 were higher than group 1 in the pretransplant period (−4.34 ± 1.74 vs −2.84 ± 1.56; P = .011 and −3.54 ± 0.93 vs −1.83 ± 1.13; P = .008). In the post-transplant period, the significant difference in height SDS continued in favor of group 2 (−3.16 ± 1.11 vs −1.16 ± 0.87; P = .002). The short stature rate was 83% in group 1 and 72% in group 2 in the pretransplant period (P = .62), and 83% in group 1 and 27% in group 2 in the post-transplant period (P = .02). Early renal transplantation seems to be effective for optimal height gain in children with CNS.

A comprehensive analysis of NPHS1 gene mutations in patients with sporadic focal segmental glomerulosclerosis

BackgroundFocal segmental glomerulosclerosis (FSGS) is still one of the common causes of refractory nephrotic syndrome. Nephrin, encoded by podocyte-specific NPHS1 gene, participated in the pathogenesis of FSGS. The sites of NPHS1 mutations in FSGS is not clarified very well. In this study, we investigated the specific mutations of NPHS1 gene in Chinese patients with sporadic FSGS.MethodsA total of 309 patients with sporadic FSGS were collected and screened for NPHS1 mutations by second-generation sequencing. The variants were compared with those extracted from 2504 healthy controls in the 1000 Genomes Project. The possible pathogenic roles of missense variants were predicted by three different software. We also compared these candidate causal mutations with those summarized from the previous studies.ResultsThirty-two genetic mutations of NPHS1 gene were identified in FSGS patients, including 12 synonymous mutations, 17 missense mutations, 1 splicing mutation, and 2 intron mutations, of which c.G3315A (p.S1105S) was the most common variant (261/309). A novel missense mutation c.G2638 T (p.V880F) and a novel splicing mutation 35830957 C > T were identified in FSGS patients. The frequencies of the four synonymous mutations (c.C294T [p.I98I], c.C2223T [p.T741 T], c.C2289T [p.V763 V], c.G3315A [p.S1105S]) were much higher in FSGS patients than in controls. The frequencies of the four missense mutations (c.G349A [p.E117K], c.G1339A [p.E447K], c.G1802C [p.G601A], c.C2398T [p.R800C]) were much higher and one (c.A3230G [p.N1077S]) was lower in FSGS patients than in controls. Five missense mutations, c.C616A (p.P206T), c.G1802C (p.G601A), c.C2309T (p.P770L), c.G2869C (p.V957 L), and c.C3274T (p.R1092C), were predicted to be pathogenic mutations by software analysis.ConclusionsNPHS1 gene mutations were quite common in sporadic FSGS patients. We strongly recommend mutation analysis of the NPHS1 gene in the clinical management of FSGS patients.

In Silico Analysis of NPHS1 Gene Mutations Identified in Patients with Steroid Resistant Nephrotic Syndrome

In Silico Analysis of NPHS1 Gene Mutations Identified in Patients with Steroid Resistant Nephrotic Syndrome

In Silico Analysis of NPHS1 Gene Mutations Identified in Patients with Steroid Resistant Nephrotic Syndrome

Introduction: Steroid Resistant Nephrotic syndrome (SRNS) is a rare autosomal recessive kidney disorder caused by increased permeability of the glomerular capillary wall for macromolecules leading to heavy proteinuria, hypoproteinemia and edema. SRNS patients do not respond to steroid therapy and have a poor prognosis with high risk of end-stage renal failure. SRNS is caused by the genetic defects in podocyte expressed proteins which do not lead to recurrence after renal transplantation. To date several mutations in podocyte genes, NPHS1&amp;2 have been associated as an underlying genetic factor. Here we investigated the pathogenic effects of the NPHS1 gene mutations reported in Pakistani patients.

In Silico Analysis of NPHS1 Gene Mutations Identified in Patients with Steroid Resistant Nephrotic Syndrome

In Silico Analysis of NPHS1 Gene Mutations Identified in Patients with Steroid Resistant Nephrotic Syndrome

WT1 and NPHS2 gene mutation analysis and clinical management of steroid-resistant nephrotic syndrome.

Nephrotic syndrome (NS) is a kidney disease predominantly present in children with idiopathic condition; final stage of the disease progresses into end-stage renal disease. Generally, NS is treated using standard steroid therapy, however; most of the children are steroid sensitive and about 15-20% are non-responders (SRNS). Non-responsiveness of these children would be a risk with the possibility of mutational changes in podocyte genes (NPHS1, NPHS2, WT1, PLCE1). The mutation in podocyte genes is associated with SRNS. NPHS1, NPHS2, and WT1 genes are identified/directly linked to SRNS. The present study is a surveillance on the mutation analysis of WT1 (exons 8 and 9) and NPHS2 (exons 1-8) gene in SRNS followed by clinical management. In the present study, we analyzed these two genes in a total of 117 SRNS (73 boys and 44 girls) children. A total of five mutations were detected in six children. First, WT1 mutation was detected at 9th intron-IVS 9+4C>T position in one SRNS female patient. This WT1 mutation was identified in a girl having Frasier Syndrome (FS) with focal segmental glomerulosclerosis and a complete sex reversal found through molecular and karyological screening. In NPHS2, missense mutations of P20L (in two children), P316S, and p.R229Q, and a frame shift mutation of 42delG were detected. Thus, applying molecular investigation helped us to decide on treatment plan of SRNS patients, mainly to avoid unnecessary immunosuppressive treatment.

