EZH2 Mutations Research Articles

Abstract C032: Patterns of care and patients’ outcomes for myelodysplastic syndromes in Puerto Rico: A real-world data analysis

Abstract Background: Myelodysplastic syndromes (MDS) are a group of rare blood cancers with a wide range of clinical outcomes and a highly variable prognosis. Usually, most population-based registries do not collect cancer-related biological and genetic markers, which limits the use of population-based registries to address critical research questions. We leveraged the Puerto Rico (PR) Central Cancer Registry (PRCCR) to collect this data and analyze clinical characteristics and outcomes of patients diagnosed with MDS in PR. Methods: The study population includes patients diagnosed with MDS in PR between 2015 and 2019. Descriptive statistics and frequency analysis were used to describe the variables of interest. Logistic regression models were used to examine factors associated with the use of genetic marker tests. Bivariate analyses were performed to evaluate association between treatment patterns and patients’ characteristics. Three-year survival curves were estimated using Kaplan-Meier (with log-rank test to assess differences between survival curves). Multivariable Cox regression models were used to estimate the magnitude of association between the risk of dying among patients with MDS and different genetic markers/clinical characteristics. Results: The study cohort consisted of 475 patients. Between 67.2% and 81.7% of cases reported information of laboratory tests and prognostic markers. The abnormal karyotype had the highest presence in patients with MDS among those that reported the test with 47.4%. After adjusting for variables of interest, the risk of dying in MDS patients who did not have a del(5q) or a mutation of TP53, EZH2, or NRAS was 53%-85% lower than the risk of dying in patients who had either one of the mutations (p<0.05). Almost half of the MDS patients (47.4%) received treatment and of those, almost a third (29.3%) received it within the first 30 days after the diagnosis of MDS. The most common first-course treatment was azacitidine (52.0%), followed by lenalidomide (20.0%). Patients with a very low IPSS-R had a 3-year survival of 72.8% and those with a very high IPSS-R had a 3-year survival of 7.8%. Conclusion: The data from the PRCCR confirm the prognostic value of the IPSS-R and the role of the cytogenetic and molecular abnormalities on the patient’s outcomes. Citation Format: Karen J. Ortiz-Ortiz, Tonatiuh Suárez Ramos, Maira A. Castañeda-Avila, Carlos R. Torres-Cintrón, Axel Gierbolini-Bermúdez, Guillermo Tortolero-Luna. Patterns of care and patients’ outcomes for myelodysplastic syndromes in Puerto Rico: A real-world data analysis [abstract]. In: Proceedings of the 16th AACR Conference on the Science of Cancer Health Disparities in Racial/Ethnic Minorities and the Medically Underserved; 2023 Sep 29-Oct 2;Orlando, FL. Philadelphia (PA): AACR; Cancer Epidemiol Biomarkers Prev 2023;32(12 Suppl):Abstract nr C032.

Mutational Landscape of Diffuse Large B-Cell Lymphoma (DLBCL) in Mexican Patients

Background. Diffuse Large B Cell Lymphoma (DLBCL) is the most common B-cell malignancy (1), recently classified with genomic sequencing and exome analysis into clusters with clinical implications (2,3). However, this analysis has not been informed neither in Mexican, or Latin-American population. The aim of this study was to describe the mutational landscape and its correlation with the clinical outcome in Mexican patients with DLBCL. Material and methods. A prospective, observational study of patients with diagnosis of DLBCL, attended at the National Cancer Institute in Mexico City. Inclusion criteria: patients > 18 years, diagnosis of DLBCL, without previous treatment and candidate to be treated with RCHOP. IRB approval was: Register number CEI/966/15. All signed informed consent. Clinical & pathological variables were analyzed. All patients were treated with 6 cycles of RCHOP. Clinical response was evaluated by PET-CT. Samples: DNA was extracted from paraffin-embedded tissue of the primary neoplasm using the kit Quick-DNA/RNA FFPE kit (Zymo Research). A custom panel (6,026 oligos) was used for the sequencing of coding regions and splicing sites of 79 genes associated with lymphomas. Therafter, the bioinformatic analysiswas carried out using Ion Torrent Suite Browser version 5.0 and Ion Reporter version 5.18. Variant calling was performed with Torrent Variant Caller. The following databases were used: Cancer Genome Interprteter (CGI), ClinVar (201706), COSMIC (v86), PolyPhen (v2.2.2), SIFT (v5.2.2), FATHMM (v2.1), gnomAD (r2.0.1), and the Variant Effect Predictor (v93.2). All variants had a depth greater than 500X. Statistical analysis. Descriptive statistics for clinical variables. Associations between clinical and pathological characteristics were assessed with the frequency of SNVs and InDels. Survival curves were estimated using the Kaplan-Meier method. The association of the overall survival (OS) and the recurrence-free survival (RFS) was evaluated with Log-Rank test. Statistical significance was set at p-value < 0.05. Cox proportional-hazard regression analysis was used to identify the variables predicting overall survival (OS). All statistical analyses were performed using R software (v4.2.2) (https://cran.r-project.org, accessed on 23rd May 2023) and SPSS version 25 software (IBM, Corp., Armonk, NY). Results We included 185 patients, median + SD age 59.3 + 14.1 years. Most (n=128, 69.2 %) were in ECOG score < 2, without B symptoms (n=131, 70.8 %), in advanced disease (n=134, 72.4%), and were germinal-center (GC) (n=126, 68.1 %), and 26 (14.1 %) were double hit lymphomas. At least a driver mutation was found in 110 cases (59.4 %). The genes with driver mutations most frequently were: TP53, EZH2, CREBBP, NOTCH1 and KMT2D. ( figure 1). The EZH2 mutations and KMT2D mutations were more frequent in female: ( EZH2 mutated [n=22/34, 64.7%], p=0.047]) ( KMT2D mutated, 75%, p=0.034), and had a higher frequency of bulky disease (63.3 %, p= 0.05). In contrast, MYD88 mutations were more frequent in male (MYD88 mutations: 76.9 %], p= 0.042). Response to R-CHOP treatment was: Complete (n= 129 (69.7%), partial (n=10, 5.4 %), or stable disease (n=3, 1.6 %); 26 patients (14 %) progressed during treatment. Median follow-up + SD was 41.99 + 21.4 months. The RFS was 60 % to 80 months and OS was 70 % to 84 months. ECOG >2 (p=0.002 [95 %CI: 1.52-3.97]), mutations at genes EZH2 (p=0.007 [95% CI: 0.193 -0.0.58), CREBBP (p=0.004 [95 % CI: 1.59 - 11.85]), and ARID1A (p= 0.027 [95 % CI: 1.34 - 131.45] were factors influencing on OS by univariate analysis. The multivariate analysis confirmed that an ECOG >2 (p=0.001 [95 CI: 1.46-3.34]) had a negative impact on OS. In contrast, EZH2 mutations (p=0.025 [95 % CI: 0.12 -0.86]) were a protective factor. Conclusions: This is the first approach to describe the genomic landscape in Latino-american population. The presence of EZH2 and KMT2 mutations were more frequent in female patients with mediastinal and bulky disease. After multivariate analysis, only the presence of EZH2 mutations was the only genomic factor influencing on OS. These results require to be confirmed by further studies.

A Multi-Omic Study Unveils a Clonal Population of TET2-Mutated Infiltrating T-Cells in Germinal Center B Cell Lymphomas (DLBCL and FL)

Introduction Follicular lymphomas (FL) and diffuse large B cell lymphomas (DLBCL) share a common germinal center (GC) B cell precursor. Nevertheless, these lymphomas appear to originate from different developmental stages, through distinct pathogenetic mechanisms and their clinical behavior varies significantly, even among FL or DLBCL patients. To understand the molecular and transcriptional heterogeneity underlying this clinical diversity we conducted a multi-omic study in GC B cell lymphomas. Methods Our study comprised 3 DLBCL patients (1 non-GCB (germinal center B), 1 non-GCB CD5+, and 1 GCB) and 2 FL (1 with no transformation (ntFL) and 1 patient with transformation (tFL)) at diagnosis. We performed single-cell multiome-sequencing (scDNA-seq + scProtein) ( Tapestri platform -Mission Bio-) and single cell RNA-sequencing (scRNA-seq) ( Chromium system -10xGenomics-) from cell suspensions and spatial transcriptomics ( Visium technology -10xGenomics-) from paraffin blocks. Results Genotyping data were available for 19,700 cells. A total of 311 variants across the 5 samples passed all quality controls. We selected probably pathogenic and pathogenic variants for downstream analysis. Germline variants were discarded. In 3 of 5 patients, we detected 1 somatic and nonsynonymous variant defining the first clone (variants in KMT2D and NOTCH2 mutated in 6-38% of the cells) and another somatic and nonsynonymous variant, defining a subclone (variants in KMT2D, ATM, EZH2 mutated in 1-15% of the cells). In 1 of 5 patients (ntFL), we detected up to 4 mutations, acquired linearly ( B2M, GNA13, EZH2, RHOA mutated clone represents 8% of the cells). Remarkably, all patients showed the same pathogenic variant in TET2 (1-2% of the cells), as an independent clone. The highest molecular similarity was observed between the GCB DLBCL patient and the tFL patient. Both had the same variant in KMT2D as the first hit (later GCB-DLBCL acquired ATM, while tFL acquired EZH2 as a second hit). ATM and EZH2 mutations have been described in “bulk” studies conducted on DLBCL and FL patients, respectively. Regarding protein expression, there was a good correlation between GCB and non-GCB phenotypes studied by immunohistochemistry and scProtein (the expression of CD10 by proteomics was lower in non-GCB patients). TET2 clones described by scDNA-seq were enriched in CD5+ and CD19- cells, suggesting they belong to the T-lymphoid lineage. The other clones and subclones were enriched in CD19+ and CD5- cells ( Figure 1). Data from 54,024 single cells were obtained for scRNA-seq analysis, with an average of 10,805 cells (7,335-18,205) for each sample. Cell type annotation was performed based on the expression of canonical markers. We identified 13 different clusters, the main ones being: GC B cells, post-GC B cells, naïve B cells, myeloid cells, CD8+ cytotoxic T cells, CD4+ naïve T cells, CD4+ reg T cells, CD4+ helper T cells. All samples contained subpopulations of both GC and post-GC B cell clusters. However, GCB DLBCL and FL patients were significantly enriched in GC B cells (63.2 vs 22.2%; p<0.01), whereas non-GCB patients were significantly enriched in post-GC B cells (35.5 vs 2.9%; p<0.01). Part of the normal B-cell transcriptional function was preserved in all samples ( Figure 2). The analysis of the infiltrating T cells revealed that the CD4+/CD8+ T cells ratio progressively increased from ntFL (1.14) to tFL (2.25) and DLBCL (2.58). Furthermore, we estimated the exhaustion status of T cells by the expression of these five markers ( TIGIT, LAG3, CTLA4, HAVCR2, PDCD1). Exhaustion T cell markers were highly expressed in CD8+ cytotoxic T cells and cycling T cells and lower expressed in CD4+ reg T cells. Both DLBCL and tFL have a stronger pattern of exhaustion than ntFL. Finally, by the spatial transcriptomics analysis, we have identified distinct cell type proportions according to their matched single-cell RNA data. Conclusions Our results confirm the intra and intertumor heterogeneity in GC B cell lymphomas. Notably, the greatest molecular and transcriptional similarities are observed between the GCB DLBCL and tFL patients at diagnosis. Moreover, our findings support the critical role of the tumor microenvironment for the persistence and development of the tumor clone. The finding of a TET2 mutated clone in the infiltrating T cells of all the patients is particularly noteworthy, as it may suggest the possible presence of clonal lymphopoiesis.

