Multivalent Aptamers Research Articles

Highly Sensitive Minimal Residual Disease Detection by Biomimetic Multivalent Aptamer Nanoclimber Functionalized Microfluidic Chip.

Minimal residual disease (MRD) offers a highly independent prognostic factor for leukemia patients. However, challenges confronting conventional MRD assays are high invasiveness, as well as limited detection sensitivity and clinical applicability. Inspired by the self-adaptive skeleton and multiple suckers or tendrils of climbing plants, a biomimetic Multivalent Aptamer Nanoclimber (MANC)-functionalized microfluidic chip (MANC-Chip) is reported for minimally invasive, highly sensitive and clinically applicable MRD detection in the peripheral blood of T-cell acute lymphoblastic leukemia patients. The MANCs are synthesized by a simple co-polymerization reaction. Due to their flexible structure and cooperative multivalent effect, MANCs dramatically enhance the binding affinity of aptamers targeting leukemia cells. A deterministic lateral displacement-patterned microfluidic chip is designed to further increase the collision probability between MANCs and leukemia cells. Benefiting from the synergistic effect of multivalent binding and enhanced collision, a high capture efficiency of 92.2% for leukemia cells is achieved. Moreover, the captured leukemia cells can be released with high efficiency of 88.9% and high viability of 93.8% via nuclease treatment prior to downstream analysis. Overall, the excellent features of MANC-Chip make it very useful for precise detection of MRD and better understanding of leukemia.

Self-Assembled Multivalent Aptamer Nanoparticles with Potential CAR-like Characteristics Could Activate T Cells and Inhibit Melanoma Growth

In this study, the CAR-like multivalent aptamer nanoparticles (X-polymers) were assembled with the dimer of murine CD28 RNA aptamer (CD28Apt7), the tetramer of CTLA-4 (cytotoxic T-lymphocyte-associated protein 4) RNA aptamer (Del60), and a folic acid labeled ssDNA fragment in a stable nucleic acid three-way junction scaffold (3WJ). Results showed that the X-polymers could recognize both the mCD28 and mCTLA-4 molecules. Confocal imaging and flow cytometry assays showed that the X-polymers could target both T cells and B16 cells in vitro. With the first costimulatory signals provided by the CD3 antibodies, the X-polymers could increase T cell proliferation and reverse the inhibitory effect of interleukin-2 (IL-2) secreting caused by exogenous B7.1 molecules on T cells in vitro. Results of our study also showed that X-polymers could inhibit mouse melanoma B16 cell growth both in vitro and in vivo. Our study demonstrated for the first time that the multivalent aptamer nanoparticle-activated T cells could fulfill the function of CAR-T, which promised a novel approach to developing a multi-functional design of aptamer drugs with potential CAR-like characteristics to enhance the safety of CAR-T cell immunotherapy.

Multivalent Aptamer Functionalized Ag2S Nanodots/Hybrid Cell Membrane‐Coated Magnetic Nanobioprobe for the Ultrasensitive Isolation and Detection of Circulating Tumor Cells

AbstractCirculating tumor cells (CTCs) play key roles in the development of tumor metastasis. It remains a significant challenge to capture and detect CTCs with high purity and sensitivity from blood samples. Herein, a nanoplatform is developed for the efficient isolation and ultrasensitive detection of CTCs by combining near‐infrared (NIR) multivalent aptamer functionalized Ag2S nanodots with hybrid cell membrane‐coated magnetic nanoparticles. Multivalent aptamer functionalized Ag2S nanodots are synthesized using a one‐pot method under mild conditions (60 °C). White blood cell and tumor cell membranes are fused as the hybrid membrane and coated with magnetic nanoparticles, which are further modified with streptavidin (SA). Through the specific interaction of SA‐biotin, the multivalent aptamer‐Ag2S nanodots are grafted with hybrid cell membrane‐magnetic nanoparticles. Due to the features of hybrid cell membrane modification, multivalent aptamer functionalization, magnetic separation, and NIR fluorescence measurements, the nanoplatform shows sensitive recognition, efficient capture, easy isolation, and sensitive detection of CTCs due to its great enhancement in anti‐interference from background and improvement on binding ability toward CTCs. The capture efficiency and purity for CTCs is as high as 97.63% and 96.96%, respectively. Furthermore, the nanoplatform is successfully applied to the detection of CTCs in blood samples.

