SLC12A3 Mutations Research Articles

SUN-LB133 Analysis of Clinical Characteristics and Gene Mutation in Four Cases of Gitelman Syndrome

Gitelman syndrome is an autosomal recessive renal tubular disorder characterized by renal salt wasting with secondary hyperreninemia and hyperaldosteronism, chronic hypokalemia with renal K wasting and metabolic alkalosis, and hypomagnesemia, and hypocalciuria. GS was found to be caused by mutations in SLC12A3 encoding the thiazide-sensitive sodium chloride cotransporter (NCCT) on the apical membrane of distal convoluted tubule. The prevalence worldwide is estimated at approximately 1:40,000, making it one of the most frequent inherited renal tubular disorders. To date, over 400 mutations scattered throughout SLC12A3 have been identified in GS patients. The majority of patients are compound heterozygous for SLC12A3 mutations, but a significant number of GS patients are found to carry only a single SLC12A3 mutation. The type of the SLC12A3 mutation may be a determinant factor in the severity of GS. The purpose of this study is to analyze clinical characteristics and gene mutation in four cases of GS. Methods: Four patients with closely resembling Gitelman syndrome was selected. Results: Six SLCl2A3 gene mutations were found in these four patients. There were one SLCl2A3 homozygous mutation in case 1 and case 3, and two SLCl2A3 heterozygous mutations in case 2 and case 4, respectively. This six gene mutations include missense mutations, frameshift mutations, and nonsense mutations. Four patients were diagnosed with Gitelman syndrome. Case 4 is the most severe with severe hypokalemia, accompanied by ventricular arrhythmias, which may be related to the presence of two SLC12A3 gene mutations in the patient. Conclusions: Four patients in this study were diagnosed with Gitelman syndrome based on their clinical characteristics and genetic testing results. For patients with hyperreninemia and hyperaldosteronism, chronic hypokalemia with renal K wasting and metabolic alkalosis, and hypomagnesemia, and hypocalciuria need to exclude Gitelman syndrome.Key words: Gitelmen Syndrome, Mutations, SlC12A3 gene

Hypophosphatemic Rickets with Hypercalciuria: A Novel Homozygous Mutation in SLC34A3 and Literature Review

Hypophosphatemic rickets with hypercalciuria (HHRH) is a rare, recessively-inherited form of rickets caused by homozygous or compound heterozygous mutations in the SLC34A3 gene that encodes the renal tubular phosphate transporter protein NaPi2c. The bone phenotype varies from severe rickets to no disease. Accurate diagnosis is important as the treatment differs from other forms of rickets. The patient was a 12-year-old boy from the Indian subcontinent with florid hypophosphatemic rickets. A targeted gene panel to search for mutations in genes associated with inherited forms of rickets was performed. We also completed a literature search of published cases of HHRH. The targeted gene panel demonstrated a novel homozygous SLC34A3 mutation: c.1339 G>A (p.Ala447Thr). His parents were heterozygous for the mutation. In our literature review we found that people with homozygous SLC34A3 mutations were more likely to have rickets than those with compound heterozygous mutations (85% versus 45%, p<0.002) and that serum phosphate z scores were lower in those with rickets than those without (-3.3 with a standard deviation of 1.5 versus -2.1 with a standard deviation of 1.5, p<0.005). The bone phenotype of HHRH is related to the nature of the mutation and serum phosphate levels. Targeted gene panels can aid in the accurate diagnosis of inherited forms of rickets, and facilitate correct treatment.

Digenic Heterozygous Mutations in SLC34A3 and SLC34A1 Cause Dominant Hypophosphatemic Rickets with Hypercalciuria.