Predicting the Clinical Course of Treatment with Midostaurin in Patients with Advanced Systemic Mastocytosis

Introduction: Advanced systemic mastocytosis (AdvSM) is characterized by presence of the KIT D816V mutation and variably other somatic mutations in the mast cell but also non-mast cell lineages, e.g. monocytes or eosinophils, in ≥80-90% of patients. Midostaurin is an approved multikinase/KIT inhibitor for treatment of AdvSM. The intricate landscape in assessment of response, resistance or progression, the occurrence of adverse events with its impact on dose modification and the recent approval of the specific KIT D816V inhibitor avapritinib contribute to complex decision-making. We here sought to characterize the most valuable baseline and on-treatment parameters for prediction of response and survival in midostaurin-treated patients with AdvSM. Methods: On basis of the ´German Registry on Disorders of Eosinophils and Mast Cells' (GREM), this retrospective-prospective analysis included 79 patients with AdvSM. Treatment was initiated between 2009 and 2022 accumulating into a 239 patient-years overall follow-up period. In addition to common serological, morphological, and molecular response parameters, we specifically examined the recurrent observation of an early flare-up in alkaline phosphatase (AP) levels, which was defined as a ≥25% AP increase within three months after treatment initiation, followed by a subsequent decline below baseline within six months. Results: Midostaurin was used in first-line (1L) or second and further lines (2L+; median 1 prior treatment line, range 0-4) in 63 (80%) and 16 (20%) patients, respectively. In 1L/2L+, median overall survival (OS) was 2.6/2.4 years. At baseline, the presence of additional somatic mutations in SRSF2 (n=36, 46%, HR 2.0 [1.2-3.6], P=0.014), ASXL1 (n=15, 19%, HR 2.0 [1.0-3.9], P=0.043), and EZH2 (n=6, 8%, HR 4.3 [1.7-11.3], P=0.003) significantly stratified patients according to their hazard ratio-weighted risk (median OS, 5.8 vs. 2.9 vs. 1.0 years; P<0.001). In 25 evaluable patients, the variant allele frequency in 72 additional somatic mutations remained stable (mean change 8%, absolute change >5% in 16/72 (22%) mutations). New mutations were identified in 9/25 (36%) patients during follow-up (Figure). Durable responses (complete, partial, clinical improvement) according to modified Valent criteria, IWG-MRT-ECNM criteria or Pure Pathological Response (PPR) criteria over a median duration between 12 and 24 months were achieved in 60%, 29% and 13% of patients, respectively. Within the first 12 months, duration of response was associated with an OS benefit ( P<0.001). An AP flare-up was observed in 22/79 (28%) patients, was paralleled by contemporaneous decrease of serum tryptase (median -35%, range -82 - 191%) and resulted into improved OS (median 5.8 vs. 2.2 years, P=0.007). Multivariable analysis identified the AP flare-up ( P=0.029), a ≥25% reduction of bone marrow (BM) mast cell (MC) infiltration ( P=0.046) and a ≥25% reduction of the KIT D816V expressed allele burden (EAB; P=0.034) at any time within the first 6 months as independent markers for improved OS (Table). Dynamic risk assessment of the independent parameters during follow-up allowed to abrogate a negative baseline risk-categorization. The initial dose was 200 mg/d (100 mg BID, including patients with a prespecified rapid dose escalation), 150 mg/d or 100 mg/d in 63/79 (80%), 2/79 (3%) and 14/79 (18%) patients, respectively. In the combined 150 mg and 100 mg cohorts, a dose increase to 200 mg/day was achieved in 9/16 (56%) patients. The 200 mg could be maintained at month 3, 6, 12, 24, and 36 in 50/63 (79%), 30/48 (63%), 23/34 (68%), 15/22 (68%) and 9/9 (100%) patients, respectively. Overall, 96 adverse events (AE) led to dose-adjustment (including temporary or permanent discontinuation). Hematologic and nonhematologic toxicities accounted for 24 (25%) and 36 (38%) of AEs with neutropenia (n=8, 8%) and nausea/emesis (n=22, 22%) being the most common AEs leading to dose-adjustment. Of note, the various dose levels had no impact on response or survival. Conclusions: Baseline mutations in SRSF2, ASXL1 and EZH2 conferred resistance to midostaurin. The various dose levels had no impact on response or survival. The on-treatment parameters AP flare-up, and a ≥25% reduction of BM MC infiltration and of KIT D816V EAB abrogated a negative baseline risk-categorization. No new safety signals occurred.

Inhibition of EZH2 Improves CART19 Immunotherapy By Reprogramming Lymphoma Tumor Cells and Enhancing T-Cell Functionality

Introduction: Anti-CD19 chimeric antigen receptor T cell (CART19) immunotherapy provides a high response rate in diffuse large B-cell lymphoma (DLBCL) and follicular lymphoma (FL) patients, but only ~30-40% of patients maintain a durable remission. The factors contributing to lymphoma resistance to CART19 are numerous, multifaceted, and coincidental, such as tumor intrinsic properties, CART dysfunction, the immunosuppressive tumor microenvironment (TME), and host factors. However, most strategies currently in development to increase CART efficacy only address one resistance mechanism at a time; therefore, it is unlikely that these approaches will be consistently effective in a group of heterogeneous patients. In this study, we sought to develop a strategy to overcome multiple resistance mechanisms simultaneously. Epigenetic modulation offers a promising approach to this goal, as it can reshape the tumor landscape, as well as immune cells. DLBCL/FL cells depend for their survival on the methyltransferase EZH2, which represses gene expression by generating histone 3 lysine 27 trimethylation. Interestingly, somatic gain-of-function mutations of EZH2 are frequently found in DLBCL/FL and drive lymphomagenesis and impair tumor B-cell to T-cell interactions, leading to an immune evasive phenotype. Therefore, we hypothesized that EZH2 inhibition could enhance CART anti-tumor effect, remodeling the entire tumor ecosystem by: a. inhibiting lymphoma growth; b. increasing lymphoma immunogenicity; and c. enhancing T cell function ( Fig. 1A). Methods and Results: Through short-term killing assays, we compared CART19 alone to CART19 combined with the EZH2 inhibitor tazemetostat (taz), and demonstrated that taz enhances CART19 tumor killing of DLBCL cell lines [OCI-Ly18 and Toledo (with wild-type EZH2) and SU-DHL-4 (with mutant EZH2)]. Interestingly, the highest effect was observed when tumor cells were pre-incubated with taz and taz was kept in the coculture with CART19. This finding underscores the importance of tumor priming to improve CART19 recognition and activation. Since EZH2 is also expressed by T cells, we tested if EZH2 inhibition impacted CART cell function. Co-treatment of lymphoma cell lines with taz and CART19 was associated with higher cytokine secretion over time (INFy and TNF) by CART cells and CART cell expansion. Most importantly, using the sub-cutaneous OCI-Ly18 xenograft lymphoma model in immunodeficient NSG mice, we demonstrated that taz administration improved tumor control ( Fig. 1B) and CART19 expansion and infiltration in vivo. Mechanistically, we studied the molecular changes in lymphoma cells (OCI-Ly18 and SU-DHL-4) induced by exposure to taz/CART19 or CART19 alone by performing RNA sequencing. We observed upregulation of genes involved in inflammatory response, B-cell activation/differentiation (e.g., BATCH2), adhesion (OX40L, CD80), and motility (CAECAM1, NRCAM1, EPHB2, CXCL16, CXCL10), sustaining the hypothesis that EZH2 inhibition changed lymphoma immunogenicity and the tumor:CART cell interaction. Indeed, functionally, we observed that taz exposure increased tumor:CART cell interaction in vitro as demonstrated by increased avidity (zMovi assay). Further, single-cell RNA sequencing performed on circulating CART19 cells from taz-treated-mice revealed enrichment in naïve and less exhausted CART cells. Lastly, we assessed whether increased activation of EZH2 in tumor cells reduces responses to CART19 in the clinic. We retrospectively analyzed a cohort of large B-cell lymphoma patients treated with commercial CART19 (tisagenlecleucel and axicabtagene ciloleucel) at the University of Pennsylvania between January 2018 and March 2023 for response (Lugano criteria) according to their EZH2 mutational status. Patients harboring EZH2 activating mutations (14/69) had a reduced complete response rate to CART19 as compared to wild-type patients (15.4% vs. 40.0%). Conclusions: Our data demonstrate that modulation of EZH2 enhances CART19 immunotherapy in preclinical models of lymphoma. EZH2 inhibition rewires lymphoma immunogenicity, making tumor cells more susceptible to CART19 killing and reducing CART19 terminal differentiation. By understanding and modulating the interplay between tumor and CART cells, we can unlock the full potential of CART19 immunotherapy in DLBCL/FL patients, aiming at long-lasting treatment outcomes.