Multivalent Aptamer-modified DNA Origami as Drug Delivery System for Targeted Cancer Therapy

In spite of great development in nanoparticle-based drug delivery systems(DDSs) for improved therapeutic efficacy, it remains challenging for effective delivery of chemotherapeutic drugs to targeted tumor cells. In this work, we report a triangle DNA origami as targeted DDS for cancer therapy. DNA origami shows excellent biocompatibility and stability in cell culture medium for 24 h. In addition, the DNA origami structures conjugated with multivalent aptamers enable for efficient delivery of anticancer drug doxorubicin(Dox) into targeted cancer cell due to their targeting function, reducing side effects associated with nonspecific distribution. Moreover, we also demonstrated that the multivalent aptamer-modified DNA origami loading Dox exhibits prominent therapeutic efficacy in vitro. Accordingly, this work provides a good paradigm for the development of DNA origami nanostructure-based targeted DDS for cancer therapy.

DNA-Nanoscaffold-Assisted Selection of Femtomolar Bivalent Human α-Thrombin Aptamers with Potent Anticoagulant Activity.

Multivalent aptamers that interact with their target proteins through multiple sites exhibit much stronger binding strengths than their monovalent counterparts. In this work, we have designed a single-stranded DNA (ssDNA) library (1015 molecules, each 145 nt) based on a predefined DNA nanostructure designed to present two random-loop sites for bivalent aptamer evolution. From this library, a group of ultra-strong bivalent aptamers against human α-thrombin (with apparent KD values of ≈340 fm) were easily identified through a simple seven-round conventional systematic evolution of ligands by exponential enrichment (SELEX) procedure. The dominant bivalent aptamers consist of two components, one binding to exosite I and the other to exosite II. The best of these bivalent aptamers show strong allosteric attenuation of the thrombin cleavage activity and also display an extremely potent anticoagulation effect in human plasma, demonstrating their great potential in therapeutic applications. The method developed here can easily be adapted to conventional SELEX techniques, opening a new route for fast selection of multivalent aptamers with superior binding affinity for other targets.

Nonviolent Self-Catabolic DNAzyme Nanosponges for Smart Anticancer Drug Delivery.

The development of self-assembled DNA nanomedicine requires a facile and accurate DNA degradation strategy for precisely programmable drug release. Conventional DNA catabolic strategies are restrained with the fragile and unclear enzymatic reactions that might lead to inefficient and uncontrollable digestion of DNA scaffolds and thus might bring undesirable side effects to the sophisticated biosystems. Herein we reported a versatile self-sufficient DNAzyme-driven drug delivery system consisting of the rolling circle polymerized DNAzyme-substrate scaffolds and the encapsulated pH-responsive ZnO nanoparticles (NPs). The full DNAzyme nanosponges (NSs) were also encoded with multivalent tandem aptamer sequences to facilitate their efficient delivery into cancer cells, where the acidic endo/lysosomal microenvironment stimulates the dissolution of ZnO into Zn2+ ions as DNAzyme cofactors and therapeutic reactive oxygen species generators. The supplement Zn2+ cofactors mediated the nonviolent DNAzyme-catalyzed cleavage of DNA scaffolds for precise and efficient drug administrations with synergistically enhanced therapeutic performance. The facile design of DNAzyme, together with their cost-effective and intrinsic robust features, is anticipated to provide extensive insights for the development of DNA-based therapeutic platforms by activating the specific intracellular biocatalytic reactions. As an intelligent and nonviolent self-driven drug delivery platform, the present DNAzyme NS system could be engineered with more therapeutic sequences and agents and was anticipated to show exceptional promise and versatility for applications in biomedicine and bioengineering.

Artificial Antibody with Site-Enhanced Multivalent Aptamers for Specific Capture of Circulating Tumor Cells.