Hypophosphatemia and metabolic bone disease are associated with hereditary hypophosphatemic rickets with hypercalciuria (HHRH) due to biallelic mutations of SLC34A3 encoding the NPT2C sodium-phosphate cotransporter and nephrolithiasis/osteoporosis, hypophosphatemic 1 (NPHLOP1) due to monoallelic mutations in SLC34A1 encoding the NPT2A sodium-phosphate cotransporter. To identify a genetic cause of apparent dominant transmission of HHRH. Retrospective and prospective analysis of clinical and molecular characteristics of patients studied in 2 academic medical centers. We recruited 4 affected and 3 unaffected members of a 4-generation family in which the proband presented with apparent HHRH. We performed clinical examinations, biochemical and radiological analyses, and molecular studies of genomic DNA. The proband and her affected sister and mother carried pathogenic heterozygous mutations in 2 related genes, SLC34A1 (exon 13, c.1535G>A; p.R512H) and SLC34A3 (exon 13, c.1561dupC; L521Pfs*72). The proband and her affected sister inherited both gene mutations from their mother, while their clinically less affected brother, father, and paternal grandmother carried only the SLC34A3 mutation. Renal phosphate-wasting exhibited both a gene dosage-effect and an age-dependent attenuation of severity. We describe a kindred with autosomal dominant hypophosphatemic rickets in which whole exome analysis identified digenic heterozygous mutations in SLC34A1 and SLC34A3. Subjects with both mutations were more severely affected than subjects carrying only one mutation. These findings highlight the challenges of assigning causality to plausible genetic variants in the next generation sequencing era.

MP03-15 THE CHALLENGES AND ANXIETIES OF PREGNANCY IN CYSTINURIA

You have accessJournal of UrologyStone Disease: Epidemiology & Evaluation I (MP03)1 Apr 2020MP03-15 THE CHALLENGES AND ANXIETIES OF PREGNANCY IN CYSTINURIA Robert Ashe, David Game, Giles Rottenberg, Kay Thomas, and Matthew Bultitude* Robert AsheRobert Ashe More articles by this author , David GameDavid Game More articles by this author , Giles RottenbergGiles Rottenberg More articles by this author , Kay ThomasKay Thomas More articles by this author , and Matthew Bultitude*Matthew Bultitude* More articles by this author View All Author Informationhttps://doi.org/10.1097/JU.0000000000000817.015AboutPDF ToolsAdd to favoritesDownload CitationsTrack CitationsPermissionsReprints ShareFacebookLinked InTwitterEmail Abstract INTRODUCTION AND OBJECTIVE: Cystinuria is recognised to cause concern about children inheriting the disease, however the impact of pregnancy in cystinuria has not been well studied. Management in pregnant women is challenging due to regular stone formation, difficulty in imaging as well as contraindication of thiol binding medication. METHODS: From a prospective database in a single center, we identified female patients known to have children. With the help of our patients we constructed a questionnaire to evaluate the experiences and challenges of pregnancy in cystinurics. RESULTS: Questionnaire sent to 37 patients; 23 responses received. Mean age 39; Median age of diagnosis 22. Median no.of children was 2 (range 1-4); age range of children was 4 months to 22 yrs. 74% and 50% were taking/ had taken alkalinisation or thiol binding medication respectively. We identified 3 major issues. Firstly, patients were under supported: 37% were anxious about getting pregnant because of cystinuria; only 23% were given specific advice about getting pregnant; 36% had to cease cystinuria medication. Only 27% were offered increased checks during pregnancy. Most reported increasing fluids during pregnancy. 68% found the OBGYN team did not know about cystinuria. Secondly symptoms and new stone formation was a problem. 32% passed stones and 23% reported needing surgery during pregnancy. 54% felt they formed stones during pregnancy that subsequently needed treating. Lastly, the ability to breastfeed was negatively impacted. 59% reported having to stop breastfeeding or discontinued medications to be able to breastfeed. Overall, whilst 64% do not think cystinuria is a barrier to pregnancy, 23% do still think it is. 91% report being concerned their children could have cystinuria; 77% have actually sought advice for them and 50% have actually been tested. Of those with genetic testing, 11 had SLC3A1 mutation; 8 SLC 7A9 and 3 had both. There was no clinical differences experienced in pregnancy between the groups. CONCLUSIONS: Cystinuria causes significant anxiety to female patients considering pregnancy as well as challenges during and afterwards due to cessation of medication, frequent stone episodes and extra surgery. Female patients should be counselled by urologists to ease the anxiety and offered extra ultrasound screening and easy access back to urological services if stone episodes occur. Liaising directly with the OBGYN will help to improve their knowledge as well as patient experience. With appropriate support women should not see cystinuria as a barrier to childbirth. In future work, it would be interesting to explore the concerns for nulliparous women. Source of Funding: None © 2020 by American Urological Association Education and Research, Inc.FiguresReferencesRelatedDetails Volume 203Issue Supplement 4April 2020Page: e27-e28 Advertisement Copyright & Permissions© 2020 by American Urological Association Education and Research, Inc.MetricsAuthor Information Robert Ashe More articles by this author David Game More articles by this author Giles Rottenberg More articles by this author Kay Thomas More articles by this author Matthew Bultitude* More articles by this author Expand All Advertisement PDF downloadLoading ...

