Multiplex PCR Method Research Articles

Measuring DNA quality by digital PCR using probability calculations

BackgroundAccurate methods to assess DNA integrity are needed for many biomolecular methods. A multiplex digital PCR (dPCR) method designed for interspaced target sequences can be used to assess sequence integrity of large DNA strands. The ratio of single positive partitions versus double positive partitions is then used to calculate the sheared DNA strands. However, this simple calculation is only valid with low DNA concentration. We here describe a method based on probability calculations which enables DNA quality analysis in a large dynamic range of DNA concentrations. ResultsKnown DNA integrity percentages were mimicked using artificial double stranded DNA in low, intermediate and high DNA concentration scenarios, respectively 600, 12500 and 30000 copies of DNA per reaction. At low concentrations both methods were similar. However, at the intermediate concentration (12500 copies per reaction) the ratio based method started producing a larger error than the proposed probability calculation method with a mean relative error of 20.7 and 16.7 for the Bruner and the proposed method respectively. At the high concentration (30000 copies per reaction) only the proposed method provided accurate measurements with a mean relative error of 60.9 and 9.3 for the ratio based and the proposed method respectively. Furthermore, while both methods have a bias, it is constant for the proposed method, while it decreases with the integrity of the DNA for the ratio based method. The probability calculation equation was extended to 4 dimensions and a proof of concept experiment was performed, the data suggested that the 4 dimensional equation is valid. Significance and noveltyWe here validate a method of estimating DNA integrity with dPCR using multiple probe combinations, allowing fast and flexible DNA integrity analysis. Additionally, we extend the method from 2 to 4 plex for more accurate DNA integrity measurements.

Molecular characterization of typing and subtyping of Staphylococcal cassette chromosome SCCmec types I to V in methicillin-resistant Staphylococcus aureus from clinical isolates from COVID-19 patients.

Methicillin resistance is acquired by the bacterium due to mecA gene which codes for penicillin-binding protein (PBP2a) having low affinity for β-lactam antibiotics. mecA gene is located on a mobile genetic element called staphylococcal cassette chromosome mec (SCCmec). SCCmec genomic island comprises two site-specific recombinase genes namely ccrA and ccrB [cassette chromosome recombinase] accountable for mobility. Currently, SCCmec elements are classified into types I, II, III, IV and V based on the nature of the mec and ccr gene complexes and are further classified into subtypes according to variances in their J region DNA. SSCmec type IV has been found in community-acquired isolates with various genetic backgrounds. The present study was undertaken to categorize the types of SCCmec types and subtypes I, II, III, IVa, b, c, d, and V and PVL genes among clinical MRSA isolates from COVID-19 confirmed cases. Based on the Microbiological and Molecular (mecA gene PCR amplification) confirmation of MRSA isolated from 500 MRSA SCCmec clinical samples, 144 cultures were selected for multiplex analysis. The multiplex PCR method developed by Zhang et al. was adapted with some experimental alterations to determine the specific type of these isolates. Of the total 500 MRSA, 144 MRSA (60 were CA-MRSA and 84 were HA-MRSA) were selected for characterization of novel multiplex PCR assay for SSCmec Types I to V in MRSA. Molecular characterization of multiplex PCR analysis revealed results compare to the phenotypic results. Of the 60 CA-MRSA; in 56 MRSA strains type IVa was found and significantly defined as CA-MRSA while 4 strains showed mixed gens subtypes. Type II, III, IA, and V were present in overall 84 HA-MRSA. Molecular subtyping was significantly correlated to define molecularly as CA-MRSA and HA-MRSA however 15 (10%) strains showed mixed genes which indicates the alarming finding of changing epidemiology of CA-MRSA and HA-MRSA as well. We have all witnessed of COVID-19 pandemic, and its mortality was mostly associated with co-morbid conditions and secondary infections of MDR pathogens. Rapid detections of causative agents of these superbugs with their changing epidemiology by investing in typing and subtyping clones are obligatory. We have described an assay designed for targeting SSCmec types and subtypes I, II, III, IVa,V according to the current updated SCCmec typing system. Changing patterns of molecular epidemiology has been observed by this newly described assay.