Genetic Evolution from Chronic Myeloproliferative Neoplasms to Acute Myeloid Leukemia: An Analysis of Forty-Six Paired Samples

Background: Secondary acute myeloid leukemia (sAML) may arise from chronic myeloproliferative neoplasm (MPN). The genetic evolution pattern may be understood by paired sample analysis. Knowledge of genetic change in MPN/sAML is still limited and more extensive studies should be done. Patients and Methods: Forty-six paired samples (27 males) at diagnosis of MPN (12 polycythemia vera, 6 essential thrombocythemia, 25 primary myelofibrosis and 3 MPN-unclassified) and sAML transformation were available. Mutational analyses of 27 genes ( JAK2V617F, CALR, MPL, ASXL1, IDH1, IDH2, TET2, DNMT3A, EZH2, SRSF2, U2AF1, SF3B1, ZRSR2, SMC1, STAG2, SMC3, RUNX1, SETBP1, IKZF1, WT1, K-RAS, N-RAS, C-CBL, TP53, RAD21, BCOR and BCORL1) were performed. Mutations and their variant allele frequencies (VAF) were measured by next generation sequencing. Results: At baseline (MPN), the mutation number was 2 (maximal 5). Forty-five samples harbored driver gene mutations (31 JAK2V617F, 13 CALR and 1 MPL). Twenty-eight samples harbored at least one epigenetic regulator mutations (11 TET2, 8 DNMT3A,7 ASXL1, 5 EZH2, 2 IDH2, 1 IDH1). Twelve samples harbored spliceosome mutations which were mutually exclusive (6 SRSF2, 3 SF3B1, 2 U2AF1 1 ZRSR2). Other mutations were RUNX1, BCORL1 (n=2 each), CBL and BCOR (n=1 each). In sAML, the median mutation number was 3 (maximal 7). Loss of mutation was found for JAK2V617F (9/31), TET2 (1/11) and SRSF2 (1/6). Acquisition was most common for RUNX1 (n=9), followed by TP53, ASXL1 (n=5 each), K-RAS (n=4) , ZRSR2, STAG2 (n=3 each). The median number of acquired mutation was 1 (maximal 5). The frequencies of gene mutations are summarized in Figure 1A. The baseline VAF of JAK2V617F was high (>35%) in 80.6% (25/31). In progression to sAML, VAF was constant in 29.0% (9/31, VAF changes <10%), increased in 20.0% (9/31, increased VAF> 10%), decreased in 41.9% (13/31, decreased VAF>10%) (Figure 1B). The baseline VAF in CALR mutation was high (>35%) in 91.3% (12/13). VAF remained stable in 76.9% (10/13), and loss of CALR mutation was not observed (Figure 1B). TET2 mutations tended to be stable (7/16), but clonal expansion (5/16 of all mutation events at MPN), or acquisition (n=2) could be found during transformation to sAML. DNMT3A mutations remained stable (5/8), exhibited clonal expansion (2/8), or acquisition (n=1) in sAML progression. ASXL1 mutations remained stable (6/7), with clonal expansion (1/7), or acquisition (n=5) during MPN/sAML progression. All EZH2 mutants had clonal expansion (5/5) and one acquired in sAML (Figure 1B). We found that CALR mutationwas often the founding clone with high VAF at MPN phase, stable clone during sAML, and might acquire mutations in signaling pathways (1 CBL, 1 KRAS), epigenetic regulators (2 ASXL1, 1 IDH2), transcription factors (2 RUNX1, 1 BCOR), spliceosome (2 ZRSR2, 1 SF3B1), and cohesin complex (1 STAG2). JAK2 mutationwas often preceded by other ancestral mutations such as TET2, ASXL1, DNMT3A, EZH2, IDH2, SRSF2 or ZRSR2. During evolution, leukemia arose from non- JAK2 mutated clones with mutations in EZH2, DNMT3A, RUNX1, EZH2, SETBP1, or acquisition of TP53, SF3B1, BCOR and STAG2 mutations) in sAML. In outcome, the median time from MPN to sAML was 82 (range 3.7 to 338.5) months. Female gender, loss of JAK2V617F, presence of U2AF1 and absence of IDH1 were associated with shorter time to sAML transformation. No other genetic mutation in our gene panel or the number of mutations harbored by patients in our cohort had significant impact on time to sAML. Marked increase of VAF was observed for JAK2 (7/22) , DNMT3A (1/7) , IDH1 (2/3), IDH2 (1/3), TET2 (3/10) , EZH2 (4/5), C-CBL (1/1) and SRSF2 (1/4). Marked decrease of VAF was observed for JAK2 (4/22), MPL (1/1), DNMT3A (1/7) , ASXL1 (1/8), SF3B1 (2/3), SRSF2 (1/4) and U2AF1 (1/2). Multiple mutational clones were detected for TET2 (two clones in 4 samples and 3 clones in 1). Clonal expansion and reduction were observed in two pairs of samples upon sAML transformation. Conclusions: At the MPN stage, most patients had driver mutations with frequent co-mutations of epigenetic modifier or spliceosome genes. CALR mutant clones were stable while for JAK2, sAML often arose from clones without JAK2V617F which acquired RUNX1, TP53, ASXL1 and K-RAS. Research funding:Ministryof Science and Technology Council,Taiwan (NSTC 112-2314-B-182-055) and Ministry of Health and Welfare, Taiwan (112-TDU-B-222-124001)

Valemetostat for Relapsed or Refractory B-Cell Lymphomas: Primary Results from a Phase 1 Trial

Introduction: B-cell non-Hodgkin lymphomas (B-NHLs), including diffuse large B-cell lymphoma (DLBCL) and follicular lymphoma (FL), are among the most common NHLs. Enhancer of zeste homolog (EZH)2 and EZH1 are methyltransferases that catalyze the trimethylation of histone H3 at lysine 27 (H3K27me3); this repressive transcriptional mark is broadly associated with gene silencing. EZH2 is involved in mediating B-cell development. Valemetostat tosylate (valemetostat) is a novel, potent, and selective dual inhibitor of EZH2 and EZH1. The clinical activity of valemetostat in patients (pts) with relapsed or refractory (R/R) NHL was investigated in the phase 1 DS3201-A-J101 (“J101”; NCT02732275) trial. Interim data were reported previously. Here we report primary clinical outcomes for the subgroup of pts in J101 with R/R B-NHLs, including DLBCL and FL. Methods: This phase 1, open-label, multicenter study was conducted in Japan and the United States (US). Eligible pts were aged ≥ 18 years (y; US) or ≥ 20 y (Japan), had confirmed B-NHL or T-cell NHL (T-NHL), and were relapsed from, refractory to, or ineligible for standard therapies. The trial included a dose-escalation portion (Japan only) followed by a dose-expansion phase (Japan & US). Pts with a histological diagnosis of B-NHL were enrolled in the dose-escalation phase and received valemetostat once daily at doses of 150-300 mg/day (d) in continuous 28-d treatment (Tx) cycles. Preliminary efficacy assessment included objective response rate (ORR), complete response (CR) rate, and duration of response (DOR). DOR was estimated for responding pts using Kaplan-Meier methods. Due to the small number of pts with B-NHL, safety was assessed among all enrolled pts, including those with T-NHL in the dose-escalation and dose-expansion cohorts. Results: At the primary trial cutoff (Dec 31, 2022), 19 pts with R/R B-NHLs were registered and had received ≥ 1 dose of study drug, including 7 with DLBCL, 7 with FL, 3 with indolent B-NHL, and 2 with other B-NHLs. Median age was 66 (range 44-88) y. Most (79%) pts had an Eastern Cooperative Oncology Group performance status score of 0. Median number of prior therapies was 2.0 (range 0-6); no pt in this cohort had received prior hematopoietic cell transplantation. Overall, 90 pts with R/R NHLs were enrolled. All pts experienced at least 1 treatment-emergent adverse event (TEAE), including 78 (87%) who had treatment-related TEAEs. The most common TEAEs (any grade) were decreased platelet count (64%), dysgeusia (50%), anemia (43%), decreased neutrophil count (34%), and alopecia (33%). The most common grade ≥ 3 TEAEs were cytopenias, including decreased neutrophil count (24%), platelet count (24%), and lymphocyte count (19%). TEAEs required Tx interruption for 42 (47%) pts, dose reduction for 9 (10%) pts, and Tx discontinuation for 7 (8%) pts. The overall response rate in pts with R/R B-NHL was 47% (9/19; 95% confidence interval [CI], 24.4-71.1). Clinical responses were seen in 3/7 pts with DLBCL and 4/7 pts with FL; 1 pt in each of these groups achieved CR ( Table). Of 19 pts, 9 (47%) achieved reductions of ≥ 50% from baseline in the sum of target lesion areas during valemetostat Tx ( Figure). A gain-of-function EZH2 mutation was identified in 1 pt with FL, and this pt achieved a partial response. Median time to response overall was 3.7 (range 1.9-10.1) months (mo) and estimated median DOR for the 9 responding pts was 18.4 mo (95% CI, 5.3 mo to not reached). Among all pts who received valemetostat 200 mg/d with pharmacokinetic (PK) data available (n = 74), mean [standard deviation; SD] maximum plasma concentration (C max) on cycle 1 day 1 was 2140 [1620] ng/mL, with a median time to C max (T max) of 3.9 (range 0.2-27.8) h and a mean [SD] AUC tau of 17,500 [21,400] ng × h/mL. Conclusions: Valemetostat demonstrated encouraging clinical activity in pts with R/R B-NHLs. The safety profile of valemetostat was acceptable; cytopenias were common but manageable and did not require Tx discontinuation between 150-300 mg/d. Clinical responses were durable, with a median DOR of > 1.5 y. Results for pts in this trial with R/R T-NHLs are presented in another abstract (Jacobsen et al.) at this congress. Ongoing trials of valemetostat in pts with R/R B-NHLs include a phase 2 monotherapy trial in France and Belgium (NCT04842877) and a phase 1/2 trial of valemetostat plus rituximab and lenalidomide (R 2) in the US (NCT05683171).

Influence of Co-Mutational Patterns in Disease Phenotype and Clinical Outcomes of Chronic Myelomonocytic Leukemia

Introduction: Chronic myelomonocytic leukemia (CMML) is characterized by recurrent somatic mutations in a conserved number of genes and functional pathways. Although specific genomic events are associated with disease phenotype and prognosis, identification of genomically-defined disease subgroups based on common recurrent cooperative genomic patterns is needed to refine disease classification and identify disease subsets with unique clinical behavior. Methods: To evaluate if CMML is defined by recurrent co-mutational profiles defining unique clinicopathologic subgroups we evaluated a cohort of 296 patients (pts) with newly diagnosed CMML. Whole bone marrow DNA was subject to 81 gene targeted next-generation sequencing analysis. Akaike information criterion (AIC) method was applied to evaluate mixture model components defining clusters based on mutational profile. Expectation-maximization (EM) algorithm was used for mixture model fitting to multivariate binary data. Unsupervised cluster membership was chosen as a function of the component with the highest weight for any individual, and we examined means of cluster centers. Cox proportional hazards models, regressing overall survival (OS) and leukemia-free survival (LFS), were fit on cluster in some cases and normalized cluster weights in other cases, with and without adjustment for age and sex. Two degree of freedom likelihood ratio tests was performed on cluster and cluster weight in all models regardless of covariate adjustment. Results: Median age of the population was 70 years [range 30-71]; 160 (54%) pts had myeloproliferative CMML (MP-CMML) and 152 (51%) had CMML-2 by WHO classification. Most frequent mutations included TET2 (51%), ASXL1 (48%), SRSF2 (40%), RUNX1 (22%), NRAS (18%), CBL (14%) and KRAS (14%) all present in >10% of pts. Based on frequency and co-occurrence of mutations, AIC optimization identified 3 unique clusters. Clusters based on mutation landscape are shown in Figure 1A. Unsupervised clustering allowed attribution of individual patients to specific clusters. Cluster 1 (C1, n=107), was characterized by near universal presence of ASXL1 mutations (86%), with lower frequency of TET2 mutations, and enrichment of RUNX1 (35%), NRAS (28%) and U2AF1 (18%) mutations. SETBP1 and EZH2 mutations were nearly exclusively observed in C1 (16% and 20% of C1 pts, respectively). All pts with ETV6 mutations belonged to this cluster. Cluster 2 (C2, n=135) was defined by universal presence of TET2 mutations (93%) with frequent SRSF2 co-mutation (56%) and lower frequency of ASXL1 (34%), RUNX1 (15%) or NRAS (12%) mutations. Despite their overall low frequency, BRAF mutations were restricted to C2, while CBL mutations were observed at similar frequencies in C1 and C2. This suggests that co-mutation profiles and genomic context differs among genes involved in RAS pathway signaling. Cluster 3 (C3, n=54) included a minor and more genomically heterogenous group enriched for SF3B1 (25%), KRAS (24%), DNMT3A (22%) and TP53 (15%) mutations, with absence of ASXL1 mutations, and low frequency of TET2 (12%) mutations. All BCORL1 and WT1 mutations and most ASXL2 and CEBPA mutations were in C3. RUNX1 mutations not only were more frequent among C1 but appeared at higher median VAF compared to other clusters (C1: 40%, C2: 11%, C3: 25%, p=0.003). Mutations in U2AF1 had higher median VAF in C3 compared to cluster 1 (49% vs 43%, p=0.017). C1 was enriched for MP-CMML (C1: 64%; C2: 48%; C3: 52%, p<0.001) and had higher frequency of del(7q)/-7 (C1: 11%; C2 0%, C3: 6%, p<0.001) and trisomy 8 (C1: 15%, C2: 7%, C3: 6%, p=0.05). Complex karyotype (C1: 1%, C2: 1%, C3: 22%, p<0.001) was nearly exclusive of C3, while C2 was more likely to be associated with a normal karyotype (C1: 59%; C1: 73%; C3: 41%, p<0.001) and higher median hemoglobin (C1: 9.8g/dL; C2: 12.1g/dL, C3: 9.7g/dL, p<0.001). In total 66% of pts received therapy with hypomethylating agents with no differences in response, median time to or duration of response between clusters. Use of Cox proportional hazards model identified that, when corrected by age and sex, patients on C1 and C3, based on attributed cluster weights, had significantly worse LFS (p=0.02, Figurer 1B) and OS (p=0.05) than those in C2. Conclusions: These data suggest that somatic mutations in CMML have unique patterns of clustering that define disease phenotype and influence disease outcomes.

