JAK2 Mutation Research Articles

A Dual-Specific Inhibitor of Rock/Aurk, RR-1752, for Primary Myelofibrosis

Myelofibrosis (MF) is a clonal myeloproliferative neoplasm (MPN) characterized by driver mutations in JAK2, CALR, and MPL resulting in constitutive activation of JAK-STAT signaling. Abnormalities in megakaryocyte (MK) numbers and morphology are a common feature of MF where abnormal MKs are associated with bone marrow fibrosis and pro-inflammatory cytokine release. Therapies that target constitutive JAK-STAT signaling and atypical megakaryocytes could provide clinical benefit for patients with MF. ROCK and Aurora kinase (AURK) are overexpressed in MPN and linked to dysregulated MKs of patients with MPN. We therefore tested the activity of RR-1752, a dual-specific inhibitor of ROCK and AURK, in preclinical models of MF. RR-1752 acted as an inhibitor of pSTAT3 in IL-2 stimulated human PBMC 1h post stimulation and significantly inhibited phosphorylated myosin light chain 2 (pMLC2) in two human MPN cell lines, HEL-92.1.7 and UKE-1, confirming an on-target action. RR-1752 inhibited colony formation by HEL-92.1.7 and UKE-1, (IC 50 = 25.2 nM and 54.6 nM respectively). RR-1752 also induced cell cycle arrest in HEL-92.1.7 and UKE-1 specifically at the G2/M checkpoint. RR-1752 was also tested in a hematopoietic colony formation assays of MF patient derived CD34 + cells. RR-1752 led to concentration specific inhibition of MF patient derived CD34 + cell colony formation between 100-190 nM demonstrating relevant activity against patient-derived MF samples (51% inhibition at 190 nM as compared to vehicle control). These data were in line with flow cytometrically determined cell viability data of MF CD34 + cells cultured in the presence of varying concentrations of RR-1752 in liquid culture. The in vivo activity of RR-1752, was examined using the human HEL- 92.1.7 cell line, homozygous for both JAK2 V617F and p53 M133K in a mouse xenograft model. The effects of RR-1752 alone and in combination with ruxolitinib were compared to single agent ruxolitinib. The administration of RR-1752, 25 mg/kg PO daily resulted in a significant (p<0.01) improvement in median survival (31 days) compared to ruxolitinib alone, 45 mg/kg PO daily (21 days). RR-1752 5.0 mg/kg PO QD plus ruxolitinib 45 mg/kg PO QD also resulted in a significant improvement in survival (p<0.05) compared to single agent ruxolitinib but was inferior to single agent RR-1752 at 25mg/kg. The demonstrated activity in MF patient derived CD34 + cells combined with the significant improvement in survival compared to the approved drug ruxolitinib in an aggressive, JAK2/p53 mutant MF xenograft model provides a compelling case for its evaluation as a therapeutic modality in MF patients. Dose optimization of RR-1752 alone and in combination with ruxolitinib in the HEL-92.1.7 IV dissemination model as well as testing in the hMPL-W515L-evoked myelofibrosis model is ongoing. Conventional treatments for MF have largely focused on symptom management but RR-1752 treatment could result not only in beneficial symptom improvement but also important disease modifying potential by inhibiting JAK-STAT signaling, cell cycle progression and targeting dysregulated MKs.

Genomic Landscape of Pediatric Non-Down's Syndrome Acute Megakaryoblastic Leukemia in China

Acute megakaryoblastic leukemia (AMKL) accounts for 4% to 15% of newly diagnosed pediatric acute myeloid leukemia (AML), and different from Down's syndrome AMKL (DS-AMKL) and non-AMKL, clinical outcomes of non-DS-AMKL are characterized by an inferior prognosis. Although comprehensive genomic studies have revealed key genomic aberrations of non-DS-AMKL in Western cohort, there is still no reports about Chinese patients. Here we report a comprehensive transcriptomic study on 100 Chinese pediatric non-DS-AMKL cases through 2009 to 2022 in Shanghai Children's Medical Center. A total of 133 rearrangements were detected involving 78 patients, including previously reported recurrent fusion events which defining subgroups of AMKL, namely CBFA2T3-GLIS2 (n=20, 20%), NUP98-KDM5A (n=16,16%), rearrangements of HOX cluster genes (HOXr, n=11, 11%), RBM15-MKL1 (n=5, 5%) and MLLr (n=3, 3%). Two new recurrent gene translocations, XPO1-TRNC18 and STAG2 rearrangements (STAG2r) were detected in 5 (5%) and 11 (11%) cases, respectively. Further unsupervised clustering analysis was done with the most variant coding genes defined by standard deviation, the results showed that cases carrying STAG2r and XPO1-TNRC18 fusion exhibited distinguishable gene expression pattern from other subgroups and were clustered together respectively. It suggested these two rearrangements as potential driver genomic alterations in AMKL. By introducing XPO1-TNRC18 fusion and three STAG2 aberrations (STAG2 knock-out, STAG2-GNA12 and STAG2-OCRL) into 32D cell line, we proved these gene alterations promoted cell proliferation and colonies formation, suggesting potential function in tumor transformation. Based on these evidences, we defined XPO1-TNRC18 and STAG2r as two new subgroups of AMKL. We identified 222 nonsynonymous sequency mutations affecting 137 genes totally, including 202 single-nucleotide variants and 20 insertion/deletion, with a median of two mutations for per case (range 0-6). Among driver abnormalities, 7 aberrations occurred in more than 3% of cases in current cohort, including JAK2 (n=15, 15%), MPL (n=13, 13%), PTPN11 (n=7, 7%), NRAS (n=5, 5%), GATA1 (n=4, 4%), CTCF (n=4, 4%) and JAK3 (n=3, 3%). All the mutations could be clustered into 8 pathways, and the most frequently mutated pathways were JAK signaling (30%), transcription regulation (29%) and RAS signaling (14%). Mutation frequency varied across different subgroups. For example, JAK/STAT lesions were enriched in STAG2r subgroup (p<0.05). Distinct genomic aberration profile was revealed while comparing results of this non-DS-AMKL cohort to the mutation profile of non-AMKL cohort which we have published before. CBFA2T3-GLIS2, NUP98-KDM5A, STAG2r, XPO1-TNRC18 and RBM15-MKL1 subgroups were merely detected in AMKL, while driver aberrations like FLT3-ITD, CBFB-MYH1 and so on were not detected in AMKL. For driver mutations, JAK2 (15% vs 3.7%, p<0.0001), MPL (13% vs 0%, p<0.0001 ) and CTCF (4% vs 0%, p=0.007) were detected more frequently in non-DS-AML, while NRAS (5% vs 18.8%, p<0.001), KRAS (2% vs 10.6%, p=0.008), KIT (1% vs 21.6%, p<0.001), CSF3R (1% vs 6.1%, p=0.047), FLT3 (0% vs 22.5%, p<0.001), CEBPA (0% vs 9.8%, p<0.001), AXSL2 (0% vs 8.6%, p<0.001), GATA2 (0% vs 6.1%, p=0.007) and DHX15 (0% vs 4.5%, p=0.038) occurred less frequently in non-DS-AMKL cohort. Survival analysis revealed association between key aberrations and clinical outcomes. Carrying CBFA2T3-GLIS2 (p=0.018), NUP98-KDM5A (p<0.001) and FUS-ERG (p=0.018) was associated with unfavorable prognosis. Driver mutations in JAK2 (p=0.03) and RAS pathway (p=0.01) were associated with shorter overall survival. Among the two new subgroups, the new XPO1-TNRC18 subgroup demonstrated similar clinical outcomes to MLLr cases, with 5-year EFS and OS of 50%, and STAG2r was characterized by a favorable clinical outcome, with 5-year EFS and OS over 75%. As the first comprehensive genomic landscape of Chinese pediatric non-DS-AMKL, our results defined two new subgroups with distinct expression patterns and prognosis characteristics. We further revealed a distinct mutation profile between AMKL and non-AMKL and shed light on association between driver aberrations and clinical outcomes. These findings revealed non-DS-AMKL as a heterogenous disease, and suggested the importance of exploration of risk-stratification and targeted therapy in different mutations driven cases.

Chromosome 9p Duplication Promotes T-Cell Exhaustion and Enhances Stem Cell Clonogenic Potential in JAK2-Mutant Myeloproliferative Neoplasms

Myeloproliferative Neoplasms (MPNs) are a diverse group of clonal hematopoietic disorders originating from a single hematopoietic stem cell, causing an excessive production of mature blood cells. Classic forms of MPNs include polycythemia vera, essential thrombocythemia, and myelofibrosis. The most common mutation is a gain-of-function point mutation in the JAK2 gene, known as JAK2V617F. This mutation leads to constant activation of the JAK-STAT signaling pathway, resulting in the overgrowth of MPN cells. Furthermore, the variant allele frequency (VAF) of JAK2V617F has a significant impact on the severity and phenotype of the disease. Alongside many described genetic mutations, cytogenetic abnormalities are commonly observed in MPNs, particularly involving chromosome 9. As the JAK2 gene is located on the short arm of this chromosome, we hypothesized that chromosome 9 copy number abnormalities might be a disease modifier in JAK2V617F-mutant MPN patients. To characterize the biological effects of chromosome 9 copy number abnormalities on JAK2-mutated MPN cells, we analyzed circulating CD34+ hematopoietic stem and progenitor cells (HSPCs) as well as monocytes and granulocytes from 32 MPN patients. Through Next Generation Sequencing, we categorized the patients into three main groups based on JAK2 mutation and copy number status: patients with two copies of the JAK2 gene with either heterozygous (VAF between 20% and 60%; n=10) or homozygous (VAF > 60% n=10) JAK2V617F mutation, or patients carrying mutant JAK2 and gene amplification (n=12). In-depth analysis of JAK2-amplified patients revealed that the amplification involved the entire chromosome 9p, thus including other gene loci like CD274, which encodes programmed death-ligand 1 (PD-L1). Further investigation of the order-of-events and clonal hierarchies through droplet digital PCR on CD34+ cell-derived colonies showed that most colonies of 9p-duplicated patients had three copies of JAK2, with 2 out of 3 alleles harboring the JAK2 mutation and that point mutations are frequently the initial pathogenic event in clonal evolution, followed by amplification of the JAK2-mutated allele. Functionally, CD34+ cells from +9p patients displayed high clonogenicity and gave rise to a greater number of primitive colonies (Colony Forming Unit-Granulocyte, Erythrocyte, Monocyte, Megakaryocyte, CFU-GEMM). As JAK2 hyperactivation had been previously reported to lead to increased PD-L1 expression, we further explored the functional significance of CD274 amplification in +9p patients. Our analysis showed increased PD-L1 messenger RNA and protein levels in +9p patient CD14+ monocytes compared to those from patients carrying only two copies of chromosome 9. Moreover, immunofluorescence analysis demonstrated significant re-localization of PD-L1 to the cytoplasmic membrane in monocytes from +9p patients, but not in JAK2V617F-homozygous patients (panel A). Increased levels of PD-L1, an immune checkpoint known to curb T cell activation, led us to analyze the T cell compartment, which resulted enriched in CD3+/CD8+/CD57-/PD-1+ exhausted T-cells in +9p patients compared to other MPN patients and healthy donors (panel B). In conclusion, our comprehensive characterization of the molecular interplay between JAK2V617F and chromosome 9 alterations, along with their immunological implications due to PD-L1 hyperactivation, fills a critical knowledge gap and provides valuable insights into the disease progression of 9p-MPNs. Further analysis is ongoing to explore the associations between 9p duplication and hematological parameters in 9p-MPN patients for a better understanding of the clinical implications of this genetic abnormality in MPNs.