SLC5A2 mutations, including two novel mutations, responsible for renal glucosuria in Chinese families

BackgroundFamilial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified.MethodsTen patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information.ResultsA total of nine different mutations were identified: IVS1-16C > A, c.305C > T/p.(A102V), c.395G > A/p.(R132H), c.736C > T/p.(P246S), c.886(−10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_Ala388del), c.1222G > T/p.(D408Y), c.1496G > A/p.(R499H) and c.1540C > T/p.(P514S); two novel mutations in SLC5A2, c.1222G > T/p.(D408Y) and c.1496G > A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6 g/d.ConclusionWe screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C > A and c.886(−10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.

Advance in genetic research on Gitelman syndrome

With an estimated incidence of 1/40 000 to 1/4000, Gitelman syndrome is the most common type of inherited renal tubular disease during adolescence or adulthood. Characteristic features of Gitelman syndrome include transient episodes of muscle cramps and fatigue, hypokalemia, hypomagnesemia, hypocalciuria, and metabolic alkalosis. Detection of SLC12A3 mutations, in conjunct with clinical manifestations, may confirm the diagnosis. Recent research suggested that CLCNKB may also be a candidate gene for Gitelman syndrome. Research on genotype-phenotype correlation has provided more information on the genetic etiology of Gitelman syndrome, which may facilitate the diagnosis and treatment for this syndrome and improve their prognosis.

Description of a novel SLC34A3.c.671delT mutation causing hereditary hypophosphatemic rickets with hypercalciuria in two adolescent boys and response to recombinant human growth hormone

Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is an autosomal recessive disorder characterized by hypophosphatemia, rickets, hyperphosphaturia, elevated 1,25(OH)2D, and hypercalciuria. Mutations in SLC34A3, the gene encoding the sodium-dependent cotransporter NPT2c, have previously been described as a cause of HHRH. Here, we describe two male siblings with rickets and hypercalciuric nephrolithiasis born to unrelated parents, and their response to oral phosphate supplementation and growth hormone therapy. Whole exome sequencing of the oldest brother, and polymerase chain reaction and Sanger sequence analysis of the identified SLC34A3 mutations, was performed for confirmation and to evaluate his siblings and parents. Serum and urine biochemical parameters of mineral homeostasis before and after therapy were evaluated. Whole exome sequencing analysis identified a previously reported heterozygous deletion SLC34A3.g.2259-2359del101bp on the maternal allele, and a novel heterozygous single nucleotide deletion SLC34A3.c.671delT on the paternal allele of the two affected brothers. The parents and the unaffected brother are heterozygous carriers. Recombinant human growth hormone (rHGH) plus oral phosphate in one affected brother improved the renal phosphate leak and resulted in accelerated linear growth superior to that seen with oral phosphate supplementation alone in the other affected brother. Our case study is the first to demonstrate that rHGH can be considered in addition to oral supplementation with phosphorus to improve linear growth in patients with this disorder, and suggests that renal phosphate reabsorption in response to rHGH is NPT2c-independent.