Rapid, simple multi-locus variable number tandem repeat analysis: a reliable tool for Klebsiella pneumoniae outbreak screening

Klebsiella pneumoniae causing nosocomial infections is increasingly multidrug-resistant. Rapid and efficient typing tools are required for monitoring. To assess a simple and rapid (<5 hours) multiplex-PCR method based on Multiple-Locus Variable-Number Tandem Repeat Analysis (MLVA) as a screening tool to determine whether K. pneumoniae strains are related or not. We assessed the global discriminatory power of our method on 72 unrelated K. pneumoniae isolates including community carriage isolates, highly virulent strains causing liver abscess and extended spectrum beta-lactamase and carbapenemase-producing strains. Suspected related strains from a suspected outbreak and relapsed meningitis case were also studied. MLVA results were compared with Whole Genome Sequencing (WGS) analysis and Multi-Locus Sequence-typing (MLST). MLVA and MLST have similar discriminatory power, each distinguishing 54 profiles among the 72 unrelated isolates (Hunter-Gaston index: 0.989). Each strain belonging to one ST or ST-complex had its own MLVA-type with few exceptions. Two strains of ST268 and ST1119 shared the same MLVA profile while two unrelated strains of ST307, ST86, ST45 and ST37 exhibited each two different MLVA-types. Moreover, investigation of seven grouped cases of K. pneumoniae neonatal sepsis pointed to strong suspicion of a common source for five isolates while two isolates with a different MLVA profile were excluded from this cluster. Our MLVA approach is a useful, rapid and reliable tool for epidemiological investigation requiring only basic molecular biology equipment and permits identification of sporadic isolates that are not part of an outbreak. However, analysis of strains sharing the same MLVA-type by a highly discriminatory technique such as WGS remains necessary.

Development of a Multiplex Polymerase Chain Reaction Method for Rapid and Accurate Identification of Girella punctata and G. leonina (Teleostei: Girellidae)

Girella punctata and Girella leonina are economically important species found in the East Sea; along the southern coast of Korea; south of Hokkaido, Japan; around Taiwan; and in the East China sea. In Korea, these two species hold high value, particularly on Jeju Island. These species have similar appearances, and it is challenging to distinguish them, particularly during the seed period. We detected genetic differences in the mtDNA (COI gene) of G. punctata and G. leonina, which are morphologically indistinguishable, and developed species-specific genetic markers for their identification. In total, 16 and 4 haplotypes of the COI genes were obtained from G. punctata (n = 164) and G. leonina (n = 36), respectively. The haplotype diversity (Hd) and nucleotide diversity (Pi, %) of the COI were 0.359 and 0.054 for G. punctata and 0.560 and 0.078 for G. leonina, respectively. We designed a Girella species common primer (control) and species-specific primer sets (experimental) for the two species. Amplicon sizes of 991, 579, and 391 bp were obtained for common primers of the two Girella species G. punctata and G. leonina. To confirm multiple targets in a single reaction, multiplex PCR conditions were optimized to adjust its resolution and accuracy. The detection levels of the multiplex PCR were confirmed to be 0.01 ng/µL for the two Girella species. The multiplex PCR was not associated with cross-reactivity between G. punctata and G. leonina. This multiplex species-specific PCR method provides a simple and rapid technique for the identification of two Girella species, thus increasing the efficiency and quality of Girella species stock management and forensic identification to prevent species misidentification.

Pengembangan Metode PCR Multipleks untuk Analisis Genotipe Null Gen GSTM1/GSTT1 pada Pasien Tuberkulosis

Tuberculosis (TB) remains Indonesia's leading infectious disease. Hepatotoxicity is the most common side effect of TB first-line medication therapy in TB patients. GSTM1 and GSTT1 are glutathione S-transferase (GST) genes involved in the detoxification of various toxic compounds such as drugs. The development of fast and simple methods for null genotyping of GSTM1/GSTT1 could facilitate large pharmacogenetic studies and the clinical application of personalized drug dose adjustment according to the patient's genetic profile. The aim of this research was to develop a multiple PCR method for simultaneous amplification of GSTM1/GSTT1 genes for molecular analysis. A total of 25 samples of TB patients were used to validate the method consisting of TB patients with hepatotoxicity and without hepatotoxicity. Our result showed the genotype frequency of the GSTM1 null genotype was 90% in TB patients with hepatotoxicity and 100% in TB patients without hepatotoxicity. The frequency of the GSTT1 null genotype in TB patients with hepatotoxicity was 90%, whereas in TB patients without hepatotoxicity was 80%. The sequencing results on the positive samples showed a similarity of 99% to the GenBank NCBI. Our study was successful in detecting GSTM1 and GSTT1 null genotypes using the multiplex PCR method in TB patients. Further study needs to be done with larger sample of TB patients.