Results of the Phase II of Epirchop Study, Evaluating the Efficacy of Tazemetostat in Combination with R-CHOP in Elderly Newly Diagnosed Diffuse Large B Cell Lymphoma (DLBCL): A Lysa Study

Introduction: Tazemetostat (TAZ) is a selective oral EZH2 inhibitor with a favorable safety profile and activity in pts with either EZH2wild type or mutant B-cell NHL. In the phase I part of Epi-RCHOP study, we reported that R-CHOP plus TAZ (Taz-RCHOP) was well tolerated with safety and PK results comparable to R-CHOP alone, and the RP2D of TAZ in combination with RCHOP was consistent with TAZ monotherapy (800mg BID). We report here the efficacy results of the phase II TAZ R-CHOP study (Epi-RCHOP, NCT02889523), in pts 60-80y with newly diagnosed DLBCL. Methods: Pts received 6 R-CHOP every 21 days in combination with continuous TAZ at 800 mg BID, plus 2 cycles of TAZ and R (cycle 7 and 8). Prophylaxis with G-CSF, valaciclovir and trimethoprim sulfamethoxazole were strongly recommended. Primary endpoint was PET-based complete metabolic response rate (CR, Lugano 2014) at end of study treatment (EOT, i.e 8 cycles or at time of permanent treatment discontinuation) (data cut-off was January 30, 2023). Sample size calculation was made with the expectation of an increase of 10% in CR, with an H0 hypothesis of 70% and an H1 assumption of 80%, leading to a theorical sample size of 122 pts, assuming a drop out of 5%. The efficacy set correspond to pts who signed an informed consent and received at least one dose of TAZ. Pts without response assessment (no matter the reason) were considered non-responders. Key secondary objectives were progression free and overall survival. A sensitivity analysis was performed excluding pts who withdrawn their consent (N=112). Analyses were conducted using SAS® version 9.3. Results: From July 31, 2020 to July 18, 2022, 122 pts were enrolled in 27 LYSA centers. Median age was 70 years (60-80), 57% were female, 12% had an ECOG-PS2+, 70.5% a stage IV disease and 19.7% stage III, 66% elevated LDH, 73.8% an IPI of 3-5. Mutational profile was available for 76 pts, of whom 10 (13%) had an EZH2 mutations and 26 (34%) and EZB profile as assessed with LymphGen classifier. One hundred pts (82%) received 8 cycles and 22 had a premature treatment discontinuation (PTD), 12 (9.8%) during the first 2 cycles and 10 (8.2%) between cycle 3 and 8. Reasons for PTD were: consent withdrawal (N=10, including 7 during cycle 1 & 2), adverse events (AE, N=6, including 2 treatment related), death (N=2, both due to septic shock), protocol deviation (N=2), progressive disease (N=1) or physician decision (N=1). Overall, the median percentage of TAZ dose received was 98.4% (mean 77.2%, Q1: 61%; Q3: 100%), and AE led to TAZ interruption in 4.1%, discontinuation in 2.8% and dose reduction in 2.4% of the cases. Mean time between cycles was 21.5 days. In oct 2020, after the inclusion of 22 pts, recommendation to cap vincristine at 1mg was done, due to an excess of constipation. At end of treatment or PTD, 92/122 pts (75.4%, IC95: 66.8-82.8%) achieved CR, 8 (6.6%) PR, 5 (4.1%) had a PD, 2 (1.6%) had died (septic shock) and 15 (12.3%) were not evaluated and considered as non-responders. The primary objective was not met in this efficacy set, with a CR of 75.4% (lower than the H1 at 80%). The sensitivity analysis, excluding the 10 pts that withdrawn their consent (all non-evaluated), showed a CR rate of 82.1% (92/112, IC95: 73.8-88.7%) and PR rate of 7.1%. After a median follow-up of 18.5 months (Range = [0.2; 28.1]), 17/122 pts had a relapse/progression (13.9%) and 12 had died: 4 due to lymphoma, 3 to COVID-19, 4 to AE (2 septic shock, 1 acute myeloid leukemia and 1 heart failure), 1 unknown cause (in CMR). The estimated 18m PFS and OS were 77.7% (IC95: 67.5-85.1%) and 88.8% (IC95: 79.9-93.9%) respectively. Most frequent AE were: neutropenia (53%), anemia (51%), nausea (47%), asthenia (42%), peripheral neuropathy (37%), gastro-intestinal hypomotility (35%), weight loss (28%), vomiting (24%), thrombocytopenia (24%). AE of grade 3 or more occurred in 73% of the pts and were mainly hematological AE with neutropenia (48%, including 6% of febrile neutropenia), anemia (23%), thrombocytopenia (17%) and gastro-intestinal disorder (overall 10.7%). Red blood cell and platelets transfusions were administered in 31% and 11.5% of the pts respectively. Conclusion: R-CHOP plus TAZ is doable. Efficacy results in this trial conducted during the COVID pandemic in a particularly challenging population, suggest that the combination warrant further investigation including correlative studies with molecular subclassification that will be presented.

Combinatorial BCL-2/ BCL2L1 Expression Predicts Clinical Response to Ruxolitinib in Myelofibrosis

Introduction: JAK inhibitors (JAKi) marked a revolutionary breakthrough in the treatment of patients (pts) with myelofibrosis (MF). The BCL-2 family of proteins have been implicated in both disease development and mechanisms of response/resistance to JAKi. This is further reinforced by preliminary evidence of therapeutic efficacy of combining JAK2 and BCL-xL inhibition. Aims&Methods: In the current study, we investigated the expression of three major BCL-2 family members in MF pts treated with ruxolitinib (RUX) at baseline and during treatment. Gene expression of BCL-2, BCL2L1 (encoding BCL-xL) and MCL-1 was analyzed by qPCR normalized to endogenous 18S gene using cDNA obtained from peripheral blood (PB) granulocytes; the relative gene expression (expressed as fold-change, FC) was calculated with reference to healthy controls using the Ct (2−ΔΔCt) method. Results: The study included 19 pts (10 males; median age 61 years) with MF (10 primary, 9 secondary) who received treatment with RUX. Sixteen pts were JAK2-mutated, 2 CALR-mutated, and 1 MPL-mutated. Treatment response was fully evaluable across the entire treatment period. After a median treatment time of 67 (range, 6-121) months, 7 (37%) pts achieved a spleen response (defined as a >50% reduction in palpable splenic length lasting >6 months) and were considered as responders, as compared to 12 (63%) non-responders. We did not find any significant correlation of baseline BCL-2/ BCL2L1/ MCL-1 expression with clinical and molecular characteristics, the only exception being the association between EZH2 mutation and higher BCL2L1 expression. First, we ascertained whether BCL2 family protein expression levels at baseline predicted response to RUX. We found that BCL2 and BCL2L1 were significantly more expressed in responders compared to non-responders, with median FC values of 0.14 vs 0.04 ( P=.0130) and 2.46 vs 0.51 ( P=.0096), respectively (Fig. 1A). A similar, not statistically significant, trend was observed for MCL-1 expression. Accordingly, in univariate regression logistic analysis, both BCL2 and BCL2L1 FCs correlated significantly with the probability of response to RUX. Then, we incorporated BCL-2 and BCL2L1 gene expression at baseline into a combinatorial score (CS) resulting from the product of the respective FCs (FC BCL-2 * FC BCL-xL). The CS outperformed the individual BCL2 family proteins expression in predicting RUX response, as confirmed in regression logistic analysis. ROC analysis identified 0.06 as the optimal cut-off value of the CS. In univariate analysis, pts with a baseline CS >0.06 had a significantly higher probability of responding to RUX (OR 27.5, 95% CI 2.1-236.7; P=.0037), with a superior cumulative incidence of RUX response at 24 weeks (50% vs 9%, respectively; P=.0045) (Fig. 1B). Finally, we prospectively assessed the changes in gene expression during treatment with RUX. Six out of seven responder pts had an available PB sample at the time of best response, while all non-responders were evaluated at some point during RUX therapy. Among responders, 5 lost response after a median time of 34 months, and 3/5 had an available sample for analyses at the time of response loss. Although we did not find any significant difference comparing gene expression at baseline and on treatment, we observed a trend for BCL-2 upregulation in responders at the time of best response. Furthermore, non-responders showed a down-regulation of MCL-1 expression during treatment ( P=.05). By comparing gene expression of responder pts at the time of best vs loss of response, we discovered a down-regulation for all the three genes, with a statistical significance that was reached only for BCL-2 ( P=.0471). Conclusion: Despite study limitations (mainly the small cohort), this preliminary data suggests that the expression levels of BCL2 family proteins may represent a predictor of response to RUX. Specifically, we developed a simple, combinatorial score includingbaseline BCL-2 and BCL2L1 expression that accurately discriminated pts who responded to RUX. Moreover, we showed that BCL2 family protein expression changes during RUX treatment, with potential correlations with both response achievement and loss. Further studies are needed in order to confirm and expand our data.