Foamy Urine: Is This a Sign of Kidney Disease?

Historically, persistent foamy urine noticed upon voiding is considered a warning sign of kidney disease. Foamy urine is characterized by the appearance and persistence of multiple layers of small to medium bubbles in urine voided into a container, such as a toilet bowl (see [Figure 1][1]). The

Phosphate matters when investigating hypercalcemia: a mutation in SLC34A3 causing HHRH

SummaryHereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare, autosomal recessive disorder caused by mutations in the SLC34A3 gene that encodes the renal sodium-dependent phosphate cotransporter 2c (NaPi-IIc). It may present as intermittent mild hypercalcemia which may attract initial diagnostic attention but appreciation of concomitant hypophosphatemia is critical for consideration of the necessary diagnostic approach. A 21-year-old woman was assessed by adult endocrinology for low bone mass. She initially presented age two with short stature, nephrocalcinosis and mild intermittent hypercalcemia with hypercalciuria. She had no evidence of medullary sponge kidney or Fanconi syndrome and no bone deformities, pain or fractures. She had recurrent episodes of nephrolithiasis. In childhood, she was treated with hydrochlorothiazide to reduce urinary calcium. Upon review of prior investigations, she had persistent hypophosphatemia with phosphaturia, low PTH and a high-normal calcitriol. A diagnosis of HHRH was suspected and genetic testing confirmed a homozygous c.1483G>A (p.G495R) missense mutation of the SLC34A3 gene. She was started on oral phosphate replacement which normalized her serum phosphate, serum calcium and urine calcium levels over the subsequent 5 years. HHRH is an autosomal recessive condition that causes decreased renal reabsorption of phosphate, leading to hyperphosphaturia, hypophosphatemia and PTH-independent hypercalcemia due to the physiologic increase in calcitriol which also promotes hypercalciuria. Classically, patients present in childhood with bone pain, vitamin D-independent rickets and growth delay. This case of a SLC34A3 mutation illustrates the importance of investigating chronic hypophosphatemia even in the presence of other more common electrolyte abnormalities.Learning points:Hypophosphatemia is an important diagnostic clue that should not be ignored, even in the face of more common electrolyte disorders.HHRH is a cause of PTH-independent hypophosphatemia that may also show hypercalcemia.HHRH is a cause of hypophosphatemic nephrocalcinosis that should not be treated with calcitriol, unlike other congenital phosphate wasting syndromes.Some congenital phosphate wasting disorders may not present until adolescence or early adulthood.

Resistance to Insulin in Patients with Gitelman Syndrome and a Subtle Intermediate Phenotype in Heterozygous Carriers: A Cross-Sectional Study.

Gitelman syndrome is a salt-losing tubulopathy caused by mutations in the SLC12A3 gene, which encodes the thiazide-sensitive sodium-chloride cotransporter. Previous studies suggested an intermediate phenotype for heterozygous carriers. To evaluate the phenotype of heterozygous carriers of pathogenic SLC12A3 mutations, we performed a cross-sectional study of patients with Gitelman syndrome, heterozygous carriers, and healthy noncarriers. Participants measured their BP at home for three consecutive days before hospital admission for blood and urine sampling and an oral glucose tolerance test. We enrolled 242 participants, aged 18-75 years, including 81 heterozygous carriers, 82 healthy noncarriers, and 79 patients with Gitelman syndrome. The three groups had similar age, sex ratio, and body mass index. Compared with healthy noncarriers, heterozygous carriers showed significantly higher serum calcium concentration (P=0.01) and a trend for higher plasma aldosterone (P=0.06), but measures of home BP, plasma and urine electrolytes, renin, parathyroid hormone, vitamin D, and response to oral glucose tolerance testing were similar. Patients with Gitelman syndrome had lower systolic BP and higher heart rate than noncarriers and heterozygote carriers; they also had significantly higher fasting serum glucose concentration, higher levels of markers of insulin resistance, and a three-fold higher sensitivity to overweight. According to oral glucose tolerance testing, approximately 14% of patients with Gitelman syndrome were prediabetic, compared with 5% of heterozygous carriers and 4% of healthy noncarriers. Heterozygous carriers had a weak intermediate phenotype, between that of healthy noncarriers and patients with Gitelman syndrome. Moreover, the latter are at risk for development of type 2 diabetes, indicating the heightened importance of body weight control in these patients.