Investigation of O25b-ST131 Clone Frequency and Presence of Carbapenem and Fosfomycin Resistance Genes in Escherichia coli Isolates: First Detection of fosA3 from Escherichia coli O25bSTf131 Clone from Türkiye

Escherichia coli ST131 clone was first reported in 2008 and defined as a 'high-risk pandemic clone'. This clone plays a critical role in the spread of antimicrobial resistance worldwide. It was reported in many studies that the E.coli ST131 clone is widespread worldwide and can carry virulence and antibiotic resistance genes. E.coli ST131 clone is associated with a fluoroquinolone and broad-spectrum cephalosporin resistance. The agents used in the treatment of infections caused by the E.coli ST131 clone are limited. For this reason, monitoring the resistance status of these limited agents is crucial. In this study, we aimed to investigate the prevalence of the O25b-ST131 clone, and the presence of carbapenem and fosfomycin resistance genes in fluoroquinolone-resistant E.coli isolates isolated from mid-stream urine samples. For the detection of the O25b-ST131 clone in fluoroquinolone-resistant E.coli isolates, amplification was performed with primers O25pabBspe-F and O25pabBspe-R. For the determination of resistance genes, carbapenem resistance genes blaNDM, blaVIM, blaKPC, blaIMP, and blaOXA-48 in carbapenem resistant isolates and plasmid-mediated fosfomycin resistance genes fosA3 and fosC2 in fosfomycin resistant isolates were investigated by multiplex PCR method. According to PCR results, the prevalence of E.coli O25b-ST131 isolates was 51.2%. Carbapenem resistance rate was 3.41%, and fosfomycin resistance rate was 3.41% in fluoroquinolone-resistant E.coli isolates. Carbapenem and fosfomycin resistance rates in E.coli O25bST131 isolates were determined as 0.83% and 2.5%, respectively. At least one of the carbapenem-resistance genes (blaNDM and/or blaOXA-48) was detected in six of the eight carbapenem-resistant isolates. Fosfomycin resistance gene fosA3 was seen in four of eight fosfomycin-resistant isolates. fosC2 gene was not detected in any of the isolates. In addition, the plasmid-mediated fosfomycin resistance gene fosA3 was detected in an E.coli O25b-ST131 isolate, and this result was confirmed by sequence analysis. To the best of our knowledge, this is the second report about fosA3 positivity in E.coli ST131 isolates from the world and the first reported from Europe and Türkiye. As a result, approximately half of the fluoroquinolone-resistant E.coli isolates were identified as E.coli ST131 clones. Despite the high rate of this clone, the carbapenem and fosfomycin resistance rates are still relatively low, which is pleasing for the future of treatment. However, it should not be forgotten that resistance rates and the prevalence of resistance genes should be constantly monitored.

Triplex-colored nucleic acid lateral flow strip and multiplex polymerase chain reaction coupled method for quantitative identification of beef, pork and chicken

Meat adulteration is one of the worldwide challenges for food quality control. Now, we developed a multiplex PCR and nucleic acid lateral flow strip (mPCR-NALFS) integrated method that employs triplex-color latex microspheres (LMs) as visual labels for simultaneous identification of beef, pork and chicken DNA. First, three primer pairs for beef, pork and chicken DNA are tailed with specific oligonucleotide sequences (anti-recognition/anti-detection/anti-control probes) as swing tags. Then, double-stranded amplicons obtained after mPCR amplification were flanked by tags. Finally, these amplicons can accurately hybridize with the pre-immobilized recognition probes on the conjugate pad, detection probes on the test lines and control probes on the control line, respectively. The LMs and recognition probe modified LMs were characterized by scanning electron microscopy, ultraviolet-visible spectroscopy and Fourier Transform Infrared spectroscopy. This strip can quantitatively detect beef, pork and chicken DNA within 10 min without compromising on accuracy compared to the electrophoresis. Specificity analysis revealed no cross-reactivity with meat derived from beef, pork, chicken, duck, mutton, rabbit, goose, ostrich, camel and horse meat. As low as 0.1 % (wt%) of beef, pork and chicken in the simulated adulterated meats were co-detected. This assay was successfully employed for adulteration identification in 28 commercial beef and lamb products.

Development of detection methods by multiplex real-time PCR for highly pathogenic Yersinia enterocolitica, low pathogenic Yersinia enterocolitica, and Yersinia pseudotuberculosis based on SYBR Green and TaqMan probes