A Real-World Evaluation of Risk Factors for Disease Progression in Patients with Polycythemia Vera (PV) Enrolled in REVEAL

Background: PV is a myeloproliferative neoplasm complicated by symptom burden, splenomegaly, vascular events, and disease progression to myelofibrosis (MF). Current risk models for PV include advanced age and history of thrombotic events (TEs), yet information on risk factors for PV progression is limited. In this analysis, we assessed the rate of PV progression to MF during the P rospective Obs ervational Study of Patients With Polycythemia Vera in US Clinic al Practices Trial (REVEAL) and assessed baseline demographics and disease characteristics as risk factors for PV progression. Methods: Criteria for enrollment in REVEAL included a physician-reported PV diagnosis. PV progression was defined by meeting any of the following criteria during the study: 1) Death from MF/myelodysplastic syndrome (MDS)/acute myeloid leukemia (AML); 2) new/worsening splenomegaly, plus 2 of the following criteria: white blood cell (WBC) count >11×10 9/L, platelets (PLT) <100×10 9/L, hemoglobin (Hb) <10 g/dL; 3) evidence of progression to MF from bone marrow (BM) biopsy; 4) new/worsening splenomegaly, plus blasts >1%. Univariate and multivariate logistic regressions were performed to assess risk factors of PV progression. Results: Of the 2510 patients enrolled in REVEAL, 1191 (47.5%) were reported to have a JAK2 mutation at enrollment. To confirm PV diagnosis, digital droplet PCR for JAK2 p.V617F was performed on all patients with the first available biospecimen from an optional biological specimen substudy; 1520/1871 (81.2%) were positive. A further 367 patients with a physician-reported JAK2 mutation and 135 with a PV diagnosis confirmed by BM aspirate/biopsy were included; 488 patients (19.4%) who did not meet any criteria were excluded. Of the 2022 patients with confirmed diagnosis, median (range) follow-up was 44.1 (0-59.5) months; 134 (6.6%) progressed to MF (BM evidence of MF, n=69 [3.4%]; new/worsening splenomegaly, plus 2 of the following criteria WBC count >11×10 9/L, PLT <100×10 9/L, Hb <10 g/dL, n=44 [2.2%]; new/worsening splenomegaly, plus blasts >1%, n=37 [1.8%]; death from MF/MDS/AML, n=22 [1.1%]). A nonsignificant trend toward higher mean JAK2 p.V617F variant allele frequency was observed in patients with vs without progression (Table 1). Compared with patients without progression to MF, patients with progression were of similar age (69.5 vs 68.0 y) and had a longer time from PV diagnosis to enrollment (median, 7.2 vs 3.7 y; P<0.0001; Table 1). The percentage of patients with vs without progression enrolled via academic practices was 23.1% vs 16.9%; the percentage of patients with vs without progression who had no cytoreductive treatment prior to enrollment was 85.1% vs 91.2%. PV risk stratification (age >60 y or history of TEs) at enrollment was similar for patients with vs without progression (high risk, 61.9% vs 63.5%). However, a higher percentage of patients with vs without progression had a history of TEs at enrollment (29.9% vs 19.7%; P=0.0050). Univariate analysis also identified hematocrit (HCT) ≤0.45 L/L (63.9% vs 53.5%; P=0.0288) and WBC count >11×10 9/L (50.4% vs 31.8%; P<0.0001) at enrollment as significantly different between patients with vs without progression, respectively (Figure 1). In univariate analyses, time from PV diagnosis, TE history, HCT ≤0.45 L/L, WBC count >11×10 9/L at enrollment were each associated with increased PV progression risk (Figure 1). These factors were retained as significant covariates in multivariate analyses with stepwise model selection (OR [90% CI]: time from PV diagnosis to enrollment, 1.030 [1.016-1.044], P<0.0001; history of TEs at enrollment, 1.96 [1.281-2.998], P=0.0019; HCT >0.45 vs ≤0.45 L/L, 0.637 [0.421-0.964], P=0.0330; WBC >11 vs ≤11×10 9/L, 2.205 [1.477-3.292], P<0.0001). Conclusions: This real-world analysis of prospective data from REVEAL found that 6.6% of patients with PV progressed to MF over the median 44.1 months of follow-up. Time from diagnosis to enrollment and history of TEs were each significantly associated with an increased risk of PV progression; the latter finding regarding TE history was unexpected and represents a potentially novel risk factor for PV progression. HCT ≤0.45 L/L and WBC >11×10 9/L at enrollment were also significantly associated with an increased progression risk. Additional analysis is ongoing to better understand the causal relationships between these risk factors and PV progression.

Durable Continuous Transfusion Independence (TI) with Imetelstat in IMerge Phase 3 for Patients with Heavily Transfused Non-Del(5q) Lower-Risk Myelodysplastic Syndromes (LR-MDS) Relapsed/Refractory (R/R) to or Ineligible for Erythropoiesis-Stimulating Agents (ESAs)

CONCLUSIONS MDS are serious life-threatening hematologic malignancies in which a heterogeneous group of clonal disorders results in ineffective hematopoiesis. An unmet need remains for new therapies for patients (pts) with LR-MDS who are red blood cell transfusion dependent (RBC-TD) and R/R to or ineligible for ESAs. Imetelstat, an oligonucleotide, is a first-in-class telomerase inhibitor that targets cells with high telomerase activity by direct binding to the RNA template of telomerase. In the IMerge phase 3 trial, imetelstat produced higher rates of TI for ≥8 weeks, ≥24 weeks, and ≥1 year (39.8%, 28.0%, and 17.8%) than placebo (15.0%, 3.3%, and 1.7%) in pts with non-del(5q) LR-MDS that was RBC-TD, R/R to/ineligible for ESAs, and naïve to lenalidomide or hypomethylating agents (HMAs; Platzbecker et al. EHA 2023. Abstr S165). We report characteristics and clinical benefit for pts with sustained TI for ≥1 year from this trial. IMerge (MDS3001, NCT02598661) is a global, double-blind, randomized, placebo-controlled, phase 3 trial of imetelstat in RBC-TD, ESA-R/R, non-del 5(q) lenalidomide/HMA-naïve LR-MDS. The primary end point was 8-week TI rate; secondary end points included safety, 24-week TI, duration of response, hematologic improvement, and MDS response. Exploratory end points included assessment of cytogenetic response and mutational status with clinical response. The proportion of pts with>1-year TI and other binary end points, were summarized with percentage and 95% 2-sided exact Clopper-Pearson CI. The Kaplan-Meier method was used to estimate the distribution of TI. Of 118 pts receiving imetelstat, 21 (17.8%; 95% CI, 11.4-25.9) achieved ≥1-year sustained TI, representing 45% of ≥8-week TI (21 of 47 pts) and 64% of ≥24-week TI (21 of 33 pts); of 60 pts receiving placebo plus supportive care, 1 (1.7%; 95% CI, 0-8.9) achieved ≥1-year TI. Of the ≥1-year TI imetelstat responders, 15/21 (71.4%) had ring sideroblasts, as did the 1 placebo pt. The median prior RBC transfusion burden was 6 U over 8 weeks (range, 4-9 U) for the imetelstat group and 5 U for the placebo pt. Additional baseline characteristics are in the table. Pts received imetelstat for a median of 101.1 weeks (range, 75.1-163.9 weeks) and a median of 24 cycles (range, 18-41 cycles). The median duration of TI for imetelstat ≥1-year TI responders was 123 weeks (95% CI, 80.4 to not evaluable); the median increase in hemoglobin during the longest TI interval was 5.18 g/dL (range, 2.67-13.76 g/dL) for the imetelstat group vs 1.67 g/dL for the placebo pt. After a median follow-up of 125 weeks, none of the patients with ≥1 year TI on either arm progressed to acute myeloid leukemia (AML). Of the pts receiving imetelstat, 7 had an abnormal karyotype at baseline, of which 6 had reduction in the cytogenetic abnormal clones (4 with cytogenetic complete response and 2 with cytogenetic partial response by independent review committee). Mutation data were available for 18 pts receiving imetelstat, all with SF3B1 mutations present at baseline, and multiple of these pts concurrently had TET2, DNMT3A, ASXL1, or JAK2 mutations. The maximal reduction ranged from −6% to −100% in SF3B1 variant allele frequency (VAF) in these pts, and 13 of 18 (72.2%) achieved ≥50% VAF reduction, including 7 with complete elimination of the VAF. Reduction in other concurrent mutations was also observed in these pts. Safety was consistent with that previously reported; most frequent adverse events were reversible grade 3 or 4 thrombocytopenia and neutropenia. At the time of data cutoff (May 10, 2023), 13 pts receiving imetelstat and the pt receiving placebo were ongoing (Figure); of the 8 who discontinued treatment, 7 had loss of response, and 1 was due to adverse event. Analyses for progression-free and overall survival were not evaluable as of this cutoff date (insufficient follow-up). Treatment with imetelstat resulted in ≥1-year sustained, continuous TI in 17.8% of pts in the IMerge phase 3 trial. In this ESA-R/R/ineligible population with a high prior transfusion burden, a reduction to 0 RBC transfusions for ≥1 year represents an opportunity to achieve relief from iron overload and other transfusion associated complications, and decreased demand on already limited blood product supply. Furthermore, durable TI and meaningful reductions in mutational burden suggest imetelstat may have disease-modifying activity.