Digenetic inheritance of SLC12A3 and CLCNKB genes in a Chinese girl with Gitelman syndrome

BackgroundGitelman syndrome (GS) is an autosomal recessive disorder and mild variant of classic Bartter syndrome. The latter is caused by defects in the genes CLCNKB and/or CLCNKA (chloride voltage-gated channel Ka and Kb). Patients with GS usually have loss-of-function mutations in SLC12A3. No patient has been reported with compound heterozygous mutations in these genes. We report a girl with GS with a paternally inherited heterozygous mutation in SLC12A3, and maternally inherited heterozygous variants in both CLCNKB and CLCNKA.Case presentationIn this report, we reported a female patient (8 y and 10 mo) who had growth retardation (111.8 cm, − 1.62 standard deviation height for age) and normal blood pressure, with persistent hypokalemia, hypomagnesemia, hypocalciuria, hypochloremic alkalosis, and elevated levels of plasma renin and aldosterone. Her younger brother, father, and paternal grandmother all had histories of mild low levels of plasma potassium (3.0–3.5 mmol/L), which were rectified by potassium-rich foods. The genomic DNA of the patient, younger brother, parents, and grandparents were screened for gene variations and pedigree analysis using trio whole exome sequencing (WES). The candidate variants were validated by Sanger sequencing. Protein-protein interaction analysis utilized the following databases: Biogrid, MINT, HPRD, STRING, IntAct, iRefIndex, and ppiTrim. The trio WES screening showed that the patient has paternally inherited SLC12A3 p.N359K, and maternally inherited CLCNKB p.L94I. The paternal grandmother and younger brother are both carriers of SLC12A3 p.N359K. According to the STRING database, SLC12A3 and CLCNKB proteins may interact or coexpress with proteins associated with GS.ConclusionsBased on clinical phenotypes, genetic evidence of the pedigree, and previous reported studies, this case of GS indicates a digenetic inheritance of SLC12A3 and CLCNKB that resulted in renal tubular dysfunction perhaps, due to a genetic double-hit mechanism. The putative pathogenicity of the CLCNKB p.L94I variant requires confirmation.

A homozygous SLC5A2 mutation: A natural protection against diabetes?

Introduction: Familial renal glucosuria (FRG) is the result of a mutation in the SLC5A2 gene, which codes for the sodium/glucose cotransporter 2 (SGLT2). The main task of this transporter lies in the proximal tubular reabsorption of filtered glucose. Case Report: In this case report, a healthy 35-year-old male of Moroccan descent was diagnosed with a homozygous SLC5A2 mutation after presentation with glucosuria without showing any other symptoms. The patient showed renal glucosuria while having normal serum glucose levels. Conclusion: The present case highlights the possible importance in performing additional DNA analysis in patients with renal glucosuria without any other symptoms. This in turn will aid in deciding what intervention to apply for patient and possibly their relatives.