This study aimed to develop multiplex real-time PCR methods using SYBR Green and TaqMan probes for rapid and sensitive diagnosis, differentiating three pathogenic Yersinia groups such as highly pathogenic Y. enterocolitica, low pathogenic Y. enterocolitica, and Y. pseudotuberculosis. Specific primer and probe combinations for differentiating three pathogenic Yersinia groups were designed from three chromosomally encoded genes (ail, fyuA, and inv). Twenty-six stains of pathogenic Yersinia species including 6 strains of low pathogenic Y. enterocolitica serotypes, 7 strains of highly pathogenic Y. enterocolitica serotypes, and 13 strains of pathogenic Y. pseudotuberculosis were used for specificity testing. Specific patterns of real-time amplification signals distinguished three pathogenic Yersinia groups. A detection limit of approximately 101 colony forming units (CFU) /reaction of genomic DNA was determined based on plate counts. Furthermore, the multiplex real-time PCR methods also detected Y. enterocolitica O:8 from the DNA extracted from spiked rabbit blood samples and potentially infected wild rodent fecal samples. These results demonstrated that the multiplex real-time PCR methods developed in this study are useful for rapid detection and differentiation of three pathogenic Yersinia groups. Therefore, these methods provide a new monitoring and detection capability to understand the epidemiology of pathogenic Yersinia and to diagnose three pathogenic Yersinia groups.

Clinical and Molecular Profile of Carbapenem Resistant Klebsiella pneumoniae Infections in a Tertiary Care Hospital -Mangalore.

Carbapenemase producing Klebsiella pneumoniae infection has increased in recent years, leading to limitations in treatment options. The present study was undertaken to detect the Carbapenemase-producing genes in K. pneumoniae, the risk factors for acquiring them, and their impact on clinical outcomes. This prospective study included 786 clinically significant K. pneumoniae isolates. Antimicrobial susceptibility testing was done by conventional method, carbapenem-resistant isolates were screened by carba NP test, and positive isolates were further evaluated by multiplex PCR method. The patient's clinical and demographic details, co morbidity, and mortality were collected. Multivariate analysis was performed to check risk factors for acquiring CRKP infection. The results of our study showed high prevalence of CRKP (68%). The variables subjected to the multivariate analysis found that diabetes, hypertension, cardiovascular disease, COPD, use of immunosuppressants, previous hospitalization history, previous surgery, and parenteral nutrition are found to be significantly associated with carbapenem resistant K. pneumoniae infection. Clinical outcomes revealed that patients in the CRKP group had higher risk of mortality and were discharged against medical advice, and they also had higher rate of septic shock. Most of the isolates carried blaNDM-1 and blaOXA-48 carbapenemase genes. Additionally, the co-existence of blaNDM-1 and blaOXA-48 was found in our isolates. The prevalence of CRKP was alarmingly high in our hospital with the limited choice of antibiotics. This was associated with high mortality and morbidity with the increase in health care burden. While this information is important to treat critically ill patients with higher antibiotics, strict infection control practices need to be in place to prevent the spread of these infections in the hospital. Clinicians need to be aware of this infection to use appropriate antibiotics to save the lives of critically ill patients with the infection.

A Two-Step Real-Time PCR Method To Identify Mycobacterium tuberculosis Infections and Six Dominant Nontuberculous Mycobacterial Infections from Clinical Specimens.

Tuberculosis (TB) is an ongoing threat to public health, and furthermore, the incidence of infections by nontuberculous mycobacteria (NTM), whose symptoms are not distinguishable from TB, is increasing globally, thus indicating a need for accurate diagnostics for patients with suspected mycobacterial infections. Such diagnostic strategies need to include two steps, (i) detecting the mycobacterial infections and, if the case is an NTM infection, (ii) identifying the causative NTM pathogen. To eliminate a false-positive TB diagnosis for a host vaccinated by the bacillus Calmette-Guérin (BCG) strain of Mycobacterium bovis, a new target specific for M. tuberculosis species was selected, together with the species-specific targets for the six dominant NTM species of clinical importance, i.e., M. intracellulare, M. avium, M. kansasii, M. massiliense, M. abscessus, and M. fortuitum. Using sets of primers and probes, a two-step real-time multiplex PCR method was designed. The diagnostic performance was assessed by using a total of 1,772 clinical specimens from patients with suspected TB or NTM infection. A total of 69.4% of M. tuberculosis and 28.8% of NTM infections were positive for the primary step of the real-time PCR corresponding to the culture within 10 weeks, and mycobacterial species of 75.5% of the NTM-positive cases were identified by the secondary step. The two-step method described herein presented promising results and similar diagnostic sensitivity and specificity to commercially available real-time PCR kits for detecting TB and NTM infections. The method also enabled the identification of mycobacterial species in three-quarters of NTM infection cases, thus providing a better treatment strategy. IMPORTANCE Tuberculosis (TB) is an ongoing threat to public health. In addition, infection by nontuberculous mycobacteria (NTM) is a nonnegligible issue for global public health, with increasing incidences. Since the antimicrobial treatment strategy needs to be differed by the causative pathogen, a rapid and accurate diagnostic method is necessary. In this study, we developed a two-step molecular diagnostic method using clinical specimens of TB and NTM infection-suspected patients. The diagnostic power of the new method using the novel target was similar to the widely used TB detection kit, and, among the NTM-positive specimens, three-quarters of the NTM species were able to be identified. This simple and powerful method will be useful as it is, and it could be applied easily to a point-of-care diagnostic apparatus for better application to patients, especially those living in developing countries.