Derangements of TLR2 Likely Play a Significant Role in the Thrombosis of Ph(-) Myeloproliferative Neoplasm

Introduction . We had previously reported that TLR 2 levels were significantly elevated in patients with polycythemia vera and MPN ( PV , ET, MF grouped together ) and TLR2 levels were related to JAK2 mutation and leukocytosis ( Blood (2022) 140 (Supplement 1): 12185-12186.). Since MPN has increased incidence of thrombosis in patients with JAK2V617F mutation and leukocytosis , therefore , current studies were done to test whether TLR-2 is related to thrombosis in MPN . In vitro platelet activation ( an pre-thrombotic marker) and clinical episodes of thrombosis were then investigated. . Material and Methods. 119 patients ( 51ET, 37 PV, 31MF, 21 CTR) were studied . 1) platelet activation. : The diluted blood was incubated with platelet agonists Pam3CSK4 (TLR2 agonist) or lipopolysaccharide (LPS) (TLR4 agonist) for 15 minutes at room temperature , then platelet activation was measured by Flow cytometry assaying CD40L, P-selectin, PAC-1 and LPI ( leukocyte-platelet-interaction). We obtained more consistent results from the LPI methods . Therefore, LPI methods were used to measure the platelet activation. LPI method was measured by CD45 and CD41 antibodies (Miltenyi Biotec, Auburn, CA), and platelet activation were measured as the percentage of CD45 cells with aggregated CD41. To test whether TLR2 or TLR4 were responsible for the LPI response ,TLR2 inhibitor C29 (InvivoGen, San Diego, CA) or the TLR4 inhibitor C34 ((Sigma-Aldrich, St. Louis, MO) were added to the LPI assay. Effects of inhibitions were measured by fold-changes which were calculated by dividing the LPI values after activation by either Pam3CSK4 (TLR2 agonist) or LPS (TLR4 agonist), with or without added inhibitors, by the LPI values before activation or inhibition. Results . 1) As shown in Fig A, a) un-activated MPN (U-MPN) patients had more LPI than un-activated controls (u-CTR), with mean ± SE of 13.01 ± 1.12 and 5.01 ± 0.97 in U-MPN and U-CTR, respectively (P<0.01). This is consistent with previous reports that un-activated MPN patients have more intrinsically activated platelets than un-activated controls .b) Greater LPI response by activation by Pam3CSK4, (TLR2 agonist ) than by LPS ( lipopolysaccharide)) (TLR4 agonist) . MPN and controls ( mean ± SE ) were of 22.25 ± 0.99 and 10.46 ± 0.44 ( by Pam3CSK4) and 12.12 ± 2.16 and 4.34 ± 0.32 ( by LPS) (P<0.0005) respectively . 2). Fig B showed the TLR2 inhibitor C29 significantly suppressed LPI ( measured by fold-changes ) , in un-activated MPN (0.38 ± 0.05), activated controls (0.42 ± 0.11), and activated MPN (0.42 ± 0.05). Conversely, the TLR4 inhibitor C34 had no inhibitory effect on un-activated MPN (0.98 ± 0.03), activated MPN (1.02 ± 0.02), or activated controls (0.84 ± 0.06) . 3) As shown in Table 2 , TLR 2 levels elevated Patients ( TLR2-E) ( defined as more than mean plus 2 standard deviation of controls (> 310 MFI) , have more thrombosis episode (29%) than TLR2 -normal patients (11%) . Conclusion . TLR2 likely plays a significant role in thrombosis in MPN patients on the basis : 1) JAK2 mutated patients have more TLR2 levels 2) TLR2-E patients have more leukocytosis than TLR-N patients 3) LPI was significantly elevated with TLR2 agonist ( Pam3SK4) but not by TLR4 agonist ( LPS) , and LPI was significantly decreased by TLR2 inhibitor and not by TLR4 inhibitor. 4) clinical evidence of more thrombosis in TLR -E patients than TLR-N patients.

SH2B3 Mutations in Patients with JAK2-Negative Erythrocytosis

Introduction: Erythrocytosis is a common reason for referral to Hematology clinics. Molecular testing for JAK2 mutations, often by next-generation sequencing (NGS), has become part of the diagnostic workup of patients with erythrocytosis, increasing the molecular characterization of this previously undifferentiated patient population. A recent study (Bhai et al. 2022) found that 4% of patients referred for JAK2-negative erythrocytosis harboured variants in the SH2B3 gene, which encodes the LNK protein, a known negative regulator of JAK2/STAT5 signaling. The objective of this study was to characterize a cohort of patients with JAK2-negative erythrocytosis with SH2B3 mutations, evaluating clinical presentation, hematologic parameters, as well as cardiovascular and thrombotic outcomes. Methods: All adult patients referred to the London Health Sciences Centre, a tertiary care centre in Southwestern Ontario, for assessment of erythrocytosis (hemoglobin >160g/L in women; >165g/L in men) between January 1, 2018 and December 31, 2022 and who underwent NGS testing were reviewed. NGS testing was performed using the Oncomine Myeloid Research Assay (Thermofisher Scientific, MA, USA). Patients with JAK2, CALR, MPL, or BCR::ABL1 mutations were excluded. Patients without JAK2 mutations ( JAK2-negative) with variants in SH2B3 were further characterized. Clinical variables included risk factors for secondary erythrocytosis and occurrence of arterial/venous thrombotic events. Laboratory variables included complete blood count and white cell differential. Results: Sixteen patients with JAK2-negative erythrocytosis met inclusion criteria with mutations in SH2B3. All mutations in SH2B3 were characterized as Tier III variants (Variants of Uncertain Significance). Laboratory and clinical parameters in this patient population are presented in Table 1. Mean hemoglobin was 181 g/L, hematocrit 0.54 L/L, leukocyte count 7.2 x10 9 cells/L, and platelets 229 x10 9 cells/L. Secondary causes of erythrocytosis were identified in 13 (81%) patients: 10 (63%) reported active smoking or had a smoking history, 4 (25%) had obstructive sleep apnea, 2 (13%) had chronic obstructive pulmonary disease, 1 (6%) had a right-to-left cardiac shunt, 4 (25%) were on an SGLT2 inhibitor, and 1 (6%) reported testosterone use. Of note, one patient had a history of stroke and another had a myocardial infarction both of which predated the development of erythrocytosis and NGS testing. One patient had a recurrent deep vein thrombosis (DVT) at the time of NGS testing. Full molecular data and comparative analysis with other cases of JAK2-negative erythrocytosis will be presented at ASH. Discussion: SH2B3 mutations have been identified in rare cases of congenital erythrocytosis and implicated in the pathogenesis of erythropoiesis. To our knowledge, this is the largest cohort of patients with JAK2-negative erythrocytosis with variants in SH2B3 reported to date. This cohort showed similar laboratory parameters and prevalence of secondary risk factors for erythrocytosis as previously reported in the general population of patients with JAK2-negative erythrocytosis at our centre (Chin-Yee et al. 2022). Thrombotic outcomes were also similar, and lower than patients with polycythemia vera. Given the high prevalence of potential secondary causes of erythrocytosis in our cohort we cannot confirm that SH2B3 mutations are causally implicated in elevated hemoglobin in these cases. Nonetheless, we cannot exclude that SH2B3 variants may confer an additional risk factor for erythrocytosis in this patient population. Further research is required to elucidate the potential impact of SH2B3 variants in patients with JAK2-negative erythrocytosis.

Conventional Cytogenetic Analysis and Array CGH+SNP Identify Essential Thrombocythemia (ET)/Prefibrotic Primary Myelofibrosis (pre-PMF) Patients Who Are at Risk for Disease Progression

ET and pre-PMF are myeloproliferative neoplasms (MPNs) that are each characterized by thrombocytosis but are difficult to distinguish by clinical and histopathological criteria. Moreover, each has the propensity to progress at variable rates to more advanced forms of the disease. The cause of progression to more overt forms of myelofibrosis (MF) or accelerated /blast phase (AP/BP) has yet to be fully understood, making prognostication difficult. To identify patients (pts) who are at risk for disease progression, we retrospectively reviewed the karyotypes from conventional cytogenetics (CC) and array Comparative Genomic Hybridization + Single Nucleotide Polymorphism (aCGH+SNP) of 158 pts with a diagnosis of ET or pre-PMF from 2017 to 2022 at our institution. Among these pts, 58% were female (92 pts) and 42% were male (66 pts), and the median age was 61 years (range 13-92). Mutational analysis was performed in 155 pts, and JAK2 mutations were present in 63% of cases, CALR in 19%, and MPL in 7% of cases. The remaining 11% of pts were triple negative. An abnormal karyotype was observed in 15% (24/158), and the remaining 85% (134/158) were either normal or had non-diagnostic results due to failed or limited peripheral blood chromosome analysis. Of the 111 pts that had aCGH+SNP testing, 6% (7/111) had prior abnormalities as detected by conventional cytogenetic analyses, while abnormalities were found in 30% (33/111) with aCGH+SNP exclusively. In this cohort, 29% (46/158) of pts underwent disease progression. Among these cases, 65% (30/46) had progression to either MF or chronic myeloid leukemia or myelodysplasia, and 22% (10/46) progressed to AP/BP. In addition, 13% (6/46) evolved to polycythemia vera. Disease progression, irrespective of its form, was associated with genomic alterations detected by aCGH+SNP, cytogenetic analysis, or both at the time of first encounter. Of the 46 pts undergoing progression during their clinical course, 65% (30/46) had an abnormal genomic finding by either technology compared to 35% (16/46) who were normal (p<0.001). Strikingly, among 24 pts who were abnormal by classical cytogenetics, 79% (19/24) progressed to either AP/BP or MF compared to only 20% (26/125) who were cytogenetically normal (p<0.001). As shown in Figure 1, there was a shorter progression-free survival among pts who were cytogenetically abnormal as compared to normal pts (p<0.001). Among 134 pts with ET/pre-PMF who were normal or had non-diagnostic results by classical cytogenetic studies, aCGH+SNP testing was performed in 104 cases and additional genomic aberrations were detected in 32% (33/104). Within this group, 30% (10/33) progressed to MF with a trend towards a shorter progression-free survival. In those patients that progressed to MF, the most frequent abnormality was 9p CNLOH occurring in 6 pts. In the remaining 71 pts that were cytogenetically and aCGH+SNP normal, only 11% (8/71) had disease progression. Overall, the combination of both conventional cytogenetics and aCGH+SNP increased the sensitivity of detecting genomic abnormalities from 15% (cytogenetics alone) to 37% when incorporating aCGH+SNP. These data indicate that genomic alterations detected by conventional cytogenetic analyses or CGH+SNP array identify a subset of ET/pre-PMF pts that are at a higher risk of disease progression.

