Multiple Primer Pairs Research Articles

Searching for Alternatively Spliced Variants of Phospholipase Domain-Containing 2 (Pnpla2), a Novel Gene in the Retina

Ensembl and other expressed sequence tag (EST) databases reveal putative alternative splice variants in mouse and rat for Pnpla2, the gene encoding pigment epithelium-derived factor-receptor (PEDF-R). The purpose of this study was to obtain experimental evidence for Pnpla2 splice variants in mouse. Cultures of a mouse cell line derived from photoreceptors (661W cells) and mouse eye, heart, adipose, kidney, and liver tissues were used. Messenger RNA (mRNA) was isolated from cells and tissues, and complementary DNA (cDNA) was synthesized. Polymerase chain reaction (PCR) primer pairs were designed to flank the putative splice sites. Exon exclusion real time PCR was used to reduce amplification of the full-length Pnpla2 transcript and enhance amplification of low abundant splice variants. PCR products were resolved by agarose gel electrophoresis and detected with a UV transilluminator. Recombinant plasmids containing a human full-length PNPLA2 cDNA or a PNPLA2 cDNA lacking exon 5b (E5b) were controls to validate the techniques. Total cell lysates from 661W cells were prepared. PEDF-R protein detection was performed using western blots. PCR products for Pnpla2 transcripts obtained from 661W cells or various mouse tissues resolved into a single band following amplification with multiple primer pairs. Simultaneous amplification of two PNPLA2 cDNAs at various molar ratios prevented the detection of lower abundant transcripts. However, even when the cDNA for the full-length Pnpla2 transcript was significantly excluded using the exon exclusion method, no bands corresponding to Pnpla2 splice variants were detectable. Nonetheless, western blots of total 661W cell lysates with two different antibodies revealed isoforms for the PEDF-R protein. The data provide evidence for the existence of a single, full-length Pnpla2 transcript that could give rise to a single protein product that undergoes posttranslational processing.

Zygosity Determination in Hairless Mice by PCR Based on <i>Hr<sup>hr</sup></i> Gene Analysis

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hrhr allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hrhr in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hrhr allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hrhr (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hrhr gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.

Identification and differentiation of the twenty six bluetongue virus serotypes by RT-PCR amplification of the serotype-specific genome segment 2.

Bluetongue (BT) is an arthropod-borne viral disease, which primarily affects ruminants in tropical and temperate regions of the world. Twenty six bluetongue virus (BTV) serotypes have been recognised worldwide, including nine from Europe and fifteen in the United States. Identification of BTV serotype is important for vaccination programmes and for BTV epidemiology studies. Traditional typing methods (virus isolation and serum or virus neutralisation tests (SNT or VNT)) are slow (taking weeks, depend on availability of reference virus-strains or antisera) and can be inconclusive. Nucleotide sequence analyses and phylogenetic comparisons of genome segment 2 (Seg-2) encoding BTV outer-capsid protein VP2 (the primary determinant of virus serotype) were completed for reference strains of BTV-1 to 26, as well as multiple additional isolates from different geographic and temporal origins. The resulting Seg-2 database has been used to develop rapid (within 24 h) and reliable RT–PCR-based typing assays for each BTV type. Multiple primer-pairs (at least three designed for each serotype) were widely tested, providing an initial identification of serotype by amplification of a cDNA product of the expected size. Serotype was confirmed by sequencing of the cDNA amplicons and phylogenetic comparisons to previously characterised reference strains. The results from RT-PCR and sequencing were in perfect agreement with VNT for reference strains of all 26 BTV serotypes, as well as the field isolates tested. The serotype-specific primers showed no cross-amplification with reference strains of the remaining 25 serotypes, or multiple other isolates of the more closely related heterologous BTV types. The primers and RT–PCR assays developed in this study provide a rapid, sensitive and reliable method for the identification and differentiation of the twenty-six BTV serotypes, and will be updated periodically to maintain their relevance to current BTV distribution and epidemiology (http://www.reoviridae.org/dsRNA_virus_proteins/ReoID/rt-pcr-primers.htm).