NPHS1 gene mutations confirm congenital nephrotic syndrome in four Brazilian cases: A novel mutation is described

Autosomal recessive mutations in NPHS1 gene are a common cause of congenital nephrotic syndrome (CNS). The disorder is characterized by massive proteinuria that manifests in utero or in the neonatal period during the first 3 months of life. NPHS1 encodes nephrin, a member of the immunoglobulin family of cell adhesion molecules and the main protein expressed at the renal slit diaphragm. Currently, there are approximately 250 mutations described in the NPHS1 gene distributed among all nephrin domains. The main objective of this study was to perform the analysis of the NPHS1 gene in patients with congenital nephrotic syndrome in order to determine the molecular cause of the disease. Direct sequencing of NPHS1 gene in four children was performed. Each patient was heterozygous for two pathogenic mutations disclosing the molecular cause of the disease in 100% of the cases. We identified six different mutations, consisting of one in-frame deletion, one frameshift, and four missense substitutions. The p.Val736Met mutation that is described here for the first time was considered pathogenic by different mutation predictive algorithms. Regardless of the type of mutation, three patients had a bad outcome and died Despite the small size of the cohort, this study contributed to the increasing number of deleterious mutations in the NPHS1 gene by describing a new mutation. Also, since we identified NPHS1 pathogenic mutations as the cause of the disease in all cases analyzed, it might be a frequent cause of CNS in the South Eastern region of Brazil, although the analysis of a larger sample is required to obtain more indicative epidemiological data.

SÍNDROME NEFRÓTICO RESISTENTE A CORTICOIDES EN PEDIATRÍA, ACTUALIZACIÓN

El síndrome nefrótico (SN) constituye la glomerulopatía más frecuente en pediatría. Las manifestaciones clínicas son derivadas de la hipoalbuminemia. El pilar del tratamiento continúa siendo de preferencia la terapia con corticoides. Dependiendo de la respuesta a los corticoides, se clasifica en síndrome nefrótico corticoresistente (SNCR) y corticosensible. La mayoría de los pacientes con SNCR tienen una Glomeruloesclerosis focal y segmentaria, asociada con un 50% de riesgo de enfermedad renal terminal, por lo que se recomienda la biopsia renal. Es importante la realización pruebas genéticas, ya que ciertas mutaciones resultan en corticorresistencia, siendo la mutación del gen NPHS2 (podocina) la más relacionada. Se incluyen las últimas investigaciones del tratamiento de esta entidad, los inhibidores de la calcineurina recomendados como terapia inicial, así como corticoides a altas dosis o en pulsos, ciclofosfamida, Mofetil micofenolato, Rituximab; obteniendo resultados variables por muestras pequeñas de pacientes en estos estudios. Con este artículo se pretende realizar una revisión actualizada de la literatura mundial y nacional acerca del SNCR en pediatría, en la búsqueda de nuevos enfoques de diagnóstico y tratamiento.

Novel NPHS1 gene mutations in a Chinese family with congenital nephrotic syndrome

Novel NPHS1 gene mutations in a Chinese family with congenital nephrotic syndrome

Mutation analysis of genes in a family with proteinuria syndrome

Objective To investigate the clinic features of a family present with proteinuria and microscopic hematuria, and screen 3 commonly pathogenic genes of hereditary proteinuria syndrome. Methods Clinical data of a family present with proteinuria and microscopic hematuria were collected and analyzed.Pedigree of the family was drawn.Urine screening was conducted to all members of the family.Peripheral blood was taken from all members of the family.Direct sequencing of all exons of NPHS1 and NPHS2 gene and exon 8, 9 of WT1 gene was performed on 2 patients and their parents. Results The family had 3 generations, 17 members.There were 2 sibling patients in the family.One was a female, the other was male.The average age onset was 1.3 years.Analysis of clinical data revealed the family genetic features was consistent with the autosomal recessive inheritance.The proband presented with initial steroid-resistant nephrotic syndrome.His renal pathological changes under light microscope showed focal proliferative glomerulonephritis.Under immunofluorescence microscope IgA, IgM, C1q and C3 were all negative, but type Ⅳ collagen α1, α3 and α5 chains were positive.The basement membrane was normal, and foot process fusion was found under the electron microscope.Two patients both had heterozygous p. R138Q(c.413G>A) and p. L156FfX11(c.467-468insT) in the NPHS2 gene exon 3 and 4.Analysis mutation of NPHS2 gene in the family revealed that p. R138Q missense mutation and p. L156FfX11 frameshift mutation were from their parents, respectively.Two mutations had been reported before, which were disease-causing mutation.The former was the most common mutation of NPHS2 gene in European population, but the latter only had been reported in the Chinese population. Conclusions The p. L156FfX11 mutation may be a specific mutation in Chinese children with nephrotic syndrome.Mutations of NPHS2 gene can not only cause proteinuria, but also be associated with microscopic hematuria.Renal pathological changes caused by NPHS2 gene mutation could not only become focal segmental glomerulosclerosis, but also be focal proliferative glomerulonephritis.Renal pathological changes may simply reflect the course of the disease. Key words: Proteinuria syndrome; Proteinuria; NPHS2 gene; Hematuria; Child