Preclinical Evaluation of JAK2 Specific Investigational Oligonucleotide for the Treatment of MPNs

Background: Myeloproliferative neoplasms (MPN) are clonal hematopoietic stem cell malignancies with cytokine independency or hypersensitivity. Polycythemia vera (PV), an acquired MPN characterized by increased blood cell mass and hematocrit and leukocyte count, is associated with incidental myelofibrosis (MF). Myelofibrosis (MF) is a chronic and progressive disorder characterized by bone marrow fibrosis, extramedullary hematopoiesis, leukoerythroblastosis and splenomegaly. Essential Thrombocythemia (ET) is another type of MPN associated with increased number and size of circulating platelets. All MPNs leave patients at risk for progression to leukemia. Abnormal cytokine signaling due to an aberrant JAK2-STAT pathway has a vital role in pathogenesis of various MPNs. JAK2 mutations can result in hematologic malignancies, where hyperactive signaling of the JAK2-STAT pathway promotes tumor cell proliferation, invasion, and angiogenesis. Increased JAK2 kinase activity is observed in hematologic malignancies; somatic JAK2 V617F gain-of-function mutations are found in large numbers between different subtypes of MPNs patients (40-95%) and are also implicated in MDS-MPN cases. We hypothesize that preventing JAK2 transcriptionby antisense oligonucleotide (ASO) mediated exon masking of the JAK2 intron-exon junction will result in reduced JAK2 mRNA, and thus JAK2 protein, by providing nonsense mediated decay (NMD) in the reading frame. This may alleviate disease manifestations of many patients suffering from different forms of MPNs. Methods: This study utilized a HEL92.1.7 cell line harboring the V617F JAK2 gain-of-function mutation. Antisense Oligonucleotides (ASOs) are small fragments of DNA/RNA that have the ability to reduce production of target protein via interaction with RNA. We designed a series ASOs targeting JAK2 sequence and tested these at a range of concentrations. The ASOs were designed and prioritized based on in silico binding affinity and limited off-target activity. HEL92.1.7 cells underwent treatment with several ASO-prototypes and functional readout at the end of 72h of incubation. Results: We observed significant JAK2 protein decrease (~50%) in ASO-treated samples compared to untreated samples. JAK2 qPCR results confirmed reduction of target transcript in 40-60% range. STAT5 phosphorylation status further confirmed this effect, and we report a ~35% pSTAT5 reduction. Furthermore, this ASO showed limited off-target effects in silico. siRNA and CRISPR knockout protein lysates were used as internal controls. Our preclinical data support our ASO as a highly specific JAK2 agent, affecting direct levels of JAK2 as well as downstream STAT signaling. Conclusions: Around 50-60% of primary MF patients harbor the JAK2 V617F gain-of-function mutation. ASOs offer the capability to directly target JAK2-driven neoplasms with highest precision and effectively reduce JAK2 protein production, without off-target effects linked with small molecules targeting various kinase families. The ability to reduce JAK2 protein may alleviate the disease burden that patients with hematologic malignancies face, resulting in a higher quality of life through prevention and treatment.

Proteomic Profiling Identifies Unique IDH Mutant Signatures and Novel Therapeutic Opportunities in Adult Acute Myeloid Leukemia Patients

CONCLUSION Patients with IDH mutations are common in adult Acute Myeloid Leukemia (AML), with selective IDH inhibitors (IDHi) being recommended, but they do not always respond. We evaluated the proteome of IDH mutant AML patients to identify prognostic signatures and therapeutic targets. The expression of 429 proteins (339 total, 90 post-translational modified) were measured by Reverse Phase Protein Array in fresh samples from 805 newly diagnosed AML patients, and normalized to normal CD34+ cells. We analyzed 151 patients with IDH mutations (IDH1 = 56, IDH2 = 76, both = 19), treated with AraC-based combination therapy (N=71, including 5 with IDHi, 11 with Venetoclax (VTX)) or Hypomethylating agent based (HMA, N=65, + IDHi=5, +VTX=11, or both=2) and 3 received IDHi monotherapy, Proteins prognostic for Overall Survival (OS) were identified using pairwise LogRank tests (p<0.05) adjusted for False Discovery Rate (FDR), followed by unbiased hierarchical clustering. Continuous and categorial variables were compared with Wilcoxon, Kruskal-Wallis (KS) or Fisher's Exact test with simulated p-values (10000 replicates). Cox proportional hazards models (CoxPH) were developed for Uni-(UV) and Multi-variate (MV) analysis. Differentially expression (DE) analysis was performed using the KS test and pairwise Dunn's tests with p-values adjusted with FDR (p<0.01). Deep neural network analysis using random forest models identified proteins most predictive of cluster assignment. 97 proteins were individually prognostic for OS, and formed 3 patient clusters (Fig. 1: C1=red, C2=blue, C3=green). Most clinical and molecular features were not biased between clusters, however C2 had more cases with primary AML, diploid karyotype (kar.), intermed. cytogenetic (cyto.) risk, and IDH+FLT3_ITD or NPM1 mutants, while C3 has more cases with unfavorable cyto. risk, complex kar., and mutations in IDH+EZH2 or TP53, and ASLX1+IDH combination were more frequent in C1. Of note, C1 has the largest proportion of VTX-treated patients, while C3 has the largest proportion of IDHi-treated ones. The OS (Fig. 2) of C1 patients was better (Median: C1=42.2mo, C2=18.3mo, C3=10.7mo; p=0.0021), but no difference was noted for Complete Remission Duration (CRD) (Median: C1=72.3mo, C2=21.6mo, C3=33.4mo; p=0.7). The OS was similar when patients were filtered by specific mutations or combinations, e.g. IDH1, IDH2, and IDH combined with ASLX1, RUNX1 or TET2, or by other features, e.g. 56-70 age group, males, primary AML, intermed. cyto. risk, diploid kar., VTX or HMA without IDHi and/or VTX (HMA-TX) therapies. CoxPH models showed only C1 and C3 predictive for OS in the UV analysis (HR=1, 1.5, 2.3; p=ref., 0.22, <0.001), along with age, secondary AML, complex, diploid and del12 kar., HMA-TX, and IDH1, IDH2, NPM1, TP53, DNMT3a and JAK2 mutations. In the MV analysis, C1, C2 and C3 (HR=1, 2.6, 3.4; p=ref., 0.019, <0.001), age, secondary AML, complex and diploid kar., HMA-TX and IDH1 mutation predicted OS. Regarding CRD, no cluster was predictive in the UV model (HR=1, 1.2, 1.4; p=ref., 0.65, 0.41), but age, secondary AML, complex kar., HMA-TX, and ASLX1, EZH2 and IDH2 mutants were. In contrast, C1 and C3 (HR=1, 2.3, 2.6; p=ref., 0.13, 0.046) predicted CRD in the MV model, as well as secondary AML, HMA-TX and IDH2 mutation. epigenetics, DNA damage response, cell cycle and metabolism, with 23, 12, 12, and 11 proteins. DE analysis identified 133 proteins among 429, including: ADM, LCK and BTK up-, and TP53BP1 and PRMT1 down-regulated in C1; ANXA1 up-, and PTK2 and SRC down-regulated in C2. In C3, TGM2 is higher than normal, although lower than in C1. Inhibitors for upregulated proteins are in clinical development, potentially working as synergistic agents. Furthermore, a set of 5 proteins (SMARCB1, SMARCA2, WTAP, PIK3CB and RAD50) predicted cluster membership with 97% of accuracy, useful for quickly identifying patients and personalizing therapy. Proteomics identified unique protein profiles that were independently prognostic for outcome in IDH mutant AML patients. We identified upregulated proteins for which inhibitors are in development, suggesting potential therapeutic synergies to improve outcomes. Finally, we defined 5 proteins that accurately stratifies IDH patients for novel treatment recommendations.

The ELN 2022 Risk Stratification Has No Impact on the Dismal Prognosis of Patients with Acute Undifferentiated Leukemia