Application of Bio-Cell Chip Technology to Rapid Genomic DNA Preparation and PCR Amplification.

Abstract 4197 BackgroundThough primary cells obtained from patients are necessary to scientists, it has been problems that their amount is not sufficient to perform various assays and that the cell specimens are often impaired, or their constituents or products are destroyed during the transport to the scientists. To address these problems, we developed a bio-cell chip, a chip having hundreds kind of cells arrayed and immobilized on a small slide. We arrayed the cells in a tiny space by spotting them onto a supporting matrix, so that hundreds of assays can be conducted with only a small amount of sample and several hundreds kinds of samples can be assayed under the same condition. We developed the direct extraction of DNA from bio-cell chip and successfully amplified the extracted DNA. Here, we introduce simple and convenient method of DNA extraction utilizing bio-cell chip, which can handle hundreds of specimen at one time. MethodsPeripheral blood anticoagulated with EDTA or sodium citrate were centrifuged at 2000 rpm for 20 minutes, and leukocyte layers were transferred to 1.5 ml tube by careful pipetting. Buffy coats are adjusted to the cell count of 1,000 cells/ μl to 10,000 cells/ μl with Phosphate Buffered Saline. One microliter of cell suspension are loaded onto each of 92 well bio cell-chip and air-dried. To investigate the duration of DNA stability of cells loaded on bio cell-chip, loaded bio cell-chip were stored at room temperature for 5day, 15day, and 1 month before DNA extraction. Cell-chip preparation was done as previously published. Briefly, the substrate for the bio cell-chip was a slide glass on which a 1 mm thick perforated poly- dimethylsiloxane (PDMS) layer was bonded to form 16×6 wells array for subsequent cell seeding. Each cylindrical shape with 1.5 mm in diameter and positioned within a lattice pattern with its own indexing number printed on the slide glass. Maximum volume that can be loaded in each cylinder was 10ul. For DNA extraction, 2 ul of BR-A buffer (GenScript BloodReadyTMMultiplex PCR System) was dropped onto each of the wells of bio-cell chip and dried cells in the bottom of wells were mixed with BR-A buffer solution thoroughly by pipetting up and down for 10-15 times. Then, BR-A buffer additionally dropped into each well up to 20ul volume finally and mixed well. One or multiple gene targets can be amplified using a pair of primers or multiple pairs of primers from the mixture of buffer with cells without DNA purification. Then, PCR Amplification was carried out using the MJ Research DNA thermal cycler programmed to denature DNA at 95°C for 30s, and 40cycles of annealing at 62°C and extension at 72°C for 30sec in a 20μl mixture containing 1U BioTherm‘DNA Polymerase (Genecraft, GERMANY), 1μl(10pM/ul) of each oligonucleotide primer, 2.5mM dNTP, and genomic DNA. Results and conclusionThe PCR amplification results were successful using BioTherm‘DNA Polymerase. When we carried out PCR amplification using the PCR Premix (BloodReadyTM PCR System), we had no PCR products. The target PCR products were observed from genomic DNA sample with above 100 cells. Also, PCR amplification for genomic DNA from stored cell for 5day, 15 day, and 1 month was successful. With this extraction method, PCR was successful and not only minimize the simplification of experimental procedure but also save the time. Disclosures:No relevant conflicts of interest to declare.

From extensive clone libraries to comprehensive DNA arrays for the efficient and simultaneous detection and identification of orchid mycorrhizal fungi