Isolation of circulating tumor cells (CTCs) from blood holdsgreat potential to diagnose cancers and discover therapeutic targets. Herein, we reported a novel kind of artificial antibody, the cell-imprinted hydrogel with site-directed modification of aptamers (APT-CIH) to achieve the specific capture of CTCs. Cell-imprinted sites not only could be used to recognize target cells but also could be used as efficient scaffolds for assembling aptamers to enhance the capture efficiency and selectivity. Due to the synergistic effect of conformation recognition and multivalent interaction between the aptamers and target cells, APT-CIH showed high capture efficiency and selectivity to SMMC-7721 cells. In the coexistence of the 1000 times leukemia Jurkat cells, the enrichment factor of APT-CIH could reach as high as 21.6 ± 3.1 toward target cells, while that relied only on cell imprinting or aptamer affinity was 8.1 ± 5.0 or 10.1 ± 1.3, respectively. Furthermore, the capture efficiency could reach 58.2% ± 10.9% with 1000 SMMC-7721 cells spiked in 1 mL of blood. Moreover, 92% of the captured cells could be released, beneficial to carry out further biological and clinical study of CTCs. These results demonstrated that APT-CIH might have great potential in CTCs analysis.

Bioinspired Engineering of a Multivalent Aptamer‐Functionalized Nanointerface to Enhance the Capture and Release of Circulating Tumor Cells

AbstractCirculating tumor cell (CTC)‐enrichment by using aptamers has a number of advantages, but the issue of compromised binding affinities and stabilities in real samples hinders its wide applications. Inspired by the high efficiency of the prey mechanism of the octopus, we engineered a deterministic lateral displacement (DLD)‐patterned microfluidic chip modified with multivalent aptamer‐functionalized nanospheres (AP‐Octopus‐Chip) to enhance capture efficiency. The multivalent aptamer–antigen binding efficiency improves 100‐fold and the capture efficiency is enhanced more than 300 % compared with a monovalent aptamer‐modified chip. Moreover, the captured cancer cells can be released through a thiol exchange reaction with up to 80 % efficiency and 96 % viability, which is fully compatible with downstream mutation detection and CTC culture. Using the chip, we were able to find CTCs in all cancer samples analyzed.

DNA-mediated reversible capture and release of circulating tumor cells with a multivalent dual-specific aptamer coating network.

DNA-triggered reversible isolation and recovery of circulating tumor cells (CTCs) is presented based on a multivalent dual-specific aptamer-tethered rolling circle amplification (MA-RCA) network. The multivalent binding sites endow the MA-RCA network with a strong binding ability towards CTCs, and the repeated cell capture/release processes are also actualized in a noninvasive manner.

DNA nanotechnology in molecular design of thrombin aptamers

The field of DNA nanotechnology has had a remarkable impact on nanobiotechnology, and has been developed rapidly. New manipulatable nanoscaled structures or machines constructed by DNA molecules are widely used in biomedical field. An interesting goal of DNA nanotechnology is to assemble DNA nanostructures to display multivalent interactions, which are characterized by simultaneous binding of multiple ligands on one biological entity to multiple receptors on another. With well-established DNA modification methods, multivalent aptamers targeting binding entities have been developed. Thrombin is a coagulation protein that plays a rather vital role in the coagulation cascade—converting soluble fibrinogen into insoluble strands of fibrin. Therefore, thrombin is usually considered an important target when searching for anti-coagulants and antithrombotics to interfere with blood coagulation. Among thrombin inhibitors, aptamers have shown great advantages. Aptamers are short DNA or RNA strands that can specifically bind to proteins and inhibit their activities. They can be selected using a technique known as SELEX (systematic evolution of ligands by exponential enrichment). Aptamers specifically recognize and bind to various target molecules (ions, small organic, inorganic molecules, proteins or living cells) with dissociation constants ( K d) in the picomolar to nanomolar range by folding into unique secondary or tertiary structures that accommodate the targets molecular structure. Two thrombin aptamers bind to two different sites of thrombin. The 15-mer thrombin-binding aptamer (TBA15: GGTTGGTGTGGTTGG) having a G-quadruplex structure in the presence of potassium ions can recognize the fibrinogen-binding exosite of thrombin via a T-loop and inhibit the thrombin activity but the binding affinity is modest ( K d, ~100 nmol/L). The 29-mer thrombin-binding aptamer (TBA29: AGTCCGTGGTAGGGCAGGTTGGGGTGACT) recognizes the heparin-binding exosite of thrombin and exhibits weak inhibitory capability toward thrombin, but has strong binding affinity ( K d, ~0.5 nmol/L). Traditionally, the molecular design of thrombin aptamers focuses on the structural modification of TBA15, and in some designs, the activity of thrombin can be recovered by introduction of complementary strand of aptamers or some small molecules. Therefore, many reversible inhibitors have been constructed based on aptamer TBA15. However, the application of monovalent aptamers-based technology is limited due to the low affinity of monomers. With the quest to develop new antithrombotic agents stimulated by clinical needs and advances in biotechnology, multivalent aptamers with independent stable structures are developed to improve the binding capabilities. In multivalent interactions, when one of the monomers dissociates from the target, another monomer, which can also bind to the same target, can increase its opportunity of binding to the target again. Present molecular designs of thrombin aptamer are mainly based on the structural modifications of the divalent aptamers. With the development of DNA nanotechnology, the precise control of thrombin activity can be achieved by constructing new DNA nanostructures, which can effectively improve the functionality of the bivalent aptamers. It can be predicted that the studies on anticoagulants will gradually expand from structural design to practical applications. In this review, monovalent and divalent thrombin aptamers are discussed, and finally, a perspective on the future directions of this field is presented. We hope this review may help researchers to improve techniques to develop ideal anticoagulants, with potential benefits including high efficacy, safety, rapid onset of action and no requirement for therapeutic monitoring.