Introduction: Acute undifferentiated leukemia (AUL) is a rare subtype of acute leukemia. It is characterized by lack of expression of myeloid or lymphoid lineage markers, frequently expressing CD56 or CD7. The dismal prognosis of AUL was reported in small studies; the largest previously reported group with this disorder included 24 patients (Weinberg, Mod Pathol, 2019). Furthermore, data are lacking regarding cytogenetic and molecular patterns of AUL. In this study, the cytogenetic and molecular changes of AUL patients are described, together with the clinical outcome. Methods: AUL was defined, in accordance with the WHO classification, as an acute leukemia that does not qualify for myeloid, B- or T-cell lineage. Immunophenotyping of BM cells at diagnosis was performed using 8-color flow cytometry. Multi-parameter Cytognos acute orientation tube (ALOT) and the combination of the following antigens were used: CD34/CD117/CD14/CD56/CD36/CD123/HLA-DR/CD45/CD64/CD11c. (Weinberg, Mod Pathol, 2019). Results: Three hundred and eighty-five patients with acute myeloid leukemia (AML) were diagnosed at Rambam Health Care Campus in Haifa, Israel between April 2015 and April 2021, of whom 30 (8%) were defined as AUL. The baseline characteristics are presented in Table 1. The median age was 62 years, none of the patients harbored NPM1 mutation, with 1 patient expressing FLT3-ITD mutation. Cytogenetic analysis was completed for all patients: 9 (30%) had adverse-risk cytogenetics by ELN 2022 criteria. A comprehensive molecular study using molecular inverted probe was performed on all patients, with final results available on 17. Nine of these 17 (53%) had high-risk mutations; RUNX1 was found in 4 patients. Notably, 4 other patients had JAK2 mutation, with or without previous myeloproliferative neoplasm. Only 3 patients had mutations characterizing secondary AML (Lindsley, Blood, 2015). Only 2 patients in this cohort had TP53 mutation or del17p. Fourteen patients were classified as adverse-risk AML by ELN 2022 using cytogenetic and molecular markers, while 15 were classified as intermediate risk. Only 4 patients in this adverse-risk cohort were not allogeneic hematopoietic stem cell transplant (HSCT) candidates due to age or comorbidity limitations. The outcome of the cohort is presented in Table 2. Twenty-two fit patients received 7+3 intensive chemotherapy, of whom 10 achieved complete remission (CR) after induction. Four of the 10 patients needed reinduction chemotherapy due to a high blast count on the bone marrow performed at day 14. Five patients were treated with low-intensity therapies such as hypomethylating agents ± novel agents; 2 achieved CR. One patient received FLAG-Ida chemotherapy and another patient was treated with ECOG1910 protocol due to clinical presentation more compatible with acute lymphoid leukemia; both achieved CR. Of the 14 patients achieving CR, 4 relapsed before HSCT and needed further salvage therapy. Eventually, 13 (50% of the transplant-eligible candidate cohort) patients proceeded to HSCT. Relapse occurred in 14 patients (10 post-HSCT and 4 before HSCT), none of them achieved long-term survival. Four of the 30 patients are alive, all in remission. The median overall survival of the entire cohort is 1 year (Fig 1). The outcome of patients with adverse or intermediate risk according to the ELN risk classification did not differ. The CR rate and relapse rate and median overall survival (OS) were similar in both groups (Table 2; Fig 1). Discussion: These data emphasize the dismal outcome of patients diagnosed with AUL, with the 5-year OS of 7.5%, far lower than the survival of other types of acute leukemia. In this cohort, 15 patients were classified as intermediate risk AML; yet, their CR rate and long-term survival were not different from the whole cohort. The CR rate achieved with the widely used 7+3 protocol, was inferior, raising the question whether this protocol should be the “standard of choice” in such patients. A limitation of this study is that not all patients were evaluated by the NGS panel, bringing about the issue whether more patients had high-risk mutations, who would then be classified as adverse risk. Conclusion: The unique subtype of AUL is associated with a particularly adverse risk genotype, irrespective of known prognostic determinants, as in the 2022 ELN classification.

Picalm::MLLT10 can Identify a New Subgroup of Acute Leukemias of Ambiguous Lineage with Unique Extramedullary Disease and Treatment Response

Background: Mixed-phenotype acute leukemias (MPAL), which is included in acute leukemias of ambiguous lineage (ALAL), can be classified as four different subtypes based on recurring genetic alterations including BCR::ABL, KMT2A and ZNF384 gene rearrangement as well as BCL11B activation. The 2022 WHO classification has already mentioned PICALM::MLLT10 fusions are also enriched in MPAL but need more data. In 2022 ELN classification, PICALM::MLLT10 was identified as acute myeloid leukemia (AML) with other rare recurring translocations but not ALAL. In addition, there is no separate classification for PICALM::MLLT10 in the new ICC classification. Therefore, it is still confused whether PICALM::MLLT10 corresponds to AML or acute lymphoblastic leukemia (ALL) or ALAL. Methods: Fourteen PICALM::MLLT10 positive patients of 390 AL patients (14/390, 3.6%) were identified by RNA sequencing (RNA-seq) in our center from 2020-2022, including 8 female and 6 male, with a median age of 33 years (16-50 years). These patients were newly diagnosed AL according to bone marrow morphology and immunology including 5 ALAL, 5 T-ALL [ 4 early T-cell precursor ALL (ETP-ALL), 1 cortical T-ALL], 2 AML, 1 B-ALL with aberrant expression of myeloid antigen, and 1 B/T MPAL. Results: The mean white blood cell counts of these patients was 8.25×10 9/L (2.34-51×10 9/L) and platelet counts was 168.5×10 12/L (39-429×10 12/L) individually. It should be mentioned that extramedullary disease (EMD) was found in 7 cases (7/14), including mediastinum, tonsil, and skin. In terms of immunotyping, CD7 was identified in all patients (14/14) and CD33 in 71.4% (10/14) patients. The major concurrence mutations were PHF6 mutation (8/14), JAK3 mutation (5/14), and SUZ12 mutation (4/14). Characteristic cytogenetic abnormality t(10;11)(p12.3;q14.2) was only found in three cases (3/14) (Table 1). The PICALM breakpoints are mainly concentrated in exon 17 (n=6) and exon 19 (n=8). Exon 4 (n=8), exon 6 (n=2), exon 9 (n=2) and exon 10 (n=2) are the most commonbreakpointsof MLLT10. To our knowledge, this is the first report about the breakpoints and fusion gene forms of PICALM::MLLT10. For initial treatment, these patients individually received standard ALL induction chemotherapy (VDPCP, vincristine, idarubicin, pegaspargase, cyclophosphamide, prednisone) and AML induction chemotherapy (3+7 IA regimen including idarubicin, cytarabine). The initial complete remission (CR) rate was only 35.7% (5/14), and 9 patients showing no remission (NR). These NR patients subsequently received salvage chemotherapy. It is worth mentioning that 6 of them received combined chemotherapy regimen including low doses of cytarabine (LDAC), granulocyte colony-stimulating factor (G-CSF) and anthracyclines such as aclarubicin or idarubicin or homoharringtonine (CAG or IAG or HAG), and 2 of 6 patients also further received combination therapy with venetoclax (CAG or IAG +VEN). Finally, 5 of them dramatically achieved CR (5/6). In the other 3 patients, 1 patient who was failure to initial Hyper-CVAD A/B regimen also dramatically achieved CR after the more Hyper-CVAD A regimen combined with venetoclax, and 1 patient achieved CR while another still NR with both receiving CLAG (cladribine, cytarabine, G-CSF) regimen. Subsequently 11 patients (9 CR, 2 with refractory disease) received allogenic hematopoietic stem cell transplantation (allo-HSCT), and all the CR patients survived well after HSCT (follow up 3-24 months, median 15 months) without relapse, while 2 NR patients died soon after transplantation because of severe complications (Table 2). Conclusions: Our data suggested PICALM::MLLT10 positive AL should be more appropriately recognized as an independent ALAL entity and may benefit from LDAC, G-CSF and anthracyclines combination chemotherapy as well as venetoclax. Sequential HSCT after chemotherapy combined with venetoclax may further improve long-term survival in AL patients with CR even MRD positive.

Error-Corrected Next-Generation Sequencing Provides a Comprehensive Overview of the Subclonal Mutation Landscape and Its Prognostic Implications in Juvenile Myelomonocytic Leukemia

Introduction: Juvenile myelomonocytic leukemia (JMML) is a rare pediatric myelodysplastic/myeloproliferative neoplasm characterized by mutations in genes activating the RAS pathway ( PTPN11, NF1, NRAS, KRAS, and CBL). Approximately 20% of patients with JMML have secondary mutations in SETBP1 and/or JAK3, and recent droplet digital PCR (ddPCR) analyses revealed that mutations in these two genes, including very rare mutations (variant allele frequency [VAF] < 0.05) that are difficult to detect by conventional next-generation sequencing (NGS), are associated with poor prognoses. Meanwhile, the landscape of low VAF subclonal mutations of other genes in patients with JMML has not been adequately evaluated. Therefore, we utilized error-corrected NGS, which can reduce the systematic sequencing error rate of conventional NGS by incorporating molecular barcodes (MBCs). Methods: We performed error-corrected NGS in 93 patients with JMML and 11 patients with JMML-like myeloproliferative disorder with Noonan syndrome (NS/MPD) using a small panel associated with myeloid malignancies. Samples for error-corrected NGS were prepared using a SureSelect XT HS2 DNA Library Preparation Kit (Agilent Technologies), including unique dual index and duplex MBCs. A unique MBC is incorporated into each DNA fragment, and the incorporated MBC can differentiate true and false duplications, allowing for highly accurate sequencing that can detect mutations with VAF > 0.001. We used the HiSeq X platform (Illumina) and SureCall v.4.2 application (Agilent Technologies) for analysis. In addition, DNA methylation analysis was performed on the same cohort using the Infinium HumanMethylation 450K BeadChip and/or Digital Restriction Enzyme Analysis of Methylation as previously described (Murakami et al. 2018;131:1576-1586, Kitazawa et al. Blood Adv. 2021;5:5507-5518). This study was approved by the Ethics Committee of the Nagoya University Graduate School of Medicine. Results: In the cohort of 104 patients with JMML or NS/MPD, 160 mutations were identified, of which 30 (19%) had VAF < 0.05 (eight in JAK3, seven in NF1, five in ASXL1, three in NRAS, two each in PTPN11 and SOS1, and one each in SETBP1, SH2B3, and ZRSR2). Subclonal mutations in SETBP1 p.D868N and JAK3 p.R657Q identified by error-corrected NGS were confirmed using ddPCR, and consistent results were obtained for both assays (R 2 = 0.9977 and 0.9919 respectively). Of 93 patients with JMML, 30 (32%) had subclonal or clonal secondary mutations, whereas no such mutations were detected in patients with NS/MPD ( P = 0.031). Of 104 patients, 23 (22%) had secondary mutations with VAF ≥ 0.05 (Major group), 7 (7%) only had secondary mutations with VAF < 0.05 (Minor group), and the remaining 74 (71%) had no secondary mutations (Negative group). We assessed the associations of subclonal mutations detected by error-corrected NGS with the DNA methylation profile, the most important prognostic factor in JMML. Whereas 22 of 23 (96%) and 5 of 7 (71%) patients in the Major and Minor groups, respectively, had high methylation (HM) profiles, only 20 of 74 (27%) patients in the Negative group featured HM profiles ( P < 0.001). The 4-year overall survival (OS) rates were significantly lower in the Major (52.2% [95% confidence interval {CI} = 30.5%-70.0%], P = 0.01) and Minor groups (42.9% [95% CI = 9.8%-73.4%], P = 0.03) than in the Negative group (76.3% [95% CI = 64.6%-84.5%]). In a subgroup analysis of 30 patients with secondary mutations, patients with secondary mutations in RAS pathway genes (n = 18) had significantly lower 4-year OS rates than those with secondary mutations in other genes (n = 12; 32.4% [95% CI = 12.7%-54.0%] vs. 75.0% [95% CI: 40.8%-91.2%], P = 0.047). Conclusions: We successfully performed error-corrected NGS to assess comprehensive subclonal secondary mutational profiles, including very low VAF variants. The presence of subclonal mutations, particularly in RAS pathway genes, was associated with poor OS. These findings provide important information for appropriate risk stratification, which will contribute to the implementation of precision medicine for patients with JMML.