NPHS2 Gene Mutation and Polymorphisms in Indonesian Children with Steroid-Resistant Nephrotic Syndrome

Objective: Although several NPHS2 gene mutations and polymorphisms were described and associated with clinical manifestation of steroid-resistant nephrotic syndrome (SRNS), the occurrence of these genetic abnormalities or variants appeared to be influenced by race and ethnic group. We have investigated probable mutations and variants in NPHS2 gene involved in SRNS and their association with clinical manifestations. Methods: We examined 28 children with primary SRNS whovisited the pediatric nephrology division of 10 teaching hospitals in Indonesia. Molecular genetic studies of the NPHS2 gene were conducted through screenings for the exon 1, exon 2, and exon 8. The mutational analysis of NPHS2 was performed by DNA sequencing. Fisher’s Exact Test was used to determine the correlation between NPHS2 polymorphisms and clinical manifestations.Results: Seven females (25%) and 21 males (75%) participated in the study. The mean age of the subjects with 95% CI is: 7.6 (6.1 - 9.0) years while the mean age at onset of disease with 95% CI is: 5.4 (3.9 - 7.0) years. Sixteen patients (57.14%) were younger than 6 years at the onset of disease. Seventeen (60.7%) subjects had normal eGFR, while 11 (39.3%) had chronic renal insufficiency. The mean eGFR of the subjects with 95% CI is: 111.4 (87.7 - 135.1) ml/min/1.73 m2. The mean systolic blood pressure with 95% CI is: 117.0 (108.9 - 125.1) mmHg and the mean diastolic blood pressure with 95% CI is: 77.0 (70.3 - 83.7) mmHg. We identified 6 NPHS2polymorphisms, i.e. g.-52G>T, c.101A>G, g.-117C>T, c.288C>T, c.954C>T, and c.1038A>G and no mutation was found. There was no correlation between NPHS2 polymorphisms and clinical manifestations (p > 0.05). Conclusion: The results demonstrate no mutation of NPHS2 gene, and the 6 NPHS2 gene polymorphisms that were identified have no correlation with the clinical manifestation in Indonesian children with SRNS.

NPHS2 variation in Chinese southern infants with late steroid-resistant nephrotic syndrome

NPHS2 mutations are responsible for autosomal recessive familial steroid-resistant nephrotic syndrome (SRNS) with minor glomerular abnormalities or focal segmental glomerulosclerosis (FSGS), which is characterized by early childhood onset and rapid progression to chronic renal insufficiency. This gene mutation is also responsible for an adolescent onset form of autosomal recessive familial FSGS with heavy proteinuria. Many infants with late steroid-resistant nephrotic syndrome (late SRNS) are prone to an implicated clinical and therapeutic course. The etiopathogenesis and the long-term prognosis of late SRNS remain obscure. Considering the similar steroid resistance between late and initial SRNS, analysis of NPHS2 variation was performed in 70 sporadic Chinese infants with late SRNS and 70 controls in the present study to investigate the possible role of NPHS2 gene in late SRNS. The variation analysis revealed three polymorphisms (288C > T heterozygous in exon 2, 954T > C heterozygous and homozygous, and 1038A > G heterozygous in exon 8) in 22 out of 70 patients studied. In conclusion, NPHS2 gene mutations are not a major cause of chronic renal insufficiency caused by late SRNS in Chinese southern infants.

NPHS2 R229Q Polymorphism in Steroid Resistant Nephrotic Syndrome: Is it Responsive to Immunosuppressive Therapy?

Steroid-resistant nephrotic syndrome (SRNS) patients with NPHS2 gene mutations have been reported as non-responsive to immunosuppressive therapy. Inter-ethnic differences can have influence over the frequency of mutations. The present study was undertaken to find out the incidence and treatment response. Mutational analysis of NPHS2 gene was performed in 20 sporadic idiopathic SRNS, 90 steroid-sensitive nephrotic syndrome (SSNS) and 50 normal controls. NPHS2 gene analysis showed R229Q polymorphism in six SRNS (30%), four SSNS (4.4%) and 13 controls (26%). The polymorphism (G→A) showed Hardy-Weinberg distribution and risk allele (G) had strong association with the disease (odds ratio 3.14, 95% CI 1.33-7.43) than controls. Five cases of SRNS having polymorphism showed partial remission to cyclosporine and prednisolone. Overall, partial remission was achieved in 14(70%), complete remission in four (20%), one(5%) patient had no response and one(5%) died. Thus, NPHS2 gene showed R229Q polymorphism and patients achieved partial remission to therapy.