Multivalent Self-Assembled DNA Polymer for Tumor-Targeted Delivery and Live Cell Imaging of Telomerase Activity.

The efficient detection and in situ monitoring of telomerase activity is of great importance for cancer diagnosis and biomedical research. Here we report for the first time that the development of a novel multivalent self-assembled DNA polymer, constructed through telomerase primer sequence (ITS) triggered hybridization chain assembly using two functional hairpin probes (tumor-trageting aptamer modified H1 and signal probe modified H2), for sensitive detection and imaging of telomerase activity in living cells. After internalizing into the tumor cells by multivalent aptamer targeting, the ITS on DNA polymers can be elongated by intracellular telomerase to generate telomere repeat sequences that are complementary with the signal probe, which can proceed along the DNA polymers, and gradually light up the whole DNA polymers, leading to an enhanced fluorescence signal directly correlated with the activity of telomerase. Our results demonstrated that the developed DNA polymer show excellent performance for specifically detecting telomerase activity in cancer cells, dynamically monitoring the activity change of telomerase in response to telomerase-based drugs, and efficiently distinguishing cancer cells from normal cells. The proposed strategy may afford a valuable tool for the monitoring of telomerase activity in living cells and have great implications for biological and diagnostic applications.

DNA nanotriangle-scaffolded activatable aptamer probe with ultralow background and robust stability for cancer theranostics

Activatable aptamers have emerged as promising molecular tools for cancer theranostics, but reported monovalent activatable aptamer probes remain problematic due to their unsatisfactory affinity and poor stability. To address this problem, we designed a novel theranostic strategy of DNA nanotriangle-scaffolded multivalent split activatable aptamer probe (NTri-SAAP), which combines advantages of programmable self-assembly, multivalent effect and target-activatable architecture.Methods: NTri-SAAP was assembled by conjugating multiple split activatable aptamer probes (SAAPs) on a planar DNA nanotriangle scaffold (NTri). Leukemia CCRF-CEM cell line was used as the model to investigate its detection, imaging and therapeutic effect both in vitro and in vivo. Binding affinity and stability were evaluated using flow cytometry and nuclease resistance assays.Results: In the free state, NTri-SAAP was stable with quenched signals and loaded doxorubicin, while upon binding to target cells, it underwent a conformation change with fluorescence activation and drug release after internalization. Compared to monovalent SAAP, NTri-SAAP displayed greatly-improved target binding affinity, ultralow nonspecific background and robust stability in harsh conditions, thus affording contrast-enhanced tumor imaging within an extended time window of 8 h. Additionally, NTri-SAAP increased doxorubicin loading capacity by ~5 times, which further realized a high anti-tumor efficacy in vivo with 81.95% inhibition but no obvious body weight loss.Conclusion: These results strongly suggest that the biocompatible NTri-SAAP strategy would provide a promising platform for precise and high-quality theranostics.