Identification of ten novel SLC5A2 mutations and determination of the renal threshold for glucose excretion in Chinese patients with familial renal glucosuria

BackgroundFamilial renal glucosuria (FRG) is a rare renal tubular disorder characterized by isolated persistent glucosuria without both abnormal glucose metabolism and any signs of proximal tubular dysfunction. SLC5A2 gene mutations are responsible for most FRG cases. MethodsQuantitative test for 24-hour urine glucose and RTG were determined in 9 families (totaling 25 subjects). All coding regions, including intron-exon boundaries, were analyzed with PCR followed by direct sequence analysis. ResultsTen novel mutations were identified (c.331 T > C, p.W111R; c.374T>C, p.M125T; c.394C>T, p.R132C; c.612G>C, p.Q204H; c.829C>T, p.P277S; c.880G>A, p.D294N; c.1129G>A, p.G377S; c.1194C>A, p.F398L; c.1540C > T, p.P514S and c.1573C>T, p.H525Y). c.886(-10_-31)del that is specific to Chinese population was found in 5 out of 9 families, with a mutation rate of 28% (5/18). The compound heterozygotes presented with much lower RTG values (1.28 ± 0.10 mmol/L), compared with the carriers of heterozygous variants (5.14 ± 0.77 mmol/L) (p<0.01); c.886(-10_-31)del heterozygotes had significant lower RTG values than others (4.43 ± 0.37 vs 5.7 ± 0.51 mmol/L; p<0.01). ConclusionsTen novel SLC5A2 mutations are found and c.886(-10-31)del may be a hot spot mutation in Chinese population. Compound heterozygotes had much lower RTG values than simple heterozygotes. Mixed-meal tolerance test is a simple method for determining RTG in FRG patients.

Novel SLC5A2 Mutations and Genetic Characterization in Korean Patients with Familial Renal Glucosuria

Purpose Familial renal glucosuria (FRG, OMIM #233100) is a rare but relatively benign genetic condition characterized by persistent isolated glucosuria with a normal blood glucose level. We report three additional SLC5A2 mutations and examine their phenotypic and genetic characteristics in a Korean FRG cohort. We also reviewed the literature and summarized the genotypes of all Korean patients with FRG. Methods A genetic analysis was conducted by directly sequencing all 14 exons of the SLC5A2 gene and their flanking regions in six unrelated Korean children with FRG and their family members. Novel non-synonymous single-nucleotide polymorphisms were identified and compared with known mutations that are repeatedly detected in the Korean population. Results We found two novel mutations [c.274G>A (G92S) and c.1168C>T (L390F)] and one known [c.1382G>A (S461N)] mutation in each family and one recurrent mutation [c.1346G>A (G449D) (rs768392222)] in two pedigrees. The recurrent G449D was predicted to be “possibly damaging,” with a score of 0.883 in Polyphen-2, while G92S, L390F, and S461N were predicted to be “probably damaging,” with scores of 1.000, 0.999, and 0.996, respectively. Conclusions Two novel, one previously reported, and one recurrent mutation were identified in six Korean FRG pedigrees as causative mutations of renal glucosuria. Sequence variations in the SLC5A2 gene were frequently detected in children with persistent isolated glucosuria. A long-term follow-up of this FRG cohort is needed to understand how these specific SGLT2 mutations impair kidney function and energy homeostasis. Key words: SGLT2; Glucose; Glucosuria; Mutation

No evidence for point mutations in the novel renal cystine transporter AGT1/SLC7A13 contributing to the etiology of cystinuria

BackgroundCystinuria is caused by the defective renal reabsorption of cystine and dibasic amino acids, and results in cystine stone formation. So far, mutations in two genes have been identified as causative. The SLC3A1/rBAT gene encodes the heavy subunit of the heterodimeric rBAT-b0,+AT transporter, whereas the light chain is encoded by the SLC7A9/ b0,+AT gene. In nearly 85% of patients mutations in both genes are detectable, but a significant number of patients currently remains without a molecular diagnosis. Thus, the existence of a further cystinuria gene had been suggested, and the recently identified AGT1/SLC7A13 represents the long-postulated partner of rBAT and third cystinuria candidate gene.MethodsWe screened a cohort of 17 cystinuria patients for SLC7A13 variants which were negative for SLC3A1 and SLC7A9 mutations.ResultsDespite strong evidences for an involvement of SLC7A13 mutations in cystinuria, we could not confirm a relevant role of SLC7A13 for the disease.ConclusionWith the exclusion of SLC7A13/AGT1 as the third cystinuria gene accounting for the SLC3A1 and SLC7A9 mutation negative cases, it becomes obvious that other genetic factors should be responsible for the cystinuria phenotype in nearly 15% of patients.