Universal whole-genome Oxford nanopore sequencing of SARS-CoV-2 using tiled amplicons

We developed a comprehensive multiplexed set of primers adapted for the Oxford Nanopore Rapid Barcoding library kit that allows universal SARS-CoV-2 genome sequencing. This primer set is designed to set up any variants of the primers pool for whole-genome sequencing of SARS-CoV-2 using single- or double-tiled amplicons from 1.2 to 4.8 kb with the Oxford Nanopore. This multiplexed set of primers is also applicable for tasks like targeted SARS-CoV-2 genome sequencing. We proposed here an optimized protocol to synthesize cDNA using Maxima H Minus Reverse Transcriptase with a set of SARS-CoV-2 specific primers, which has high yields of cDNA template for RNA and is capable of long-length cDNA synthesis from a wide range of RNA amounts and quality. The proposed protocol allows whole-genome sequencing of the SARS-CoV-2 virus with tiled amplicons up to 4.8 kb on low-titer virus samples and even where RNA degradation has occurred. This protocol reduces the time and cost from RNA to genome sequence compared to the Midnight multiplex PCR method for SARS-CoV-2 genome sequencing using the Oxford Nanopore.

A simplex and multiplex PCR assay for simultaneous detection of beef, pork, and chicken meat in sausages based on mitochondrial DNA Cytochrome oxidase sub-unit I

Adulteration in the processed beef product industry has long been an issue affecting consumers’ rights and legal protection as beef is an expensive raw material. The intense market competition opens up opportunities for manufacturers of processed beef products to counterfeit and mixes their products with other cheap meat ingredients such as chicken and pork. In addition, the use of pork to substitute beef in the production of sausages without proper labelling on the final products is both an adulteration and halal assurance issue in the Muslim-majority market. Multiplex PCR is a sensitive assay used for the identification of raw materials used in the production of processed food and it reduces the cost and time of analyzing a large number of samples. The purpose of this research was to apply the multiplex PCR assay targeting mitochondrial DNA Cytochrome Oxidase SubUnit I (COI) sequence and to determine the detection limits for DNA concentrations in beef, pork, and chicken. The DNA genomes that were extracted from each meat were diluted to concentrations of 25; 10; 1; 0.1; 0.01; and 0.001 ng/µL, and then used as a DNA template for the simplex- and multiplex-PCR. The results of simplex- and multiplex-PCR showed that the COI primers used were able to amplify the DNA of bovine, porcine, and chicken accurately as indicated by amplicons of 263 bp, 168 bp, and 596 bp, respectively. It was concluded that the simplex- and multiplex-PCR methods using COI primers can be used to identify bovine, porcine, and chicken DNA isolated from sausages with a sensitivity of 0.001 ng/μL.

Carriage of Enterotoxigenic Staphylococcus Aureus and Hygiene Practices of Food Workers

To determine the enterotoxigenic Staphylococcus aureus carriage rates and personal hygiene practices a total of 300 food workers participated, with 228 working in food businesses and 72 in hospital kitchens in Canakkale, Turkey. &#x0D; Participants completed a questionnaire about sociodemographic characteristics, hygiene practices, and food safety. Hand/nasal swabs were collected from the food workers. Inoculums were seeded on Baird Parker Agar. Multiplex PCR and ELISA methods were used.&#x0D; The enterotoxigenic S. aureus carriage rate was 14% of food workers. Out of the 125 S. aureus strains, 42 (33.6%) were positive for one or more SE genes. Furthermore, sea, seb, sec, sed, and sea+sed were found in 16.0%, 6.4%, 9.6%, 6.4%, and 4.8% respectively. SEA, SEB, SEC, SED, and SEE were found at rates of 14.4%, 7.2%, 12.8%, 11.2%, and 20.8%. It was determined that as the education level of food workers increased, the S. aureus carrier rate decreased. The carrier rate was found to be higher in those who use gloves than those who do not. Hand carriers were determined more in nasal carriers (p

Diagnostic test of multiplex PCR design based on COVID-19 genotype variations in local isolates