Implication of multivalent aptamers in DNA and DNA–RNA hybrid structures for efficient drug delivery in vitro and in vivo

To examine proper multivalency and type of aptamers in linear nucleic acid-based structures for efficient intracellular uptakes, we designed linear DNA structures with single and dual aptamers targeting guanosine-rich oligonucleotide 100 (AS1411) and mucin 1 (MUC-1). Multivalent linear DNA structures containing dual types of aptamers showed significantly superior cellular internalization. In addition, multivalent aptamer-immobilized DNA–RNA hybrid structures showed excellent tumor accumulation in vivo without liver toxicity and very low nonspecific cytokine induction. Thus, these multivalent nucleic acid based structures with dual types of aptamers can be specifically applied as carriers of therapeutic nucleic acids without inducing noticeable systemic toxicity.

A TIM-3 Oligonucleotide Aptamer Enhances T Cell Functions and Potentiates Tumor Immunity in Mice

T cell immunoglobulin-3 (TIM-3) is a negative regulator of interferon-γ (IFN-γ) secreting CD4+ Tcells and CD8+ T cytotoxic cells. Recent studies have highlighted the role of TIM-3 as an important mediator of CD8+ Tcell exhaustion in the setting of chronic viral infections and cancer. In murine tumor models, antibody blockade of TIM-3 with anti-TIM-3 antibodies as monotherapy has no or minimal antitumor activity, suggesting that TIM-3 signaling exerts an accessory or amplifying effect in keeping immune responses in check. Using a combined bead and cell-based systemic evolution of ligands by exponential enrichment (SELEX) protocol, we have isolated nuclease-resistant oligonucleotide aptamer ligands that bind to cell-associated TIM-3 with high affinity and specificity. A trimeric form of the TIM-3 aptamer blocked the interaction of TIM-3 with Galectin-9, reduced cell death, and enhanced survival, proliferation, and cytokine secretion invitro. In tumor-bearing mice, the aptamer delayed tumor growth as monotherapy and synergized with PD-1 antibody in prolonging the survival of the tumor-bearing mice. Both invitro and invivo, the trimeric aptamer displayed superior activity compared to the currently used RMT3-23 monoclonal antibody. This study suggests that multi-valent aptamers could represent an alternative platform to generate potent ligands to manipulate the function of TIM-3 and other immune modulatory receptors.

Orchestrating a Symphony on a Single Conjugate: Aptamer Targeting, Gene Silencing, and Immunomodulation to Enhance Antitumor Response

Over the past decade, immunotherapy has rapidly changed the landscape of medicine, especially oncology. Checkpoint inhibitors and monoclonal antibodies capable of deploying the body’s own immune functions against diseased cells have been heralded as a soon-to-be standard of care for cancer. The excitement around immunotherapy has been accompanied by impressive results, although some are tailored only to a limited number of patients and others are accompanied by substantial toxicity profiles.1 Therefore, there are still unmet needs within the field.

Multivalent Aptamers: Versatile Tools for Diagnostic and Therapeutic Applications.

Nucleic acid aptamers generated through an in vitro selection are currently extensively applied as very valuable biomolecular tools thanks to their prominent advantages. Diversity of spatial structures, ease of production through chemical synthesis and a large variety of chemical modifications make aptamers convenient building blocks for the generation of multifunctional constructs. An opportunity to combine different aptamer functionalities with other molecules of interest such as reporter groups, nanoparticles, chemotherapeutic agents, siRNA or antisense oligonucleotides provides a widest range of applications of multivalent aptamers. The present review summarizes approaches to the design of multivalent aptamers, various examples of multifunctional constructs and the prospects of employing them as components of biosensors, probes for affinity capture, tools for cell research and potential therapeutic candidates.

Multivalent Aptamer-RNA Conjugates for Simple and Efficient Delivery of Doxorubicin/siRNA into Multidrug-Resistant Cells.

Multivalent aptamer-siRNA conjugates containing multiple mucin-1 aptamers and BCL2-specific siRNA are synthesized, and doxorubicin, an anthracycline anticancer drug, is loaded into these conjugates through intercalation with nucleic acids. These doxorubicin-incorporated multivalent aptamer-siRNA conjugates are transfected to mucin-1 overexpressing MCF-7 breast cancer cells and their multidrug-resistant cell lines. Doxorubicin-incorporated multivalent aptamer-siRNA conjugates exert promising anticancer effects, such as activation of caspase-3/7 and decrease of cell viability, on multidrug-resistant cancer cells because of their high intracellular uptake efficiency. Thus, this delivery system is an efficient tool for combination oncotherapy with chemotherapeutics and nucleic acid drugs to overcome multidrug resistance.

Post-SELEX optimization of aptamers.