Impact of Genomic Landscape and Mutational Burden on Primary Endpoint Responses in the COMMANDS Study

Background: Myelodysplastic syndromes (MDS)-related anemia leads to significant morbidity, due to impaired oxygen transport and red blood cell transfusion (RBCT)-related iron overload. Erythropoiesis-stimulating agents (ESAs) are used to treat anemia and decrease transfusion burden and are effective in ~ 35% of patients (pts) with lower-risk (LR)-MDS. Luspatercept is approved for pts with LR-MDS refractory/intolerant to ESAs who need regular RBCTs. Primary resistance to ESAs is frequent, and ~ 70% of responders relapse in < 2 years. Baseline (BL) erythropoietin level ≤ 200 U/L and ≤ 2 somatic mutations are prognostic factors for better ESA response. An association of driver gene mutations with deteriorating clinical outcomes is well established in LR-MDS (Papaemmanuil E, et al. Blood 2013;122:3616-3627; Bersanelli M, et al. J Clin Oncol 2021;39:1223-1233; Nazha A, et al. J Clin Oncol 2021;39:3737-3746). The Molecular International Prognostic Scoring System (IPSS-M; Bernard E, et al. NEJM Evidence 2022;1(7):EVIDoa2200008) was developed to improve upon the shortcomings of the Revised IPSS (IPSS-R) and restratified ~ 46% of pts by adding genomic profiling to existing hematologic and cytogenetic parameters. Pts with LR-MDS typically harbor a median of 2-3 driver mutations in genes involved in MDS pathogenesis. Methods: Individual pt bone marrow samples were prepared for sequencing using the Illumina ® DNA prep with enrichment and the xGen™ hybridization capture of DNA libraries. Exon coverage was ≥ 400X for 3% sensitivity. Sequencing libraries were run on the NovaSeq6000 (Illumina ®) system and statistical analyses were conducted using R. A targeted panel of 82 genes was used. Results: At BL, 322/363 pts enrolled in the COMMANDS trial had somatic mutations in ≥ 1 gene; 11 pts did not have mutation data. Most mutations had a variant allele frequency of 3%-50%. In the intent-to-treat (ITT) population, the luspatercept arm did not show any significant differences in BL mutational burden (MB, defined as the number of gene mutations from the myeloid gene panel) between responders (R) and non-responders (NR). Interestingly, R in the ESA arm trended ( P = 0.065) towards lower MB compared with NR. Subgroup analysis revealed that ring sideroblast (RS)− pts in the ESA arm had lower MB at BL (median 1 gene mutation) compared with RS+ pts (2 gene mutations; P = 0.0004). However, no significant difference was observed in the luspatercept arm. In the ITT population (and the RS+ subgroup), compared with ESAs, luspatercept showed robust responses (Figure A) in pts with 1 (63% vs 40%; Fisher's P = 0.040), 2 (70% vs 27%; Fisher's P < 0.001), and 3 (72% vs 40%; Fisher's P = 0.018) gene mutations. However, in the RS− subgroup, luspatercept and ESAs had similar response rates independent of MB. Interestingly, more RS− pts in the luspatercept arm had ≥ 4 gene mutations (12/47 pts [26%]) versus the ESA arm (only 3 pts [6.4%]). Furthermore, these ≥ 4 mutations were in genes associated with shorter leukemia-free survival, overall survival, and progression-free survival. Of the RS− pts in the luspatercept arm, 9/12 were NR, compared to 2/3 in the ESA arm. Luspatercept showed superior clinical benefit in pts with difficult-to-treat mutations (such as ASXL1, TET2 DNMT3A ZRSR2) and favorability in pts with mutations in SRSF2 EZH2, TP53, DTA.SF3B1.n and IDH2. Primary endpoint analysis by IPSS-M (Figure B) also showed superior clinical benefit of luspatercept across risk groups compared with ESAs: Low (75% vs 38%); Moderate low (61% vs 38%); Moderate high (44% vs 21%); and High (36% vs 24%). Conclusion: In pts in the COMMANDS trial,BL MB impacted response to ESAs but not to luspatercept. In both ITT and RS+ pts, luspatercept showed either superior or comparable clinical benefit in pts with LR-MDS with various BL MB. Interestingly, both luspatercept and ESAs had similar clinical benefit across various MB in the RS− subgroup. However, lower MB favored higher responses to ESAs in the RS− subgroup, and higher MB in genes associated with poor prognosis significantly impacted response rates in the luspatercept arm. Despite the presence of these imbalances in BL MB, RS− pts had similar response rates to luspatercept as to ESAs. Pts with LR-MDS with difficult-to-treat mutations also showed superior or favorable clinical benefit with luspatercept. Finally, luspatercept showed superior clinical benefit to ESAs in pts with LR-MDS across all IPSS-M risk groups.

Joint Analyses of Serum Proteins and Circulating Tumor DNA Improves Risk Assessment and Subtype Stratification in Large B-Cell Lymphomas

Introduction Inadequate dismantling of clinical and biological heterogeneity is an obstacle for improving outcome in large B-cell lymphoma (LBCL). Circulating tumor DNA (ctDNA)-based stratification holds great potential in resolving these challenges. However, the assessment is limited to genetic content, and excludes host response from the estimates. Previously, we have shown that an inflammatory signature identified from the pretreatment serum proteins translates to poor survival, and multiple serum proteins correlate with LBCL genetic subtypes. To further improve risk stratification and molecular characterization of LBCL from the liquid biopsy, we co-analyzed serum protein and ctDNA levels in LBCL patients treated in two Nordic Lymphoma Group (NLG) trials. Materials and methods Our discovery cohort consisted of 122 patients less than 65 years of age with clinically high-risk (age adjusted IPI ≥ 2) LBCL, who were treated in NLG-LBC-06 trial with immunochemotherapy. Plasma and serum samples were collected prior to treatment. Cell free DNA was extracted from plasma and sequenced with in-house adapted duplex sequencing platform using custom targeted panel of 347 lymphoma driver genes and immunoglobulin loci. An inflammation score was composed as log transformed mean of the most pertinent inflammatory serum proteins detected in the inflammatory signature (IL10, IL2RA, CXCL9, IL18, GZMB, PD-L1 and IFNG), and their levels were measured using antibody-based Luminex assay (pg/ml, R&D Systems). In addition, CCL17 and TNFRSF13B levels were analyzed to uncover their associations with genetic subtypes. An independent cohort of 91 patients treated in our previous NLG-LBC-05 trial was used for validation. Results Combined analysis of serum proteins and ctDNA identified a group of patients (n=12, 10%) with high serum inflammation scores and ctDNA burden (≥ 3.75 hGE/ml), which translated to poor survival compared to the patients with low concentrations of either inflammatory proteins or ctDNA, or both (progression free survival, PFS, hazard ratio 7.33, 95%-CI 2.59-20.79, P < 0.001, Figure 1A). This finding was confirmed in the independent validation cohort. In both cohorts, the combined analysis showed higher specificity in survival prediction as compared to the ctDNA-based assessment alone, indicating that inflammatory serum markers alongside with ctDNA can identify those patients who, despite of having high ctDNA burden, have excellent survival. Beyond inflammation, the levels of serum TNFRSF13B and CCL17 correlated with mutations associating with non-germinal center diffuse large B-cell lymphoma (non-GCB DLBCL)/MCD subtype and primary mediastinal B-cell lymphoma/grey-zone lymphoma (PMBCL/GZL), respectively. For example, serum TNFRSF13B levels correlated positively with mutations in MCD genes, such as CD79B, SETD1B, PIM2 and PRDM1, and negatively with mutations in EZB genes EZH2 and CREBBP in both cohorts (P < 0.05, Figure 1B). Supporting our earlier findings, high CCL17 levels revealed a group of patients diagnosed with DLBCL not otherwise specified or high-grade lymphoma but with a mutational landscape resembling PMBCL/GZL, including mutations in TNFAIP3, ITPKB, B2M, BTG1 and STAT6 (P < 0.05). Conclusion Our findings demonstrate that co-analysis of inflammatory serum markers along with the ctDNA improves ctDNA-based survival prediction. Moreover, analysis of serum proteins refines molecular classification. Altogether, joint analysis of serum proteins and ctDNA provides new tools to dismantle LBCL heterogeneity.

Novel Protac-Based EZH2 Degraders Effectively Target EZH2-Driven Lymphoid Malignancies By Abolishing Both Methylation-Dependent and -Independent Functions

Across various cancers, overexpression or mutation of the epigenetic silencer EZH2 correlates with invasive cancer growth, resistance and poor survival outcomes. While the tumorigenic role of EZH2 is largely attributed to the H3K27me3-mediated repression of tumor suppressor genes, reports have also established a methylation-independent role for EZH2 in the transcriptional activation of oncogenes, particularly in aggressive cancers like Natural Killer T-cell Lymphoma (NKTL). Here, traditional EZH2 inhibitors have been ineffective. We hypothesized that targeted depletion of the EZH2 protein will more effectively disrupt oncogenic signals arising from enzyme-independent activities of EZH2. Thus, we embarked on the development of EZH2 Proteolysis Targeting Chimeras (PROTACs) to trigger targeted ubiquitination and proteasome-mediated degradation of EZH2. No clinical EZH2 PROTAC has been reported yet. Our initial efforts focused on the iterative synthesis of a series of PROTAC candidates considering factors such as permeability, solubility and stable ternary complex formation. We developed a library of 53 compounds with various permutations of EZH2- and E3 ligase-binding ligands as well as linker lengths. Through extensive screening and testing of the EZH2 degradation activity via the Nano-Glo HiBiT lytic detection system and immunoblotting, we identified three lead Protac candidates. Compared to the clinical EZH2 inhibitor Tazemetostat (Taz), EZH2 PROTACs, C2911 and C1311 demonstrated higher cytotoxic activity in diffuse large B-cell lymphoma (DLBCL), a cancer in which Taz was evaluated during clinical trial. Importantly, C2911 and C1311 also successfully triggered EZH2 degradation in a dose-dependent manner thereby qualifying for further evaluation in NKTL. Previous work has highlighted a critical role for JAK3-mediated phosphorylation of EZH2 in promoting NKTL proliferation. Treatment of NKTL with C2911 and C1311 leads to a dose and time-dependent EZH2 degradation, loss of cell viability and increased apoptosis. These effects were absent with Taz and Pomalidomide treatments. The concomitant loss of H3K27me3 levels as well as PRC2 complex subunits, SUZ12 and EED suggest effective degradation of the EZH2 protein. We also observed that induction of NKTL cell death required a longer treatment period as compared to DLBCL. This may be potentially ascribed to the longer half-life of the EZH2 protein in NKTL as determined through cycloheximide treatment. In order to validate the mechanism of action of the EZH2 PROTACs, cells were either pretreated with pomalidomide or siRNA targeting cereblon. Indeed, this mitigated PROTAC-induced degradation of the EZH2 protein and rescued cancer cell death. Similarly, inhibiting the activity of the 26S proteasome through bortezomib also prevented EZH2 degradation. Characterization of EZH2 PROTAC-induced protein expression changes through immunoblotting highlighted that there was specific loss of H3K27me3 and H3K27me2 but not H3K27me1. Of note, we detected a concomitant decrease of Jak3 protein expression and STAT5 phosphorylation levels, more pronounced than PRC2 complex subunits. This suggests that the PROTAC may act by disrupting the non-canonical binding of EZH2 to Jak3 in NKTL. Furthermore, gene expression analyses revealed that EZH2 PROTAC treatment more effectively reactivated canonical EZH2 target genes such as MYT1 and ANPEP as compared to Taz. As the JAK-STAT-MYC axis is dysregulated in NK leukemia, we also evaluated the gene expression of c-Myc and c-Myc target gene, E2F1. EZH2 PROTAC treatment reduces the transcription levels of these oncogenes corroborating with loss of c-Myc protein expression. Studying the pharmacokinetics of the lead PROTACs in a mouse model revealed good plasma stability, half-life (> 4 h), and low clearance. Collectively, our data supports a critical role for EZH2 PROTACs in abolishing both the enzyme-dependent and independent activities of EZH2 through protein degradation, resulting in enhanced anti-cancer activity against DLBCL and NKTL. This may potentially benefit other EZH2-driven cancers. Further evaluation of the EZH2 PROTACs for clinical application is in progress. EZH2 PROTACs will next be tested in vivo. An in-depth investigation of the mechanisms stabilizing EZH2 protein levels and underlying PROTAC induced-cell death will be made to identify potential mechanisms of resistance.