Background: Coronavirus disease 2019 (COVID-19) is an infectious disease caused by the SARS-CoV-2 virus which is a new strain of the Coronavirus, the primary and probe designs were carried out to find candidate primers and probes to be used as the detection of COVID-19. The purpose of this study was to design multiplex PCR on primers and ORF1ab and N gene probes in COVID-19 examination using the multiplex PCR method and it is expected to have good validity in the examination. Methods: The research design is in the form of explorative descriptive with a cross sectional approach. Starting from April to December 2021. The samples used in this study were 221 COVID-19 gene sequences downloaded from the NCBI and GISAID gene databases. Results: The design results of the ORF1ab gene primer and probe with forward primer: 5'- CGCAATTTACAACACAGAC -3' reverse primer: 5'- GTTCTTTATGCTAGCCACT -3' amplicon length 183 bp, and probe sequence: FAM 5'-AAACACACAACAGCATCGTCA-3' BHQ-1, on the N gene with forward primer: 5'-AATTCAACTCCAGGCAG -3' and reverse primer: 5'- CTCTCTCAAGCTGGTTCAATC -3' amplicon length 111 bp, and probe sequence: HEX 5'-CAGCAAAGCAAGAGCAGCA-3' BHQ-1 primary pair sequence and ORF1ab gene probe and N gene conjecture qualified for q-PCR. Conclusions: The obtained primary and probe pair sequences can be used as COVID-19 detection using the multiplex PCR method.

GSTs genetic polymorphism, gene-environment interaction and association with gallbladder cancer risk in North Indian population: A case-controlled study.

In the present case-controlled study, we explored the role of genetic polymorphism in three xenobiotic metabolizing genes, GSTM1, GSTT1 and GSTP1, and their association to gallbladder cancer (GBC) risk in a North Indian population. Its etiology is influenced by genetic, food habits, lifestyle, and environmental factors. GBC incidence is significantly higher in the Gangetic belt, India. Therefore, we explored the prognostic factors in the susceptibility of GBC through gene-gene and gene-environment interaction in this region. Genetic polymorphism was analyzed in 108 GBC patients from Kamala Nehru Memorial Cancer Hospital, Prayagraj and 142 matched controls. GSTM1 and GSTT1 genotypes were analyzed by multiplex PCR method, while restriction fragment length polymorphism (RFLP) was performed to analyze GSTP1 genotypes. Logistic regression analysis calculating the odds ratio (OR) and 95% confidence interval (CI) was performed to analyze the GBC risk. GSTT1 (null) genotype was at a significantly higher risk and susceptible to GBC (OR = 2.044, CI = 1.225-3.411, P = 0.006), while GSTM1 and GSTP1 genotypes did not show any association to GBC risk. After sex stratification, females diagnosed with GBC had higher GSTT1 (null) genotype (OR = 2.754, CI = 1.428-5.310, P = 0.003) compared to males. GBC patients dwelling in rural areas show higher GSTT1 (null) genotype with two-fold GBC risk (OR = 2.031, CI = 1.200-3.439, P = 0.008). Further, GBC patients with histopathology of adenocarcinoma also showed higher GSTT1 (null) genotype (OR = 2.113, CI = 1.248-3.578, P = 0.005). Gene-gene interaction between GSTT1 (non-null)/GSTP1 (Ile/Val + Val/Val), enhance the GBC risk (OR = 1.840, CI = 1.135-2.982, P = 0.013). The present study suggests that GSTT1 (null) genotype has higher susceptibility and risk towards GBC in North Indian population. Female patients, patients with histopathology of adenocarcinoma and rural dwelling GBC patients have higher GSTT1 (null) genotypes and may be at risk of developing GBC. The genotype combination GSTT1 (non-null)/GSTP1 (Ile/Val + Val/Val) has increased GBC susceptibility and may be considered as 'at risk' genotypes for GBC in North Indians.

Association of 410L, 1016I and 1534C kdr mutations with pyrethroid resistance in Aedes aegypti from Ouagadougou, Burkina Faso, and development of a one-step multiplex PCR method for the simultaneous detection of 1534C and 1016I kdr mutations

BackgroundSince 2000, Burkina Faso has experienced regular dengue cases and outbreaks, making dengue an increasingly important health concern for the country. Previous studies in Burkina Faso reported that resistance of Aedes aegypti to pyrethroid insecticides was associated with the F1534C and V1016I kdr mutations. The current study reports high resistance of Ae. aegypti populations to pyrethroid insecticides, likely supported by mutations in the voltage-gated sodium channel, here evidenced by genotyping the kdr SNPs V410L, V1016I and F1534C. We also describe a new multiplex PCR-based diagnostic of F1534C and V1016I kdr SNPs.MethodsLarvae of Ae. aegypti were collected from three health districts of Ouagadougou in 2018. The resistance status of Ae. aegypti to permethrin (15 μg/ml) and deltamethrin (10 μg/ml) was tested using bottles and to malathion (5%) using WHO tube tests. All bioassays used 1-h exposure and mortality recorded 24 h post-exposure. Bioassay results were interpreted according to WHO thresholds for resistance diagnosis. The kdr mutations were screened using AS-PCR and TaqMan methods in exposed and non-exposed Aedes mosquitoes.ResultsFemales from all health districts were resistant to permethrin and deltamethrin (< 20% mortality) but were fully susceptible to 5% malathion. The F1534C and V1016I kdr mutations were successfully detected using a newly developed multiplex PCR in perfect agreement with TaqMan method. The 1534C/1016I/410L haplotype was correlated with permethrin resistance but not with deltamethrin resistance; however, the test power was limited by a low frequency of dead individuals in deltamethrin exposure.ConclusionsResistance to pyrethroid insecticides is associated with kdr mutant haplotypes, while the absence of substantial resistance to malathion suggests that it remains a viable option for dengue vector control in Ouagadougou.