A Multicenter Clinical Study with Reduced Intensive Chemotherapy for Induction Remission of Pediatric Acute Megakaryoblastic Leukemia

Bcakground: Pediatric acute megakaryoblastic leukemia (AMKL) without Down syndrome (DS) is a genetically heterogenous myeloid malignancy and with dismal prognosis. Refractory and relapse remains a major challenge. Given to the young age distribution of AMKL and high frequency of abandonment in middle-income countries, we conducted a multicenter clinical trial (ChiCTR1800015875) in aims to lower the intensity of induction while without compromise the remission rate and survival. Methods: From June 2018 to December 2022, there were consecutively 43 cases with de novo non-DS AMKL, which accounted for 7.6% cases of acute myeloid leukemia (AML) during the same period, enrolled in this trial. All the patients received at least one cycle of low-dose induction with HAG regimen (homoharringtonine 1 mg/m 2, intravenous daily, days 1-7; cytarabine 10 mg/m 2, subcutaneously every 12 hours, 20 doses, and G-CSF 5µ/kg subcutaneous, daily, 10 doses) followed by 3 to 4 courses of intensive chemotherapy or HSCT as post-remission consolidation. Besides conventional molecule testing, RNA-sequencing and whole exon sequencing (WES) were performed as well to reveal underlying genetic landscape of this type of disease. Results: The median age of the 43 patients at diagnosis was 18.5 (range 4-114) months. The median while blood cell (WBC) counts and platelet at diagnosis were 17.2×10 9/L (range 1.8-105.7 ×10 9/L) and 36.5×10 9/L (range 4-472 ×10 9/L), respectively. Among them, 39.5% of cases exhibited hepatosplenomegaly. A diversity of genetic fusions and mutations were uncovered. The recurrent fusions in this cohort include CBFA2T3-GLIS2 (16.3%), MLLr (11.6%), NUP98-(9.3%), RBM15-MKL1 (7.0%), HOX fusions (7.0%) and PICALM-MLLT10 (4.7%). Other non-recurrent fusions accounted for 18.6% (Figure 1A). The common mutations detected in our pediatric AMKL were JAK2, NRAS, MPL, BCOR, CTCF, KRAS and PTPN11. Regarding treatment response, 20 of 43 cases (46.5%) attained complete remission (CR) or complete remission with incomplete blood cell recovery (CRi) after one cycle of induction. Among the 20 cases, 9 of them got minimal residual disease (MRD) negative by flow cytometry. Ten patients (23.2%) achieved partial remission (PR) while 13 patients (30.2%) showed no response (NR) to treatment. Thirty-one patients continued with another cycle of the same regimen and 21 of the 28 cases who were available for evaluation (75.0%) attained CR/CRi. Disease relapse was observed in 16/43 (37.2%) cases, with 7/43 (16.2%) patients relapsed after transplantation. The 3-year overall survival (OS) and event-free survival (EFS) were 49.6±8.2% and 29.5±7.1%, respectively (Figure 1B). In total, more than half of patients (22/43, 51.5%) underwent HSCT. The 3-year OS of transplant group and chemotherapy group were 57.9±11.7% versus 39.5±11.2%, P=0.036. As genetic characteristics often predict treatment response and prognosis, we wonder which subgroup could benefit from the reduced intensive induction. We further compared the features of patients who got CR/CRi after induction I with those achieved PR/NR. Interestingly, we found more patients with adverse fusions in PR/NR group, such as CBFA2T3-GLIS2 (26.0% vs. 5.0%), NUP98- (17.4% vs. 0%), MLLs (13.0% vs. 10.0%), and RBM15-MKL1 (8.7% vs. 5.0%); while other non-recurrent fusions were more common in CR/CRi group (4.3% vs. 35.0%). Two thirds of patients (67.4%) experienced refractory or relapse and almost half of them harbored adverse fusions or mutations such as CBFA2T3-GLIS2, MLLr, NUP98- fusions, NRAS and PTPN11. On the other hand, 14 patients without refractory or relapse had genetic features with more JAK2 and MPL mutations. No treatment-related mortality (TRM) occurred during induction. Only one patient with KRAS mutation died of infection after consolidation III. Conclusion: Insight into the genetic and molecular landscape improved our understanding of pediatric AMKL. Distinct molecular features can serve as a tool to tailor the therapy. Though treatment still lags behind and novel therapy is urgent for the adverse subgroups, our low-dose induction with HAG regimen could benefit for a subgroup with non-recurrent fusions, which showed efficiency while is tolerable for the young age group. Based on our results, we provide an induction option for these AMKL patients, especially for those in the middle-income countries.

1-Year Data Analysis from a Cancer Center Molecular Tumor Board Dedicated to Clonal Hematopoiesis

Background Nearly 25% of cancer patients harbor clonal hematopoiesis of indeterminate potential (CHIP). Detection of clonal hematopoiesis (CH) in routine clinical practice is increasing due to incidental findings during sequencing analysis of circulating cell-free DNA (cfDNA) or exploration of unexplained cytopenia. To improve clinical management of these patients in our institution, we set up a multidisciplinary molecular tumor board (MTB) dedicated to patient cases with CH, CHIP, and clonal cytopenia of undetermined significance (CCUS) in 2022. Methods Between June 2022 and June 2023, our MTB reviewed a total of 345 cases, of which 212 referred by the solid tumor MTB and 133 referred by hematologists. The former 212 cases with CH were identified through cfDNA sequencing (FoundationOne Liquid CDx) within the Gustave Roussy Cancer Profiling study (NCT04932525), which includes some genes recurrently mutated in hematologic malignancies ( ASXL1, DNMT3A, IDH1, IDH2, JAK2, MPL, MYD88, SF3B1, TET2, U2AF1). A variant allele frequency (VAF) of at least 10% for the CH mutation was required to refer cases to the MTB, except for JAK2, MPL, and MYD88 mutations. The latter 133 cases were screened for CH mutations on peripheral blood leukocytes using a next-generation sequencing (NGS) assay targeting 174 genes recurrently mutated in hematologic malignancies. In addition to molecular data, standard clinical and biological parameters were recorded for each individual case. Results Patients referred by the solid tumor MTB In this cohort of 212 patients, median age was 72 years old (range, 48-91), sex ratio (M/F) was 1.4, median prior anticancer treatment lines was 2 (0-9), and time between MTB and cancer diagnosis was 2.3 years (0.2-34). The most frequent tumor types were lung (23%), colorectal (20%), prostate (19%), gynecological (12%) and breast (9%) cancers. The most frequently mutated genes were DNMT3A (59%), TET2 (30%), ASXL1 (24.5%), JAK2 (23%), SF3B1 (7.5%), and MYD88 (6%), with a median VAF of 4.2%, 3.0%, 8.5%, 1.0%, 5.0%, and 0.20%, respectively. Fifty percent of patients harbored more than 1 mutation. Six patients had a known history of myeloproliferative neoplasm (MPN). The proportion of cases with CH, CHIP, and CCUS was 15%, 59%, and 17%, respectively. The CH risk score of myeloid malignancy (CHRS, Weeks et al.) could be calculated in 126 cases but may underestimate risk due to the limited gene list considered, and revealed 69 (55%) low-risk, 52 (41%) intermediate-risk, and 5 (4%) high-risk patients. Our MTB recommended hematologic consultation for additional investigations in 58 patients, of which 22 were actually referred (main reason for not referring patients was advanced cancer disease). Four patients were diagnosed with hematologic malignancy (1 MPN, 1 chronic myeloid leukemia, 2 myelodysplastic syndromes [MDS]). Patients referred by a hematologist In this cohort of 133 patients, median age was 69 years old (53-89), and sex ratio (M/F) was 0.6. Eighty-six percent of patients had a cancer history, median prior anticancer treatment lines was 2 (0-7), time between MTB and cancer diagnosis was 3.5 years (0.2-34). The most frequent tumor types were lymphoid disorders (39%), breast cancer (15%), and gynecological cancer (15%). The proportion of CH, CHIP, and CCUS was 11%, 33%, and 41%, respectively. The most frequently mutated genes were DNMT3A (48,5%), PPM1D (24%), TET2 (22%), TP53 (17%), ASXL1 (6%), JAK2 (4.5%) and CHEK2 (4.5%), with a VAF of 2.5%, 2,3%, 4.0%, 2.0%, 8.0%, 1.0%, and 2.5%, respectively. Sixty percent of patients harbored more than 1 mutation. The CHRS could be calculated in 98 cases and revealed 34% low-risk, 50% intermediate-risk, and 16% high-risk CH patients. No need for a specific follow-up was recommended by the MTB in 33 patients. Among the 85 patients with hematologic follow-up, 3 (for which the CHRS was intermediate in 2 cases and high in 1 at the time of MTB evaluation) rapidly progressed to a myeloid malignancy ( Figure 1) (2 MDS and 1 MDS/MPN). Conclusions Our study highlights the utility of a MTB dedicated to CH, CHIP and CCUS for the identification of high-risk patients, early detection of hematologic malignancies, and appropriate therapeutic management. Long-term follow-up is needed to validate the CHRS but the design of a specific score for patients with cancer may be helpful due to the specific features of this population (high prevalence of PPM1D mutations, post-treatment cytopenia).