Clinical Factors but Not Somatic Mutations Predict for Survival in Patients with Myelofibrosis Undergoing Allogeneic Hematopoietic Cell Transplant: Analysis of the North American Myelofibrosis Transplant Outcome (NAMTO) Study

Introduction: Myelofibrosis (MF) is a clonal hematologic malignancy characterized by constitutive JAK-STAT activation and aberrant cytokine signaling. Allogeneic hematopoietic stem cell transplantation (allo-HCT) remains the only potentially curative therapy in MF. The contribution of disease-, patient- and donor-related factors to allo-HCT outcomes remains to be fully elucidated, as well as the presence of somatic mutations in genes such as ASXL1, EZH2, SRSF2, U2AF1 and IDH1/2 which are associated with worse prognosis in MF patients (pts). In this large multi- center retrospective analysis, we aimed to study the impact of clinical and molecular mutations on transplant outcomes. Methods: This analysis including 498 pts from 11 centers in North America and Canada. Univariate proportional-hazard Cox regression analysis stratified by center was used to assess the association of patient, transplant, and disease characteristics on overall survival (OS). Baseline patient demographic data and disease characteristics were selected as covariates in the multivariate analysis. Results: Pts transplanted between 2002-2021 were included in this analysis. Baseline and transplant characteristics are summarized in table 1. The 1- and 2-year OS was 77% (95% CI; 73-81) and 70% (95% CI; 66-74) and non-relapse mortality (NRM) 19% (95% CI: 17-21) and 23% (95% CI: 19-27), respectively. The cumulative incidence (CMI) of relapse at 1- and 2-years was 12% (95% CI; 10-14) and 16% (95% CI; 12-20). The CMI of acute graft versus host disease (aGVHD) grade II-IV was 31% (95% CI; 27-35) at 3 months and 42% (95% CI; 38-46) at 1-year post-transplant and grade was III-IV 13% (95% CI; 11-15) and 18% (95% CI; 14-22), respectively. The CMI of neutrophil engraftment at 1 and 3 months was 90% (95% CI: 87-93) and 97% (95% CI: 95-95) and for platelets 55% (95% CI: 50-59) and 80% (95% CI: 76-83). Univariate analysis included pts (age and gender), transplant (donor type and conditioning regimen intensity) and disease characteristics (DIPSS, mutations, cytogenetics (CG), blood counts, and spleen size). Hemoglobin > 10 g/dL (HR .5, 95% CI .34 -.73 p=3 x 10 -4) and platelets >50× 10 9/L (HR .59, 95% CI .42-.81, p=.0013) prior to transplant were associated with improved OS. High risk DIPSS was associated with decreased OS (p=0.0002). Mutations in ASXL1, EZH2, IDH1/2, U2AF1 and SRSF2 were not associated with decreased OS in this analysis (Figure 1). However, mutations in ZRSR2 were associated with inferior OS (HR 2.07, 95% CI 1.08-3.95, p=.0252). Lastly, JAK2 which had the most frequent mutations was not associated with OS (HR .0.93, 95% CI .65-1.31). There was no association between the CG risk groups and OS. Splenomegaly, measured radiographically, had no impact on OS but was strongly associated with engraftment (better engraftment defined as HR>1). For platelets, spleen size of 15.6-18.9 cm HR of 0.69 (95% CI .47-1, p=.0489) and size >18.9-22.5 cm HR of 0.48 ( 95% CI .33-.7, p=1x10^-4). For neutrophils, spleen size >19.9-22.5 cm had a HR of 0.68, (95% CI .48-.96, p=.0268) and size>22.5 cm had a HR of 0.65 (95% CI .46-.91, p=.0114). Mismatched unrelated (MMURD) and haplo identical donors had no impact on survival but were associated with delayed platelet engraftment; MMURD (HR .67, 95% CI .47-.96, p=.0298) and haploidentical donors (HR .56, 95% CI .39-.8, p=.0017). In a multivariate analysis adjusted for age, gender, highest DIPSS, donor type and conditioning regimen, platelets > 50× 10 9/L (HR .61, 95% CI .44-.87, p=.0053) hemoglobin >10 g/dL (HR .6, 95% CI .4-.9, p=.0244) and lower DIPSS at the time of transplant were associated with improved OS. Conclusions: In this large multicenter analysis only clinical variables; hemoglobin and platelets, were found to be associated with OS after allo-HCT in MF patients. Somatic mutations associated with poor prognosis were not associated with OS suggesting that transplant can overcome their negative impact. Splenomegaly was associated with delayed engraftment but not OS. Interestingly, using alternative donors (MMURD and haplo identical) didn't have a negative effect on OS, possibly reflecting the use of post-transplant cyclophosphamide for GVHD prophylaxis in recent years. These results highlight the importance of biologic factors in the prognostication of outcomes in MF pts undergoing allo-HCT independent of somatic mutations. Supported by the American Society of Hematology (ASH) and MPN Research Foundation

What Is the Optimal Treatment Modality in Molecularly Defined Secondary AML? a Multicenter Cohort Study

Introduction Secondary ontogeny acute myeloid leukemia (AML), defined by the presence of mutations in ASXL1, BCOR, EZH2, SF2B1, SRSF2, STAG2, U2AF1 or ZRSR2 was recently integrated into both the ICC and WHO diagnostic criteria, as well as into the ELN 2022 risk classification as adverse risk. However, it is unknown whether cytarabine + anthracycline (7+3), liposomal cytarabine and daunorubicin (CPX-351) or hypomethylating agent + venetoclax (HMA+VEN) is the optimal frontline treatment for these patients (pts). We performed the largest multicenter retrospective cohort study to date, dedicated to pts with molecular-defined secondary ontogeny AML, comparing treatment modalities and assessing the impact of clinical and molecular characteristics on response and survival. Methods We included pts with newly diagnosed (ND) AML who were treated at 4 large academical centers with 7+3, CPX-351 or HMA+VEN. Secondary ontogeny was defined as absence of TP53 mutation and presence of at least one of the aforementioned mutations. Composite complete response (cCR) was defined as complete response (CR) + CR with incomplete count recovery (CRi). Logistic regression was fitted to evaluate odds ratio (OR) for cCR. Overall survival (OS) was compared between groups by log-rank test. COX regression for OS were fitted to evaluate effect of secondary/co-mutations within each treatment group, as well as the effect of treatment and allogeneic stem cell transplantation (SCT) as a time-varying covariate. Results Out of 1132 ND AML pts in the entire cohort, 401 (35%) were molecularly defined as secondary ontogeny and included in the final analysis. Initial treatment was 7+3 in 173 (43%), HMA+VEN in 162 (40%) and CPX-351 in 66 pts (17%). Pts in the HMA+VEN group were older (median age 74 years[yrs]; CPX351 66 yrs; 7+3 63 yrs, p<0.001), while pts in the CPX351 group were more likely to have prior myeloid neoplasm (n=52 [79%]; HMA+VEN n=72 [44%]; 7+3 n=48 [28%], p<0.001) and prior HMA exposure (n=27 [41%]; HMA+VEN n=23 [14%]; 7+3 n=28 [16%], p<0.001). The cCR rates were 56% (97/173), 56% (90/162) and 44% (29/66) in 7+3, HMA+VEN and CPX-351, respectively (p=0.21). In the 7+3 group, the presence of RUNX1 co-mutation was associated with lower cCR rate (OR 0.8, 95% confidence interval [CI] 0.7-0.95, p=0.01), while PTPN11 was associated with higher cCR rate (OR 1.4, 95% CI 1.1-1.8, p=0.011). In the HMA+VEN group, monosomal karyotype (OR 0.7, 95% CI 0.5-0.9, p=0.002), NRAS co-mutation (OR 0.6, 95% CI 0.5-0.8, p<.001) and SF3B1 mutation (OR 0.76, 95% CI 0.6-0.9, p=0.008) were associated with lower cCR rate and FLT3-TKD with higher cCR rate (OR 1.5, 95% CI 1.1-2.1, p=0.01). In the CPX-351 group, NRAS co-mutation was associated with lower cCR rate (OR 0.65, 95% CI 0.5-0.9, p=0.005). As most younger pts (aged ≤ 60 yrs, n=85) were treated with 7+3 (n=64) or CPX-351 (n=13) and almost exclusively older pts (age >75, n=78) were treated with HMA+VEN (n=74), we performed age-group based analyses. In pts aged > 60 yrs (n=318), the median OS (mOS) was comparable between groups (7+3: 16 months [mo], 95% CI 13-27; HMA+VEN 15 mo, 95% CI 13-19; CPX-351 11 mo, 95% CI 9-28 p=0.57). Similar results were seen in pts 60-75 yrs (n=238): 7+3 mOS 16 mo, 95% CI 13-27; HMA+VEN mOS 16 mo, 95% CI 13-26; CPX-351 mOS 10 mo, 95% CI 8-28, p=0.74. The effect of secondary/co-mutations on survival differ between groups: For 7+3 splicing mutations were associated with worse OS, whereas IDH1/2 were associated with improved OS ( Figure). Conversely, in HMA+VEN and CPX351 groups K/NRAS co-mutations were associated with worse survival. NPM1 co-mutation did not affect survival in any treatment group. In multivariable analysis, age, prior myeloid disease, K/NRAS co-mutations and monosomal karyotype were associated with worse OS ( Table). Conversely, BCOR mutation, IDH1/2 co-mutation and SCT were associated with improved OS. Treatment with HMA+VEN or CPX351 were not statistically different vs 7+3, although there was a trend for better OS with HMA+VEN vs 7+3 (HR 0.68, 95% CI 0.44-1.03, p=0.069). Conclusion In pts with ND secondary ontogeny AML the OS with HMA+VEN was at least comparable to 7+3 or CPX351 when adjusted for multiple covariates. The effect of co-mutations on response and OS differed between treatment modalities and may aid in optimal treatment selection in this population. Prospective trials should evaluate the potential superiority of HMA+VEN and effect of co-mutations in secondary ontogeny AML.