Identification of priority pathogens for aetiological diagnosis in adults with community-acquired pneumonia in China: a multicentre prospective study

BackgroundCommunity-acquired pneumonia (CAP) is a major public health challenge worldwide. However, the aetiological and disease severity-related pathogens associated with CAP in adults in China are not well established based on the detection of both viral and bacterial agents.MethodsA multicentre, prospective study was conducted involving 10 hospitals located in nine geographical regions in China from 2014 to 2019. Sputum or bronchoalveolar lavage fluid (BALF) samples were collected from each recruited CAP patient. Multiplex real-time PCR and bacteria culture methods were used to detect respiratory pathogens. The association between detected pathogens and CAP severity was evaluated.ResultsAmong the 3,403 recruited eligible patients, 462 (13.58%) had severe CAP, and the in-hospital mortality rate was 1.94% (66/3,403). At least one pathogen was detected in 2,054 (60.36%) patients, with two or more pathogens were co-detected in 725 patients. The ten major pathogens detected were Mycoplasma pneumoniae (11.05%), Haemophilus influenzae (10.67%), Klebsiella pneumoniae (10.43%), influenza A virus (9.49%), human rhinovirus (9.02%), Streptococcus pneumoniae (7.43%), Staphylococcus aureus (4.50%), adenovirus (2.94%), respiratory syncytial viruses (2.35%), and Legionella pneumophila (1.03%), which accounted for 76.06–92.52% of all positive detection results across sampling sites. Klebsiella pneumoniae (p < 0.001) and influenza viruses (p = 0.005) were more frequently detected in older patients, whereas Mycoplasma pneumoniae was more frequently detected in younger patients (p < 0.001). Infections with Klebsiella pneumoniae, Staphylococcus aureus, influenza viruses and respiratory syncytial viruses were risk factors for severe CAP.ConclusionsThe major respiratory pathogens causing CAP in adults in China were different from those in USA and European countries, which were consistent across different geographical regions over study years. Given the detection rate of pathogens and their association with severe CAP, we propose to include the ten major pathogens as priorities for clinical pathogen screening in China.

Association of NAT2, GSTT1, and GSTM1 gene polymorphisms withprostate cancer risk in Bangladeshi population

One of the leading causes of cancer-related mortality in males is prostate cancer. The latest molecular studies revealed the interconnection of genetic polymorphism of N acetyltransferase (NAT) and Glutathione-S-transferase (GST) gene in the genesis of prostate cancer. The study’s aim was to find out the association of NAT2, GSTT1, and GSTM1 gene polymorphisms with the risk of prostate cancer in the Bangladeshi population. This case-control study included 207 histopathologically diagnosed cases of prostate cancer and 200 age-matched healthy controls. After taking informed written consent, 5.0 mL of venous blood was collected to extract genomic DNA for genetic analysis of NAT2, GSTT1& GSTM1 by PCR-RFLP by multiplex PCR methods. In this study, the mean ± SD age of cases and control was 67.3 ± 8.3, and 62.2 ± 6.8 years, respectively. A higher frequency of mutant NAT2*5A, NAT2*6A, and NAT2*7A in prostate cancer cases was observed in this study, in comparison to controls. Prostate cancer risk was found considerably increased in patients with NAT2 slow genotypes, GSTT1 and GSTM1 null genotypes, compared to control. Furthermore, Prostate cancer risk was found very significantly associated with the presence of combined genotypes that included NAT2 (slow), GSTT1 (null), and GSTM1 (null), and the risk rose 9.64-fold when compared to the wild genotype for NAT2, GSTT1, and GSTM1. Again, it was observed that individuals with positive smoking history/family history of cancer along with NAT2 slow genotype had significantly increased risk for prostate cancer. Moreover, the likelihood of developing a moderate to a high-grade tumor (Gleason score 7), as well as locally progressed or metastatic prostate cancer was considerably greater in persons with NAT2 slow genotypes, GSTT1, and GSTM1 null genotypes. This study established the association of genetic polymorphisms of NAT2, GSTT1, and GSTM1 genes with prostate cancer risk in the Bangladeshi population.