Aptamers are functional single-stranded DNA or RNA oligonucleotides, selected in vitro by SELEX (Systematic Evolution of Ligands by Exponential Enrichment), which can fold into stable unique three-dimensional structures that bind their target ligands with high affinity and specificity. Although aptamers show a number of favorable advantages such as better stability and easier modification when compared with the properties of antibodies, only a handful of aptamers have entered clinical trials and only one, pegaptanib, has received US Food and Drug Administration approval for clinical use. The main reasons that limit the practical application of aptamers are insufficient nuclease stability, bioavailability, thermal stability, or even affinity. Some aptamers obtained from modified libraries show better properties; however, polymerase amplification of nucleic acids containing non-natural bases is currently a primary drawback of the SELEX process. This review focuses on several post-SELEX optimization strategies of aptamers identified in recent years. We describe four common methods in detail: truncation, chemical modification, bivalent or multivalent aptamer construction, and mutagenesis. We believe that these optimization strategies should improve one or more specific properties of aptamers, and the type of feature(s) selected for improvement will be dependent on the application purpose.

Methods for Improving Aptamer Binding Affinity.

Aptamers are single stranded oligonucleotides that bind a wide range of biological targets. Although aptamers can be isolated from pools of random sequence oligonucleotides using affinity-based selection, aptamers with high affinities are not always obtained. Therefore, further refinement of aptamers is required to achieve desired binding affinities. The optimization of primary sequences and stabilization of aptamer conformations are the main approaches to refining the binding properties of aptamers. In particular, sequence optimization using combined in silico sequence recombinations and in vitro functional evaluations is effective for the improvement of binding affinities, however, the binding affinities of aptamers are limited by the low hydrophobicity of nucleic acids. Accordingly, introduction of hydrophobic moieties into aptamers expands the diversity of interactions between aptamers and targets. Moreover, construction of multivalent aptamers by connecting aptamers that recognize distinct epitopes is an attractive approach to substantial increases in binding affinity. In addition, binding affinities can be tuned by optimizing the scaffolds of multivalent constructs. In this review, we summarize the various techniques for improving the binding affinities of aptamers.

Multivalent DNA aptamers as potent inhibitors of L-selectin mediated lymphocyte rolling

Event Abstract Back to Event Multivalent DNA aptamers as potent inhibitors of L-selectin mediated lymphocyte rolling Jens Dernedde1, Sebastian S. Riese1, Konrad K. Buscher2, Sven S. Enders1, Christian C. Kuehne1 and Rudolf R. Tauber1 1 Charité - Universitätsmedizin Berlin, Institute for Laboratory Medicine, Germany 2 University of Muenster, Institute for Physiology, Germany Introduction: The adhesion receptor L-selectin mediates the extravasation of leukocytes from the blood into the surrounding tissue during inflammation and homeostasis. The single binding event to its ligands is very weak but strongly enhanced by multivalent interactions. We have previously described L-selectin targeting by the pleiotropic synthetic polyanion dPGS [1],[2]. Aptamers are short oligonucleotides with favorable use in clinical settings due to their high specificity and low immunogenicity. In this study, we characterized the structural requirements of an L-selectin aptamer for effective receptor binding and evaluated the impact of multivalency. Material and Methods: Deletion and point mutations of the DNA aptamer sequence defined structural essential parts of aptamer sequence. Target binding was initially screened by surface plasmon resonance (SPR). Di- and trimeric aptamers were prepared by linkage to polyadenosine spacers of different length. Again the optimal spacer length was evaluated by SPR. Further evaluation of aptamer functionality was performed in a flow chamber where binding of leukocytes to immobilized ligands was analyzed with respect to aptamer concentrations which block the adhesion receptor L-selectin. Finally, aptamer function was evaluated in vivo, in a model of leukocyte extravasation by intravital microscopy. Results and Discussion: Structural optimization of the L-selectin targeting aptamer led to a size reduction of 22% while maintaining binding efficiency. Surface plasmon resonance experiments showed superior blocking effects of multivalent aptamers, even compared to the monoclonal inhibitory antibody DREG-200. This finding was confirmed both in flow chamber experiments and in vivo using intravital imaging of the peripheral lymph node. Together, these data demonstrate that optimization of DNA structure and a multivalent display significantly increase the functionality and versatility of aptamer-based drugs.