Truncating SPEN Mutations Highlight BN2-Subtype DLBCL with Aggressive Biology and Features of Immune Evasion

Introduction: Molecular classifications have been developed to characterize the heterogeneity of diffuse large B cell lymphoma (DLBCL), with activation of BCL6 and Notch signaling pathways acting as driving pathogenic features in C1/BN2 subtype tumors. Among C1/BN2 defining variants are truncating/inactivating SPEN mutations. SPEN regulates the Notch signaling pathway by initiating formation of a repressive complex that facilitates transcriptional repression of Notch target genes. Our group has identified SPEN mutations enriched in DLBCL cases failing to achieve event-free status at 24 months (EFS24). This contrasted with generally favorable outcomes in C1/BN2 tumors, suggesting a potential high-risk molecular feature with unexplored significance. Presenting an opportunity to expand underlying mechanisms and risk stratification in C1/BN2 tumors, we aimed to use a functional genomic approach, combined with clinical data, to characterize the alternative biology stemming from SPEN truncating mutations. Methods: FFPE tumor biopsies from newly diagnosed DLBCL cases (N=444) enrolled in the Mayo Clinic/Iowa Lymphoma Molecular Epidemiology Resource (MER) program were analyzed by WES (n=404) and RNA-seq (n=321). Biologic and clinical variables were annotated for all cases. CRISPR/Cas9 introduced truncating mutations to the endogenous SPEN locus in OCI-LY3 & SU-DHL-2 ABC-type human cell lines to establish models of SPEN depletion. Functional in vitro analysis utilized standard methods for RNA-seq, cell proliferation, western blot, and flow cytometry. Results: WES identified 29/404 ndDLBCL (7.2%) harboring SPEN mutations; n=17 missense and n=12 nonsense or frameshift insertions/deletions (truncating variants - [trunc]), the later considered as the focal point of our study. Against all cases, SPEN trunc cases displayed enrichment for high-risk factors including non-GCB COO (p=0.06, OR=3.7, 95% CI [0.9, 22.2]) and primary refractory disease (PTR; p=0.02, OR=5.0, 95% CI [1.05, 19.9]), and demonstrated inferior OS (p=0.06, HR=2.2), where a majority of clinical progression events occurred within 12 months of diagnosis. Leveraging RNA-seq, we observed 11 of 11 SPEN trunc cases exhibiting a double-hit negative gene expression signature, 9/11 cases with inflammatory or depleted microenvironment (LME), and 8/11 with a signature associating with intermediate/high risk of EFS24 failure. Applying the LymphGen algorithm, 5/12 SPEN trunc cases received the BN2 classification, observing co-occurring mutations with CD70 (p<0.01, OR=9.68), BRCA2 (p=0.03, OR=5.84), TET2 (p=0.02, OR=4.91), IRF4 (p=0.02, OR=7.27), and PTPRD (p<0.01, OR=8.31) genes, and were mutually exclusive with ARID1A, BCL2, EZH2, FAS, HLA-B, IRF8, and TMEM30A mutations ( Figure 1A). Isolating SPEN trunc against BN2 cases without SPEN variants (n=14), despite similar clustering of non-GCB COO (p=0.7), PTR was exclusively observed in SPEN trunc cases, accompanied again by inferior OS (p=0.07, HR=4.2; Figure 1B). In the OCI-LY3 SPEN depletion model, GSEA analysis from RNA-seq revealed activation of E2F (NES=2.7; p=9.4E-20) and MYC target genes (NES=2.3; p=4.1E-6), while both OCI-LY3 and SU-DHL-2 models featured depletion of antigen presentation genes (NES= -1.8, p=5.7E-4; NES= -2.2, p=3.8E-7, respectively). A decrease of MHC class II proteins (HLA-DR, HLA-DP) was confirmed by flow cytometry in both models (p<0.01). Hypothesizing loss of SPEN enhances reliance on the BCL6-HDAC3 axis featured in BN2 tumors, we treated both SPEN depletion models with a class-I HDAC inhibitor highly selective for HDAC3, BRD-3308, and indeed observed a 1.4 and 2.4-fold increase in sensitivity compared to WT cells (p=0.07, p<0.01, respectively). Significance: We find SPEN trunc mutations in poor acting DLBCL cases with clinical and biologic characteristics that diverge from C1/BN2 biology. The enhanced rate of clinical progression highlights urgency to better characterize these tumors. Our data suggests loss of SPEN regulatory mechanisms may act cooperatively with C1/BN2 biology to facilitate tumor immune evasion and drive progression through Notch-mediated pathways. Importantly, in vitro evidence shows SPEN deficient lymphoma cells are susceptible to targeted therapeutics against dependent pathways, providing rationale for advancing individualized care strategies for affected patients.

Pre-Transplant Somatic Co-Occurring Mutations (by next generation sequencing) in Acute Myeloid Leukemia: Frequency and Impact on Clinical Outcomes after Allogeneic Hematopoietic Cell Transplantation - a Large Study on Behalf of the EBMT Acute Leukemia Working Party

Background: Acute myeloid leukemia (AML) is a very heterogeneous hematological malignancy, which includes numerous genetically defined subsets. The genomic classification of AML with the identification of mutations in transcription factors, epigenetic modifiers, spliceosome, cohesin complex, and signaling pathways has led to a more accurate risk stratification model. The main genetic aberrations included in the European LeukemiaNet (ELN) 2022 classification are NPM1 (risk group according to karyotype and FLT3-ITD status), FLT3-ITD (intermediate risk), bZIP in-frame mutated CEBPA (favorable risk), and RUNX1, ASXL1, BCOR, EZH2, RUNX1, SF3B1, SRSF2, STAG2, U2AF1, ZRSR2 and TP53 mutations (all belonging to the adverse risk group). In the context of allogeneic hematopoietic stem cell transplantation (allo-HSCT), the frequency and prognostic value of different gene-gene interactions has not been studied and may differ from that of patients treated with chemotherapy alone. We aimed at evaluating, through the European Society for Blood and Marrow Transplantation (EBMT) database, the frequency and impact of different recurrent somatic mutations, either alone or in association, on prediction of relapse and survival in patients receiving allo-HSCT. Methods: This is a retrospective, registry-based, multicenter analysis from the EBMT with the approval of the EBMT Acute Leukemia Working Party. Adult patients aged more than 18 years with a diagnosis ofAML who received an allo-HSCT between 2013-2022, with an available genetic profile determined at diagnosis by next generation sequencing (NGS) were included. Results: We identified 836 allografted AML patients who had NGS performed at diagnosis. Most of these patients had de novo AML (88%), with a median age of 53 years (range: 18-78 years). Karyotype was favorable in 7%, intermediate in 69% and adverse in 24% of patients. At transplant, 74% of patients were in first remission (CR1) and 13% in CR2. The most frequent detectable mutations by frequency were DNMT3A (33%), FLT3 (29%), NPM1 (29%), TET2 (28%), NRAS (23%), RUNX1 (22%), WT1 (22%), BCOR (19%), ASXL1 (17%), IDH2 (17%), IDH1 (15%), SRSF2 (13%), STAG2 (12%), CEBPA (11%), TP53 (10%), KRAS (10%), and PTPN11 (10%) . By multiple correspondence analysis, two independent groups of co-occurring mutations were identified, the first group included DNMT3A, NPM1 and FLT3, the second group included ASXL1, SRSF2 and RUNX1. Outcome analysis was performed on the subset of 298 patients allografted in CR1 with available data for the aforementioned six genes ( DNMT3A, NPM1, FLT3, ASXL1, SRSF2 and RUNX1). Most of these patients had de novo AML (90%), with a median age of 53 years (range: 19-75 years). Patients received primarily reduced intensity conditioning (58%) and peripheral blood stem cells (93%) from matched sibling donors (35%), matched unrelated (28%), and haploidentical donors (21%). Seventy percent of these patients had intermediate-risk cytogenetics, while 27% were classified as adverse-risk. Median follow up calculated by the reverse Kaplan-Meier method was 2.5 years. Overall, the 2-year relapse incidence (RI), leukemia-free survival (LFS) and overall survival (OS) were 24%, 62% and 69%, respectively. When outcome analysis was performed according to the presence or absence of single mutations, none of the six mutations significantly affected RI or LFS. The 2-year OS was positively affected by the presence of NPM1 mutation (78% vs 66%; p=0.02) and FLT3 (79% vs 65%, p=0.01) but not significantly affected by the other 4 mutations. When mutations were investigated in groups, the 2-year RI, LFS and OS were 24%, 70% and 78%, respectively, for patients with NPM1 mutation regardless of other co-mutations, 35%, 56% and 69% for patients with FLT3-ITDand/or DNMT3A mutation, wild type NPM1, regardless of other co-mutations, 17%, 70% and 74% for patients with RUNX1 and/or ASXL1 and/or SRSF2 mutation without FLT3-ITD and with wild type NPM1 and wild type DNMT3A and 20%, 56% and 61% for patients with all six genes unmutated. Conclusion: NGS at diagnosis can be extremely useful in risk stratification of AML patients undergoing allo-HSCT, potentially allowing adequate post-transplant interventions. Notably, the 2-year LFS of 70% for patients harboring RUNX1 and/or ASXL1 and/or SRSF2 mutation indicates that allo-HSCT can overcome the adverse risk associated with these somatic mutations at diagnosis.