Multiplex PCR detection of mackerel-based food adulteration with pleco and chicken in selected areas around Ciliwung River, Indonesia

Abstract. Widiyanti R, Nugroho HA, Megarani DV, Widiasih DA, Pakpahan S. 2023. Multiplex PCR detection of mackerel-based food adulteration with pleco and chicken in selected areas around Ciliwung River, Indonesia. Biodiversitas 24: 1538-1543. Detecting fish product adulteration is crucial to ensure food safety since pleco meat was already reported to carry several heavy metals that might harm human health. Pleco is invasive species in the Ciliwung River and is commonly used as adulteration material for fish-based products. Adulteration in mackerel-based food products may alter the nutritional value and carry heavy metal contamination from the bottom-feeder fish's meat (pleco). Therefore, using the DNA barcoding technique, a molecular approach has been used to authenticate mackerel fish products (including dumplings and otak-otak). This study aimed to develop a specific multiplex PCR method for simultaneously detecting processed products from mackerel and pleco. The sample consists of 21 processed food items initially made from mackerel. The samples were taken in the selected area around the Ciliwung River. All the samples can be amplified successfully, and amplification lengths were 108, 171, and 300 bp, respectively. Analysis from various claimed mackerel products showed that five samples were positive for pleco adulteration, and 11 products contained chicken meat addition. The phylogenetic tree was constructed from selected sequences from our samples and showed that the amplicons were clustered in three clades, mackerel (Scomberomorus), pleco (Pterygoplichthys), and chicken (Gallus gallusLinnaeus, 1758). The findings of this study revealed that 23.80% (5/21) products contained pleco, and 52.38% (11/21) contained chicken meat addition. The addition of an unusual component to food composition may alter nutritional value as well as may affect food hygiene and safety.

Novel Multiplex PCR Assay and Its Application in Detecting Prevalence and Antibiotic Susceptibility of Porcine Respiratory Bacterial Pathogens in Guangxi, China.

Porcine respiratory disease complex (PRDC) is a serious disease caused by multiple pathogens which inflicts huge economic losses on the pig industry. Investigating the epidemiology of porcine respiratory bacterial pathogens (PRBPs) in specific geographic areas and exploring the antibiotic susceptibility of local strains will contribute to the prevention and control of PRDC. However, the epidemiology of PRBPs in Guangxi Province remains unclear, and existing diagnostic methods have multiple limitations, such as high costs and the detection of only a single pathogen at a time. In this study, we developed a multiplex PCR assay for Streptococcus suis, Glaesserella parasuis, Actinobacillus pleuropneumoniae, Pasteurella multocida, and Mycoplasma hyopneumoniae, and investigated the prevalence of PRBPs in pigs with respiratory symptoms in Guangxi Province. The isolates from positive samples were subjected to susceptibility tests to 16 antibiotics. Our results indicated that of the 664 samples from pigs with respiratory symptoms, 433 (65.21%), 320 (48.19%), 282 (42.47%), 23 (3.46%), and 9 (1.36%), respectively, carried each of these 5 pathogens; 533 samples were positive; and 377 (56.78%) carried multiple pathogens simultaneously. The dominant PRBPs in pigs with respiratory symptoms in Guangxi province were S. suis, G. parasuis, and A. pleuropneumoniae, which frequently co-infected swine herds. Most of the isolates (A. pleuropneumoniae, G. parasuis, S. suis, and P. multocida) were sensitive to cefquinome, ceftiofur, trimethoprim-sulfamethoxazole (TMP-SMX), and tiamulin antibiotics. We developed a rapid specific multiplex PCR assay for PRBPs. Our findings provide new information on the epidemiology of PRBPs in Guangxi Province and offer a reference for developing drug targets against PRDC. IMPORTANCE Pigs are closely associated with humans as the most common food animals and the vectors of numerous pathogens. PRDC, caused by multiple pathogens, is a serious disease that can cause growth retardation in swine and even sudden death. Due to the droplet transmission of PRBP and the similar clinical signs of different pathogen infections, most pig farms struggle to identify and control PRBPs, leading to the abuse of antibiotics. In addition, some PRBPs have the potential to infect humans and threaten human health. Therefore, this study developed a multiplex PCR method targeting PRBPs, investigated the prevalence of these pathogens, and tested their antibiotic susceptibility. Our studies have important implications for public health safety and the development of the pig industry.