Aberrant Activity of the Calcium Sensor STIM1 Underlies Congenital Platelet Disorders and Myeloproliferative Neoplasms

MB and VA equal contributors AB and STO co-corresponding authors This study was initiated following evaluation of a 32 year-old woman who presented with a history of thrombocytopenia identified in childhood who subsequently developed features of myelofibrosis (MF). A bone marrow biopsy demonstrated hypercellularity in conjunction with megakaryocyte hyperplasia and marked reticulin fibrosis. Molecular testing for JAK2, CALR, and MPL mutations was negative. Given the unusual association between congenital thrombocytopenia and MF in this patient, exome sequencing was performed, revealing a heterozygous R304W mutation in the coiled coil (CC) domain of STIM1. Activating mutations in the CC and EF hand domains of STIM1 have been associated with Stormorken syndrome, a rare congenital platelet disorder associated with abnormal store operated calcium entry (SOCE). We subsequently identified a second patient with MF associated with a STIM1 activating mutation. This individual was found to have severe thrombocytopenia at birth, and exome sequencing revealed a heterozygous S88G mutation in the EF hand of STIM1. A bone marrow biopsy obtained at 6 months of age revealed atypical megakaryocytes and grade 1-2 MF. A repeat biopsy at age 2 showed persistence of stable MF. The unusual finding of MF in these two patients suggested the possibility of altered calcium signaling as a shared mechanism driving congenital platelet disorders such as Stormorken syndrome and myeloproliferative neoplasms (MPNs) including MF. In support of this notion, we identified elevated STIM1 expression in MF vs normal megakaryocyte progenitors, as well as in platelets from patients with essential thrombocythemia (ET) vs healthy controls. Additionally, we found that STIM1 expression was significantly elevated in CD34+ hematopoietic stem/progenitor cells (HSPCs) from both ET and MF patients vs healthy controls. Notably, STIM1 expression was increased in both JAK2 and CALR-mutant MF patients. Collectively, these findings provide evidence of aberrant STIM1 expression in MPN patient cells. To determine the functional role of STIM1 in MPN disease development, colony assays and patient-derived xenograft (PDX) experiments were performed with MF patient CD34+ cells subjected to CRISPR ablation of STIM1. Strikingly discordant results were observed with JAK2 vs CALR-mutant patient samples. Abrogation of STIM1 in CALR-mutant CD34+ cells led to decreased colony formation, and NSGS mice engrafted in parallel with STIM1-targeted cells exhibited decreased human CD45+ cell engraftment in conjunction with prolonged survival. These findings suggest an important role for STIM1 in CALR-mutant MPN disease phenotypes. In contrast, targeting of STIM1 in JAK2-mutant CD34+ cells led to increased colony formation and exacerbated disease phenotypes in vivo as manifested by enhanced human CD45+ cell engraftment, worsened splenomegaly, and early lethality. Similar results were obtained in experiments utilizing pharmacologic inhibitors of SOCE activity. Taken together, these findings indicate that the consequences of aberrant STIM1 activity may be context-dependent relating to specific MPN driver mutations. To expand these observations, we identified a separate cohort of 9 family members in Italy with Stormorken syndrome and confirmed STIM1 EF hand mutations. In ex vivo megakaryocytic differentiation assays, cells from affected individuals exhibited a defect in proplatelet formation. These observations were corroborated by initial analyses of a newly generated Stim1 R304W conditional knock-in mouse which recapitulated the characteristic thrombocytopenia found in patients with Stormorken syndrome. In summary, this study represents the first demonstration of MF development in patients with Stormorken syndrome, thereby uncovering a previously unrecognized hallmark of altered calcium signaling via aberrant STIM1 activation underlying Stormorken syndrome and MPNs. Our findings suggest distinct mechanisms relating to the interaction between JAK2 vs CALR mutation and altered STIM1 activity. Further studies of these relationships may have important ramifications for potential therapeutic approaches targeting these pathways.

Distinct Immune and Molecular Profiles of Hepatitis-Associated Aplastic Anemia

Background: Hepatitis-associated aplastic anemia (HAAA) is characterized by the development of hematopoietic failure within months following an acute episode of non-infectious hepatitis. Although disease presentation with pancytopenia and a hypocellular marrow in HAAA is similar to non-hepatitis immune AA (non-HAAA), the immune and molecular profile in HAAA has not been completely elucidated. Here, we aimed to assess HAAA patients for cytokines and presence of clonal events linked to AA, the presence of paroxysmal nocturnal hemoglobinuria (PNH) clones and somatic mutations in peripheral blood mononuclear cells (PBMC) subpopulations, and compared to a non-HAAA cohort. Methods: A cohort of HAAA patients (n=30), age and sex-matched non-HAAA patients (n=24) and healthy controls (n=23) seen at the National Institutes of Health since 2003 were retrospectively screened for a panel of inflammatory cytokines and growth factors by Luminex, and somatic mutations in sorted CD3-, CD3+CD4+, and CD3+CD8+ PBMC fractions by error-corrected DNA sequencing. A customized panel with 42 myeloid-related and 49 autoimmunity-related genes at minimum limited of detection of 0.1% were used. All samples were before any immunosuppressive treatment (IST). Cytokine levels and frequencies of PNH clones and clonal hematopoiesis (CH) in different fractions were compared among groups. Results: HAAA patients were in average young (median age=23); 37% were at age < 18 (Table 1). Although disease severity and blood counts were similar to the non-HAAA cohort, immune and molecular markers of immune AA were distinct among cohorts. The frequency of PNH clones was significantly lower in HAAA compared to the non-HAAA cohort (15% v 58%, p=0.0008). The median size of PNH clones in HAAA and non-HAAA was 1.4% and 7.4%, respectively (p =0.03). The cytokine profiles performed in the sera of 22 HAAA before IST were marked by significantly higher levels of IL-1ra (p=0.0008), CXCL-10 (p=0.0038), and VEGF (p=0.0023) in comparison to 31 non-HAAA assessed patients; IL-6 (p=0.0002) and CD40L (p=0.0001) levels were significantly lower than in non-HAAA. As reported in immune AA, HAAA patients had higher levels of TPO (p=0.0001), G-CSF (p=0.0001), and EPO (p=0.0001) than controls; lower levels of CCL-5 (p=0.0001) and CCL-11 (p=0.0025) were seen in the HAAA. FLT3-L levels were markedly elevated in both AA cohorts when compared to HC. The clonal landscape was also strikingly different between HAAA and non-HAAA in all fractions evaluated (Figure 1). In HAAA, 3 out of 21 assessed patients (14%) had CH in the CD3- fraction at maximum variant allele frequency (VAF) of 1.8%; one patient had two RUNX1 mutations while a JAK2 and DNMT3A mutation were found in the other two patients. No mutations were found in CD4+ and CD8+ compartments in subjects with HAAA. In contrast, 13 of 24 non-HAAA patients (54%) had CH in the CD3- populations, which was dominated by PIGA, BCOR, and DNMT3A clones, a pattern consistent with the known clonal landscape of immune AA. The frequency of non-HAAA with CH in the CD4+ and CD8+ compartments was 7/24 (29%) and 8/24 (30%) patients, respectively; CH in these fractions was similar to those found in CD3- dominated by mutations in PIGA, BCOR, and DNMT3A at VAFs ranging from 0.2% to 15% (Figure 1). CH in lymphoid-related genes was only found in a single patient with a STAT3 p.S614Rmutation at VAF of 3% exclusive to the CD8+ fraction. Conclusion: HAAA has a distinct immunologic and molecular profile than non-HAAA patients. PNH clones were less frequent in HAAA and patterns of cytokines were significantly different than the non-HAAA cohort. CH in PIGA and BCOR, highly associated with AA, were not present in our small HAAA cohort. Our results indicate a distinct underlying pathophysiology that initiates the immune destruction resulting in marrow failure in HAAA patients. Confirming these findings in a larger cohort and correlating with clinical outcomes is ongoing.

A Rare Case of Triple Negative Essential Thrombocythemia Presenting with Splenic Infarction: A Diagnostic Conundrum

Introduction Essential thrombocythemia (ET) is a myeloproliferative neoplasm characterized by significant thrombocytosis with high propensity for thrombosis formation as well as other vascular complications. Most myeloproliferative neoplasms including ET are associated with Janus kinase ( JAK2) mutation. Other commonly associated mutations include Calreticulin ( CALR) and Myeloproliferative leukemia virus oncogene ( MPL) mutations. About 17% of cases of ET lack mutations in these driver genes. This presents a clinical conundrum for clinicians on initiation of appropriate treatment for these patients. We report a rare presentation of triple-negative ET with splenic infarction. Case Summary A 66-year-old Hispanic female who presented with left sided abdominal pain that gradually worsened over the course of 1 week; she believed it was stomach cramps. Laboratory evaluations were pertinent for platelet counts of 2000 x 10 9/L, hemoglobin level was 10.9 g/dl, and leukocytosis (white blood cell count 13.2k/uL) without left shift. Further work-up with iron studies was unremarkable and molecular studies were negative for BCR-ABL 1, PDGFR alpha/beta, FGFR 1, JAK2 V617F (including exons 12-13), CALR and MPL. A bone marrow biopsy showed an increase in megakaryocytes with some atypical forms with “enlarged size and nuclear hyper lobulation, and mild patchy reticulin fibrosis” suggestive of myeloproliferative neoplasm. Computed Tomography of the abdomen and pelvis with contrast showed evidence of splenic infarct. The patient was started on oral aspirin 81mg and oral hydroxyurea 2000 mg daily. Due to poor response to hydroxyurea and aspirin, she eventually had two cycles of platelet apheresis, and her platelet count improved to 1000 x 10 9/L. A repeat bone marrow biopsy was subsequently done to confirm essential thrombocythemia. At the time of discharge, the patient was asymptomatic and platelet count had decreased to 892 × 10 9/L. Discussion Essential thrombocythemia (ET) is a rare but recognized cause of vascular complications including arterial and venous thrombosis. Triple negative ET is quite uncommon and can pose a great deal of diagnostic challenge which can impact timing of initiation of appropriate therapy. This clinical vignette exemplified the conundrum encountered in making a diagnosis of triple negative ET. Following the World Health Organization (WHO) 2016 criteria for diagnosis of ET, patient has to have all 4 of: sustained platelet counts >450 x 10 9/L, bone marrow biopsy showing increased number of enlarged and mature megakaryocytes with no significant increase or left shift of granulopoiesis or erythropoiesis, presence of driver mutations/clonal markers (including JAK2, CALR and MPL mutations) or absent of evidence of iron deficiency or cause for reactive thrombocytosis and not meeting WHO criteria for Polycythemia vera or other myeloid neoplasms. Our patient met criteria for ET with no driver mutation detected, hence triple negative ET. She was also classified as high-risk ET using the revised International Prognostic Score for Essential Thrombocytopenia (IPSET). Initial work up of this patient was not confirmatory of the essential thrombocythemia due to the bone marrow biopsy not clearly defining features as per WHO stipulations, thus, a more aggressive therapy was not pursued. This can pose a great deal of diagnostic challenge which can impact timing of initiation of appropriate therapy. This is not uncommon especially considering sampling challenge. Studies has shown that early initiation of cytoreductive therapy prophylactically in a high-risk patients can avert vascular complications of ET (including splenic infarction). The index patient responded slowly to platelet apheresis which can be an effective treatment in acute thrombotic complication of ET. Conclusion The diagnosis of triple negative essential thrombocythemia can pose a clinical challenge which impacts effective management of this myeloproliferative neoplasm. There is a dire need for further discussion on this conundrum to provide more applicable recommendations to avert the rare but fatal complications of ET. Platelet apheresis can be an option for emergency treatment in patients presenting with a major vascular complication like splenic infarction.