Development of SGLT1 and SGLT2 inhibitors.

Sodium-glucose cotransporters SGLT1 (encoded by SGLT1, also known as SLC5A1) and SGLT2 (encoded by SGLT2, also known as SLC5A2) are important mediators of epithelial glucose transport. While SGLT1 accounts for most of the dietary glucose uptake in the intestine, SGLT2 is responsible for the majority of glucose reuptake in the tubular system of the kidney, with SGLT1 reabsorbing the remainder of the filtered glucose. As a consequence, mutations in the SLC5A1 gene cause glucose/galactose malabsorption, whereas mutations in SLC5A2 are associated with glucosuria. Since the cloning of SGLT1 more than 30years ago, big strides have been made in our understanding of these transporters and their suitability as drug targets. Phlorizin, a naturally occurring competitive inhibitor of SGLT1 and SGLT2, provided the first insights into potential efficacy, but its use was hampered by intestinal side effects and a short half-life. Nevertheless, it was a starting point for the development of specific inhibitors of SGLT1 and SGLT2, as well as dual SGLT1/2 inhibitors. Since the approval of the first SGLT2 inhibitor in 2013 by the US Food and Drug Administration, SGLT2 inhibitors have become a new mainstay in the treatment of type 2 diabetes mellitus. They also have beneficial effects on the cardiovascular system (including heart failure) and the kidney. This review focuses on the rationale for the development of individual SGLT2 and SGLT1 inhibitors, as well as dual SGLT1/2 inhibition, including, but not limited to, aspects of genetics, genetically modified mouse models, mathematical modelling and general considerations of drug discovery in the field of metabolism.

In silico analysis of SLC3A1 and SLC7A9 mutations in Iranian patients with Cystinuria.

Cystinuria is an autosomal recessive defect in reabsorptive transport of cystine and the dibasic amino acids ornithine, arginine, and lysine from renal tubule and small intestine. Mutations in two genes: SLC3A1, encoding the heavy chain rbAT of the renal cystine transport system and SLC7A9, the gene of its light chain b0, + AT have a crucial role in the diseases. In our previous studies from Iranian populations with Cystinuria totally six and eleven novel mutations respectively identified in SLC3A1 and SLC7A9 genes. In this study, we conducted an in silico functional analysis to explore the possible association between these genetic mutations and Cystinuria. MutationTaster, PolyPhen-2, PANTHER, FATHMM. PhDSNP and MutPred was applied to predict the degree of pathogenicity for the missense mutations. Furthermore, Residue Interaction Network (RIN) and Intron variant analyses was performed using Cytoscape and Human Slicing Finder softwares. These genetic variants can provide a better understanding of genotype-phenotype relationships in patients with Cystinuria. In the future, the findings may also facilitate the development of new molecular diagnostic markers for the diseases.

SLC34A3 Intronic Deletion in an Iranian Kindred with Hereditary Hypophosphatemic Rickets with Hypercalciuria

Objective:To describe clinical findings, biochemical profile and genetic analysis in an Iranian kindred with hereditary hypophosphatemic rickets with hypercalciuria (HHRH).Methods:Clinical examination and biochemical profile results and gene analysis of 12 members of a family of a patient previously diagnosed with HHRH due to SLC34A3 mutation. Ten healthy controls were also evaluated.Results:Of the twelve family members three were homozygote and seven heterozygote for the same SLC34A3 variant found in the proband while two others were unaffected. All patients had significantly increased risk of kidney stone formation, bone deformities and short stature compared with unrelated healthy controls. The heterozygous patients displayed milder clinical symptoms compared with homozygous patients. In particular they had mild or no hypophosphatemia and they did not develop skeletal deformities. Recurrent renal stones and hypercalciuria were the main presentations of the heterozygous patients which may be confused with familial hypercalciuria. In addition, biochemical analysis showed significantly low serum sodium and elevated alkaline phosphatase levels in these patients.Conclusion:Genetic counseling and screening for SLC34A3 mutations can be helpful in adult onset phenotype with unexplained osteoporosis, bone deformities and especial recurrent renal stones. In subjects with vitamin D deficiency the results should be interpreted cautiously.