A DNA array was developed from extensive clone library sequence data sets for the assessment of dominant members of mycorrhizal fungi that associate with terrestrial orchid species. As a-proof-of-concept, the array was developed for the basidiomycetous mycorrhizal partners from three closely related perennial Orchis species, including Orchis anthropophora, O. militaris and O. purpurea. Based on internal transcribed spacer regions, oligonucleotides were developed for seven operational taxonomic units (OTUs; defined as groups of sequences sharing at least 97% sequence similarity), corresponding to members of the Tulasnellaceae family. In order to cover a broader spectrum of tulasnelloid fungi, oligonucleotides were as well developed for two subsets of closely related OTUs. The array was evaluated using multiple primer pairs. In addition, hybridization results were validated by recovery and sequencing of the hybridized amplicons as well as by hybridizing reference DNA samples. Considering the unlimited expansion possibilities of DNA arrays to include specific detector oligonucleotides for other and more microorganisms, the method described here has the major advantage that it provides a powerful, rapid and cost-effective way for the simultaneous detection and identification of a wide range of orchid mycorrhizae. The design, development and advantages of the array are discussed in relation to its potential for future research in mycorrhizal ecology.

Quantitative detection of PML‐RARα fusion transcript by real‐time PCR with a single primer pair

Quantitative detection of minimal residual disease has prognostic value for some leukemias. Acute promyelocytic leukemia (APL) is characterized by the specific PML-RARalpha fusion gene from t(15;17). Added to three PML-RARalpha isoforms, alternative spliced forms of PML exons give rise to multiple isoforms even within a single patient. To date, multiple primer pairs for the detection of the various PML-RARalpha transcripts have been designed, potentially generating some nonspecific amplification products. Here, we established a real-time quantitative PCR (RQ-PCR) strategy with a single primer pair using LightCycler (sp-RQ-PCR), which could simultaneously detect three isoforms with equal specificity and sensitivity as well as alternative spliced forms. Results obtained with sp-RQ-PCR for 39 samples from 15 APL patients and 31 non-APL samples were compared with those with TaqMan assay with three primer pairs. In two of the APL samples, PML-RARalpha was detected in the TM, but not in the sp-RQ-PCR or nested PCR. Furthermore, the sp-RQ-PCR showed no positive results for the 31 non-APL samples, whereas the TM identified 13% (4/31) as positive. Electrophoresis detected some artifacts in the TM, which do not correspond to PML-RARalpha. We conclude that our sp-RQ-PCR is specific enough to identify various forms of PML-RARalpha and yields no false-positive results.

PROBER: oligonucleotide FISH probe design software

PROBER is an oligonucleotide primer design software application that designs multiple primer pairs for generating PCR probes useful for fluorescence in situ hybridization (FISH). PROBER generates Tiling Oligonucleotide Probes (TOPs) by masking repetitive genomic sequences and delineating essentially unique regions that can be amplified to yield small (100-2000 bp) DNA probes that in aggregate will generate a single, strong fluorescent signal for regions as small as a single gene. TOPs are an alternative to bacterial artificial chromosomes (BACs) that are commonly used for FISH but may be unstable, unavailable, chimeric, or non-specific to small (10-100 kb) genomic regions. PROBER can be applied to any genomic locus, with the limitation that the locus must contain at least 10 kb of essentially unique blocks. To test the software, we designed a number of probes for genomic amplifications and hemizygous deletions that were initially detected by Representational Oligonucleotide Microarray Analysis of breast cancer tumors. http://prober.cshl.edu

Multiplexed tandem PCR: gene profiling from small amounts of RNA using SYBR Green detection

Multiplexed tandem PCR (MT-PCR) is a process for highly multiplexed gene expression profiling. In the first step, multiple primer pairs are added to the RNA to be analysed together with reverse transcriptase and Taq DNA polymerase. Following reverse transcription, the multiplexed amplicons are simultaneously amplified for a small number of cycles so as to avoid competition between amplicons. The reaction product is then diluted and analysed in multiple individual PCRs using primers nested inside the primers used for the multiplexed amplification. As the second PCR uses a template enriched in the amplicons of interest, the conditions can be optimized to significantly reduce ‘primer dimer’ formation allowing SYBR Green chemistry to be used for quantification. MT-PCR can be configured for as little as 10 pg RNA (equivalent to a single mammalian cell) and works well with RNA extracted from archival formalin-fixed paraffin-embedded sections. We illustrate MT-PCR with gene expression profiles of breast cancer cell lines.