Mutations in the RNA Splicing Factors U2AF1 and SRSF2 are Context-Dependent in Myeloproliferative Neoplasms

RNA splicing factor gene mutations are recurrently found in BCR::ABL1 negative myeloproliferative neoplasms (MPN). To understand the interactions between spliceosome gene mutations and MPN phenotypic driver mutations ( JAK2, CALR and MPL), we investigated their patterns of co-occurrence or mutual exclusivity in a cohort of 990 MPN patients with comprehensive molecular profiling and clinical information from the Hematologic Malignancies Data Repository (HMDR). As expected, MPN driver mutations ( JAK2, CALR and MPL) were mutually exclusive (N=658, N=168, N=53 respectively, Log2 OR≤-3.5 and Padj. ≤0.005 using pairwise Fisher's exact tests with Benjamin Hochberg multiple testing correction). Additionally, cases with co-occurring mutations in two RNA splicing factors, SF3B1, U2AF1 and SRSF2 (N=44, N=49, N=44) respectively were uncommon (2/135 splicing factor mutated cases) . We further found that U2AF1 and SRSF2 mutations co-occurred with JAK2 (log2 OR=1.7, Padj.=0.009) and MPL (log2 OR=2.1, Padj.=0.006) respectively, but rarely with CALR mutations (N=2 CALR-U2AF1 log2 OR=-2.3 Padj.=0.025, N=2 CALR-SRSF2 log2 OR=-2.2 Padj.=0.048). In contrast, CALR-SF3B1 mutations occurred at the expected frequency (Padj.=0.11). To explore the molecular settings where these mutations co-occur, we investigated the variant allele frequencies (VAFs) of CALR, U2AF1, SRSF2 and concomitant mutations in the CALR-U2AF1 (N=2) and CALR-SRSF2 (N=2) patients. The VAFs for the mutations detected in the first patient with CALR-U2AF1 co-mutation were: CALR 0.26, U2AF1 0.45, and TET2 0.41. Since CALR and splicing factor mutations are typically heterozygous, this suggests the CALR mutation was sub-clonal to the U2AF1 mutation and that U2AF1 and TET2 mutations were likely present in the same cell. In the second CALR-U2AF1 co-mutant case, VAFs were: CALR 0.31, U2AF1 0.27, and TP53 0.16. It is possible that in this case, the CALR and U2AF1 mutations may have occurred in independent clones or may have occurred in the same cell in the absence of other pathogenic mutations. For the two CALR-SRSF2 patients, data from three samples revealed VAFs of 0.23-0.46 for CALR and 0.21-0.58 for SRSF2 mutations. Considering their typical heterozygous occurrence, we inferred those individual cells harbored both CALR and SRSF2 mutations. Notably, in samples with high VAFs (>0.37) for both CALR and SRSF2 in two separate patients, additional high VAF pathogenic mutations were observed: 0.35 for ASXL1 and 0.46 for RUNX1 respectively. As ASXL1 and RUNX1 mutations also typically occur in a heterozygous manner, we hypothesized that when CALR and SRSF2 mutations are present in the same cell, another pathogenic co-mutation may be required for survival of the clone. To test our hypothesis, we FACS-sorted single lineage negative CD34 positive bone marrow cells from the first CALR- SRSF2 co-mutant case into 96 wells plates containing methylcellulose and hematopoietic growth factors (CFU-GEMM). DNA was harvested from single-cell colonies and genotyped for the following mutations using polymerase chain reaction (PCR) followed by gel electrophoresis and Sanger sequencing: CALR c.1154_1155insTTGTC p.K385fs*, SRSF2 c.284G>T p.P95H, ASXL1 c.1926_1927insG p.G642fs*, EZH2 c.2188_2212delAAAAAACAGCTCTTCGCCAGTCTGG p.F729fs*. Bulk NGS VAFs were 0.46, 0.38, 0.35, and 0.17, respectively. Out of 73 colonies analyzed, 71 colonies had the CALR insertion 5 mutation detected (see figure). Among these 71 CALR-mutated colonies, SRSF2 was found to co-occur in 35 colonies. Interestingly, all 35 colonies were accompanied by an ASXL1 mutation, and 29 of them had an additional EZH2 mutation. These findings support our hypothesis that CALR and SRSF2 mutations may co-occur in the same cell in the presence of another pathogenic mutation. Our findings offer molecular insights into the context-dependent behavior of splicing factor mutations in MPN. While they can co-occur with JAK2 and MPL mutations, U2AF1 and SRSF2 mutations are largely mutually exclusive with CALR mutations. In addition, our findings generate two main biological hypotheses: (i) a synthetic lethal relationship may exist between CALR mutations and SRSF2 or U2AF1 mutations, and (ii) this synthetic lethality may be overcome by the presence of additional pathogenic mutation(s) in the cell. Validation studies are ongoing to address these hypotheses. AM and AEM contributed equally.

Clinical and Molecular Spectrum of Somatic Mosaic States in DDX41 mutant Germline Predisposition Syndromes

Introduction: Germline DEAD-box RNA helicase-1 mutant (DDX41) predisposition syndrome ( DDX41-MT-GPS) is one of the most frequent hereditary predisposition syndromes in adults with myeloid neoplasms (MN-2-5%). Somatic mosaicism involving the unmutated DDX41 allele (e.g., R525H) as a potential mechanism for myeloid evolution has been reported in 39-50% of patients (pts). In addition, given the later age of onset, somatic mosaic states composed of age-related clonal hematopoiesis (ARCH) (e.g., DNMT3A, ASXL1, TET2, and TP53), with reported frequencies less than expected in MDS and AML, have been documented. We conducted this study to define the somatic mosaic landscape in DDX41-MT-GPS . Methods: After approval from the Mayo Clinic IRB the prospective GPS database was queried for pts with DDX41-MT GPS. Germline confirmation was conducted on skin fibroblast-, or hair follicle-derived DNA. Somatic CH testing was conducted using a targeted NGS panel as previously described. Given the high frequency of variants of undetermined significance (VUS), comparisons were made between pathogenic ( DDX41path) and DDX41VUS. Results: We identified 106 pts with DDX41-MT-GPS, of which 83 (78%) met criteria for MN, 16 (15%) for CH/CCUS (clonal cytopenias of undetermined significance), while 7 (6%) were unaffected carriers. Somatic mosaicism in DDX41-GPS patients without MN Sixteen DDX41-MT pts without MN met criteria for CH/CCUS ( DDX41path [n=4] and DDX41VUS [n=12]; median age 69 years (yrs) (range [R], 19-78) ( DDX41path [69 yrs] and DDX41VUS [67 yrs], p=0.85), with a male predilection (75%). Four (25%) pts had somatic DDX41 MT (R525H [n=3] and A376T [n=1]) with median variant allele frequency (VAF) 10.5% (R, 5-27); 2 (50%) pts with germline DDX41path had R525H (VAF; 5% and 13%) and 1 (8%) pt each with germline DDX41VUS had R525H (VAF 5%) and A376T (VAF 27%) somatic variants, respectively. Abnormal cytogenetics (CG) were observed in 2/13 evaluable (15%) pts ([+8 and del20q]) in the germline DDX41path group only (p= 0.05). ARCH co-mutations were observed in 11 (69%) pts, not significantly (NS) different between DDX41path (75%) and DDX41VUS (75%), p= 0.66. Individual co-mutations: DNMT3A (25% vs 16%, p= > 0.99), ASXL1 (25% vs 8%, p=0.71), TET2 (25% vs 8%, p= >0.99), and JAK2 (0% vs 8%, p= >0.99) were NS different between the two groups. Somatic mosaicism in DDX41-GPS patients with MN Eight-three pts met criteria for MN ( DDX41path [n=43] and DDX41VUS [n=40]; median age 67 yrs (range [R], 27-92), with a male predilection (58%). Fifty-four (65%) pts had MDS ( DDX41path [55%] and DDX41VUS [45%], p=0.55) and 29 (35%) had AML ( DDX41path [41%] and DDX41VUS [59%], p=0.65). Overall, 15 (18%) pts had somatic DDX41 MT; 12 (80%) pts with DDX41path and 3 (20%) pts with DDX41VUS (p= 0.003). The median VAF of somatic DDX41 MT was 12% (R, 5-37), NS different between DDX41path (10.5%) and DDX41VUS (12%) (p=0.08). The most common somatic DDX41 MT was R525H (66% [n=10]), significantly associated with DDX41path (9/10 [90%]), p=0.01. ARCH was observed in 17 (20%) pts, significantly higher in DDX41path (76%) compared to DDX41VUS (24%), p= 0.03. Abnormal CG were observed in 10/73 evaluable (14%) pts (-Y [n=2], del 20 [n=3], del 5q [n=2], del 7q [n=1], t (3;8) [n=1] and complex CG [n=1]), higher in DDX41path (70%) compared to DDX41VUS (30%) with p value >0.99. We compared the spectrum of CH between DDX41 MT CH/CCUS and MN pts ( Table 1) and found no difference in the proportion of pts with somatic DDX41 MT (p= 0.52) and ARCH/myeloid MT (p= 0.56). The individual occurrences of DNMT3A (p= 0.49), ASXL1 (p= 0.71), TET2 (p=0.59), JAK2 (p>0.99) and TP53 (p= 0.56) mutations were NS different between the two groups ( Figure 1). Conclusion: We define the somatic mosaic landscape in DDX41-MT GPS and demonstrate that somatic mutations involving the other allele, especially R525H, are seen in ~20% of pts (>80% of R525H present in MN). The frequency and composition of ARCH and myeloid driver mutations was lower than expected for the age of presentation, in comparison to de novo and secondary MDS/AML and occurred more frequently in DDX41path compared to DDX41VUS. Forty-two % (n=41), including 37% with MN, did not have somatic mosaicism, underscoring the fact that mechanisms of leukemia progression remain to be defined in subsets of affected pts.