Clinical and genetic characteristics of 15 families with hereditary hypophosphatemia: Novel Mutations in PHEX and SLC34A3

BackgroundHereditary hypophosphatemia is a group of rare renal phosphate wasting disorders. The diagnosis is based on clinical, radiological, and biochemical features, and may require genetic testing to be confirmed.MethodologyClinical features and mutation spectrum were investigated in patients with hereditary hypophosphatemia. Genomic DNA of 23 patients from 15 unrelated families were screened sequentially by PCR-sequencing analysis for mutations in the following genes: PHEX, FGF23, DMP1, ENPP1, CLCN5, SLC34A3 and SLC34A1. CytoScan HD Array was used to identify large deletions.ResultsGenetic evaluation resulted in the identification of an additional asymptomatic but intermittent hypophosphatemic subject. Mutations were detected in 21 patients and an asymptomatic sibling from 13 families (86.6%, 13/15). PHEX mutations were identified in 20 patients from 12 families. Six of them were novel mutations present in 9 patients: c.983_987dupCTACC, c.1586+2T>G, c.1206delA, c.436+1G>T, c.1217G>T, and g.22,215,887–22,395,767del (179880 bp deletion including exon 16–22 and ZNF645). Six previously reported mutations were found in 11 patients. Among 12 different PHEX mutations, 6 were de novo mutations. Patients with de novo PHEX mutations often had delayed diagnosis and significantly shorter in height than those who had inherited PHEX mutations. Novel compound heterozygous mutations in SLC34A3 were found in one patient and his asymptomatic sister: c.1335+2T>A and c.1639_1652del14. No mutation was detected in two families.ConclusionsThis is the largest familial study on Turkish patients with hereditary hypophosphatemia. PHEX mutations, including various novel and de novo variants, are the most common genetic defect. More attention should be paid to hypophosphatemia by clinicians since some cases remain undiagnosed both during childhood and adulthood.

A novel compound heterozygous variant of the SLC12A3 gene in Gitelman syndrome pedigree

BackgroundGitelman syndrome (GS) is an autosomal recessive disorder caused by genic mutations of SLC12A3 (Solute carrier family 12 member 3), which encodes the Na-Cl cotransporter (NCC), and presents with characteristic metabolic abnormalities, including hypokalemia, metabolic alkalosis, hypomagnesemia, and hypocalciuria. In this study, we report a case of a GS pedigree, including analysis of GS-associated gene mutations.MethodsWe performed next-generation sequencing analysis and Sanger sequencing to explore the SLC12A3 mutations in a GS pedigree that included a 35-year-old female patient with GS and five family members within three generations. Furthermore, we summarized their clinical manifestations and analyzed laboratory parameters related to GS.ResultsThe female proband (the patient with GS) presented with intermittent fatigue and transient periods of tetany, along with significant hypokalemia, hypomagnesemia, and hypocalciuria. All other members of the pedigree had normal laboratory results without obvious GS-related symptoms. Genetic analysis of the SLC12A3 gene identified two novel missense mutations (c.1919A > G, p.N640S in exon 15; c.2522A > G, p.D841G in exon 21) in the patient with GS. Moreover, we demonstrated that her mother, younger maternal uncle, and cousin were carriers of one mutation (c.1919A > G), and her father was the carrier of the other (c.2522A > G).ConclusionThis is the first report of these two novel pathogenic variants of SLC12A3 and their contribution to GS. Further functional studies are particularly warranted to explore the underlying molecular mechanisms.