NGS Profile and the Mathematical Prediction Model for Venetoclax Combination Therapy in HM-Screen-Japan 02 Study

[Introduction] Azacitidine and venetoclax combination therapy (Aza/Ven) is a novel strategy for acute myeloid leukemia (AML). Although this regimen is widely used as a first line treatment not only for unfit/elderly patients but also for fit/young patients in the real-world situation, appropriate patient selection is an important issue. HM-SCREEN-Japan 02 (UMIN-CTR UMIN000046371) is a Japanese multicenter prospective observational study to evaluate the clinical utility of targeted sequencing. In this study, we performed the sub-analysis of newly diagnosed AML patients who received Aza/Ven as a 1 st line treatment to elucidate the genetic background of AML. Furthermore, we proposed a novel mathematical model to predict the response of Aza/Ven. [Methods] AmoyDx® Myeloid Blood Cancer Panel for acute myeloid leukemia was used for the targeted sequencing. We performed linear discriminant analysis to predict complete response patients by Aza/Ven based on clinical information before treatment. We utilized three clinical quantities for the analysis: Wilms Tumor-1 (WT1) mRNA expression level, the number of “favorable mutations”, and that of “unfavorable mutations”. Favorable and unfavorable mutations were defined as IDH1, IDH2, NPM1, and CEBPA mutations, and ASXL1, BCOR, EZH2, RUNX1, SF3B1, SRSF2, STAG2, U2AF1, ZRSR2 and TP53 mutations, respectively, based on the previous reports (NEJM 2019, Blood 2022). The data were standardized and utilized for the linear discriminant analysis. Statistical analyses were performed using R version 4.2.3 software (R Foundation for Statistical Computation, Vienna, Austria). [Results] Total 158 patients were enrolled in our study. Among 48 patients who received Aza/Ven as a 1 st line therapy, NGS analyses were performed prior to treatment in 38 patients. Their median age was 70.5 (39-92) years old. AML with myelodysplasia-related changes was the major subtype (71%) and 37 percent of the cases had high risk cytogenetic abnormalities at diagnosis. After 1 st line Aza/Ven treatment, complete remission (CR)/ CR with incomplete blood count recovery (CRi) was achieved in 63% of the cases while the remaining 37% were non-CR. There was a trend that patients with NPM1 and IDH1/2 mutations achieved CR/CRi, while patients with RUNX1 mutation were not tended to achieve CR (Figure 1). Next, we performed linear discriminant analysis of treatment response using three pretreatment clinical factors. Linear discriminant analysis found a linear combination of prognostic factors that best separates two classes in the group of patients. Thirty-seven patients were employed to determine the discriminant function D, given by D = 0.638 × x − 0.76 × y + 0.68 × z + 0.145. Here x, y, and z represented the WT1 quantity in peripheral blood, the number of “favorable mutations”, and that of “unfavorable mutations” after standardization, respectively. Using this model, 81.1% of cases were correctly classified, and so were 75.7% of cases with leave-one-out cross validation method (Table 1). [Discussions] As previously reported (NEJM 2019, Blood adv 2020), IDH1/2 and NPM1 mutations tended to be sensitive to Aza/Ven in our cohort. However, it would be hard to predict the response of Aza/Ven by a single gene mutation because multiple gene mutations were co-existed in most of the cases (Figure 1) and clinical factors including tumor markers might also affect the outcome. Our mathematical model, involving gene mutations and WT1, could efficiently predict the response of Aza/Ven, which may support the selection of 1 st line treatment. In conclusion, our study revealed the genetic landscape of real-world Aza/Ven therapy and provided a potential prognostic model.

Mutations in the RNA Splicing Factors U2AF1 and SRSF2 are Context-Dependent in Myeloproliferative Neoplasms

RNA splicing factor gene mutations are recurrently found in BCR::ABL1 negative myeloproliferative neoplasms (MPN). To understand the interactions between spliceosome gene mutations and MPN phenotypic driver mutations ( JAK2, CALR and MPL), we investigated their patterns of co-occurrence or mutual exclusivity in a cohort of 990 MPN patients with comprehensive molecular profiling and clinical information from the Hematologic Malignancies Data Repository (HMDR). As expected, MPN driver mutations ( JAK2, CALR and MPL) were mutually exclusive (N=658, N=168, N=53 respectively, Log2 OR≤-3.5 and Padj. ≤0.005 using pairwise Fisher's exact tests with Benjamin Hochberg multiple testing correction). Additionally, cases with co-occurring mutations in two RNA splicing factors, SF3B1, U2AF1 and SRSF2 (N=44, N=49, N=44) respectively were uncommon (2/135 splicing factor mutated cases) . We further found that U2AF1 and SRSF2 mutations co-occurred with JAK2 (log2 OR=1.7, Padj.=0.009) and MPL (log2 OR=2.1, Padj.=0.006) respectively, but rarely with CALR mutations (N=2 CALR-U2AF1 log2 OR=-2.3 Padj.=0.025, N=2 CALR-SRSF2 log2 OR=-2.2 Padj.=0.048). In contrast, CALR-SF3B1 mutations occurred at the expected frequency (Padj.=0.11). To explore the molecular settings where these mutations co-occur, we investigated the variant allele frequencies (VAFs) of CALR, U2AF1, SRSF2 and concomitant mutations in the CALR-U2AF1 (N=2) and CALR-SRSF2 (N=2) patients. The VAFs for the mutations detected in the first patient with CALR-U2AF1 co-mutation were: CALR 0.26, U2AF1 0.45, and TET2 0.41. Since CALR and splicing factor mutations are typically heterozygous, this suggests the CALR mutation was sub-clonal to the U2AF1 mutation and that U2AF1 and TET2 mutations were likely present in the same cell. In the second CALR-U2AF1 co-mutant case, VAFs were: CALR 0.31, U2AF1 0.27, and TP53 0.16. It is possible that in this case, the CALR and U2AF1 mutations may have occurred in independent clones or may have occurred in the same cell in the absence of other pathogenic mutations. For the two CALR-SRSF2 patients, data from three samples revealed VAFs of 0.23-0.46 for CALR and 0.21-0.58 for SRSF2 mutations. Considering their typical heterozygous occurrence, we inferred those individual cells harbored both CALR and SRSF2 mutations. Notably, in samples with high VAFs (>0.37) for both CALR and SRSF2 in two separate patients, additional high VAF pathogenic mutations were observed: 0.35 for ASXL1 and 0.46 for RUNX1 respectively. As ASXL1 and RUNX1 mutations also typically occur in a heterozygous manner, we hypothesized that when CALR and SRSF2 mutations are present in the same cell, another pathogenic co-mutation may be required for survival of the clone. To test our hypothesis, we FACS-sorted single lineage negative CD34 positive bone marrow cells from the first CALR- SRSF2 co-mutant case into 96 wells plates containing methylcellulose and hematopoietic growth factors (CFU-GEMM). DNA was harvested from single-cell colonies and genotyped for the following mutations using polymerase chain reaction (PCR) followed by gel electrophoresis and Sanger sequencing: CALR c.1154_1155insTTGTC p.K385fs*, SRSF2 c.284G>T p.P95H, ASXL1 c.1926_1927insG p.G642fs*, EZH2 c.2188_2212delAAAAAACAGCTCTTCGCCAGTCTGG p.F729fs*. Bulk NGS VAFs were 0.46, 0.38, 0.35, and 0.17, respectively. Out of 73 colonies analyzed, 71 colonies had the CALR insertion 5 mutation detected (see figure). Among these 71 CALR-mutated colonies, SRSF2 was found to co-occur in 35 colonies. Interestingly, all 35 colonies were accompanied by an ASXL1 mutation, and 29 of them had an additional EZH2 mutation. These findings support our hypothesis that CALR and SRSF2 mutations may co-occur in the same cell in the presence of another pathogenic mutation. Our findings offer molecular insights into the context-dependent behavior of splicing factor mutations in MPN. While they can co-occur with JAK2 and MPL mutations, U2AF1 and SRSF2 mutations are largely mutually exclusive with CALR mutations. In addition, our findings generate two main biological hypotheses: (i) a synthetic lethal relationship may exist between CALR mutations and SRSF2 or U2AF1 mutations, and (ii) this synthetic lethality may be overcome by the presence of additional pathogenic mutation(s) in the cell. Validation studies are ongoing to address these hypotheses. AM and AEM contributed equally.

Qpctl Inhibition, By Targeting the Inflammatory Tumor Microenvironment, Constitutes a Novel Therapeutic Approach for Diffuse Large B-Cell Lymphoma

We have previously described that diffuse large B-cell lymphomas (DLBCL) harboring an inflammatory and immunosuppressive microenvironment (i.e., IN-LME) carry independent poor prognosis while proof-of-principle experiments modifying the composition of the LME were sufficient to induce lymphoma regression in mice models ( Kotlov, Cancer Discovery 2021). However, identification of pharmaceutical approaches that by modifying the LME will induce an anti-lymphoma effect while being suitable for short-term human translation remains challenging. The IN-LME is characterized by the presence of pro-inflammatory and immunosuppressive chemokines and cytokines that frequently undergo post-translational modifications. QPCTL (glutaminyl-peptide cyclotransferase-like) is an intracellular enzyme that mediates a N-terminal pyroglutamylation of CD47 and several chemokines, including CCL2 and CCL7, ultimately resulting in their sustained expression and/or secretion. SC-2882 is a first-in-class specific QPCTL inhibitor that induces secondary proteolytic degradation of the monocyte chemoattractants CCL2 and CCL7 ( da Silva, Nature Immunology 2022) and inactivation of the “do-not-eat-me” signal CD47 ( LogtenbergNature Medicine 2019). In a dataset of 470 DLBCL patients we found that the expression of QPCTL correlates negatively with overall survival and progression free survival (0.019 and <0.001, respectively). To determine whether QPCTL could be a potential target in DLBCL, we investigated its expression along with its targets CCL2, CCL7 and CD47 in additional 216 DLBCL cases categorized by LME. We found that while QPCTL and CD47 are expressed at similar levels in all DLBCL cases regardless their COO class and LME category, CCL2 was highly expressed in DLBCL harboring a IN-LME (p <0.05 vs. other LME categories), that also correlate with higher presence of tumor-associated macrophages (TAMs) and exhausted CD8+PD1 HIGH T cells (p <0.01 and p<0.001, vs. other LME categories, respectively). CCL7 was not expressed at detectable levels in majority of LMEs in DLBCL. In preclinical models, murine and human DLBCL cell lines expressed baseline QPCTL and CD47 while CCL2 and CCL7 expression (qPCR) and secretion (ELISA) increased at higher levels upon culturing these cells for 24 h embedded in splenic extracellular matrix 3D cultures. Exposure of a panel of 3 murine and 5 human DLBCL cells to increasing concentrations of SC-2882 (vs. vehicle) for up to 72 h and up to a 10 micromolar dose had no noticeable decrease in cell viability or proliferation. However, SC-2882 (vs. vehicle) at nanomolar concentrations increased anti-Cd20-dependent lymphoma cell phagocytosis by in vitro differentiated macrophages (from splenic monocytes in mice and THP1 cells in humans) in 3D co-cultures (p < 0.05, for all conditions). To further test the anti-lymphoma effect of SC-2882 we used a murine GCB-DLBCL model by implanting GEMM-derived aggressive Ezh2 mutant (EZH2 Y646equivalent) + BCL2 amplified lymphoma cells in the spleen of immunocompetent C57BL/mice (n=14). After implantation, mice were randomized to receive SC-2882 by oral gavage (n=7) or vehicle (n=14) for 14 days. Tumor burden was followed by luciferase imaging (Caliper), and spleens were analyzed at sacrifice by multiparametric imaging, flow-cytometry, and spatial transcriptomics. Oral SC-2882 (vs. vehicle) induced a significant decrease in tumor growth (p=0.0079, Figure 1) without evidence of systemic toxicity by body weight, blood cell count and chemistry panel. Analysis of the LME in remnant splenic tumors showed in SC-2882 (vs. vehicle) treated mice a significant decrease in lymphoma cells and Ki67+ cells (p<0.001) as well as F480+ TAMs (p<0.01) while there was an increase of CD3+ T cell infiltration (p<0.001). We also found a decrease in Cd4+Foxp3+ Tregs and increase in Cd8+Gzb+ cells in SC-2882 treated mice by flow-cytometry. These changes mirrored the findings in the spatial transcriptomics. Additional analysis of LME cell subpopulations by SC-RNA-seq is ongoing. Overall, these data indicate that QPCTL is a potential target in DLBCL, and that QPCTL inhibition exhibits potent anti-lymphoma effects primarily by targeting the IN-LME.