An intelligent primer design system for multiplex reverse transcription polymerase chain reaction and complementary DNA microarray

Various biological and clinical applications require the quantification of the messenger RNA (mRNA) abundance of the biological materials under investigation. Reverse transcription-polymerase chain reaction (RT-PCR) is a popular technique for mRNA quantification. However, in these applications, multiple quantifications of mRNA are required from the same sample. Multiplex RT-PCR uses multiple primer pairs to amplify the specific targets simultaneously from a single sample. Therefore, multiplex RT-PCR is suitable for such applications. Complementary DNA (cDNA) microarray is a robust and versatile tool that allows researchers to examine the expression of hundreds or thousands of genes for the analysis of gene function, disease diagnosis, and drug discovery. Multiplex RT-PCR is usually performed for the cDNA preparation during the cDNA microarray experiments. Primer design is the most crucial step in multiplex RT-PCR. Therefore, the goal of this study was to implement an intelligent primer design system. The core of the system was based on mathematical techniques. The system can guide users to design cost effective primer collection. The system had also been successfully applied to two real world examples with biological and clinical significance.

A novel sequence-based approach to localize translocation breakpoints identifies the molecular basis of a t(4;22).

Low copy repeats (LCRs) located in 22q11.2, especially LCR-B, are susceptible to rearrangements associated with several relatively common constitutional disorders. These include DiGeorge syndrome, Velocardiofacial syndrome, Cat-eye syndrome and recurrent translocations of 22q11 including the constitutional t(11;22) and t(17;22). The presence of palindromic AT-rich repeats (PATRRs) within LCR-B of 22q11.2, as well as within the 11q23 and 17q11 regions, has suggested a palindrome-mediated, stem-loop mechanism for the generation of such recurring constitutional 22q11.2 translocations. The mechanism responsible for non-recurrent 22q11.2 rearrangements is presently unknown due to the extensive effort required for breakpoint cloning. Thus, we have developed a novel fluorescence in-situ hybridization and primed in-situ hybridization (PRINS) approach and rapidly localized the breakpoint of a non-recurrent 22q11.2 translocation, a t(4;22). Multiple primer pairs were designed from the sequence of a 200 kb, chromosome 4, breakpoint-spanning BAC to generate PRINS probes. Amplification of adjacent primer pairs, labeled in two colors, allowed us to narrow the 4q35.1 breakpoint to a 6.7 kb clonable region. Application of our improved PRINS protocol facilitated fine-mapping the translocation breakpoints within 4q35.1 and 22q11.2, and permitted rapid cloning and analysis of translocation junction fragments. To confirm the PRINS localization results, PCR mapping of t(4;22) somatic cell hybrid DNA was employed. Analysis of the breakpoints demonstrates the presence of a 554 bp palindromic sequence at the chromosome 4 breakpoint and a 22q11.2 location within the same PATRR as the recurrent t(11;22) and t(17;22). The sequence of this breakpoint further suggests that a stem-loop secondary structure mechanism is responsible for the formation of other, non-recurrent translocations involving LCR-B of 22q11.2.

Conservation of the 17-kilodalton antigen gene within the genus Bartonella.

The 17-kDa antigen of Bartonella henselae has previously been shown to elicit a strong humoral immune response in patients with cat scratch disease (CSD) and to be useful in screening human serum samples for CSD. In this study, PCR amplification of genes homologous to the 17-kDa antigen gene of B. henselae was performed using genomic DNAs from several species of Bartonella, including the currently recognized human pathogens. Amplicons of similar size were demonstrated using the following chromosomal DNA templates: B. henselae (two strains), B. quintana (two strains), B. elizabethae, B. clarridgeiae, B. vinsonii subsp. vinsonii, and B. vinsonii subsp. berkhoffii. No evidence of a B. bacilliformis homolog of the 17-kDa antigen gene was obtained using multiple primer pairs. DNA sequencing revealed open reading frames capable of coding for proteins with sizes similar to that of the 17-kDa antigen of B. henselae in all of the amplicons; however, extensive sequence divergence across the genus was noted. Cloning of the amplified products into pUC19 resulted in recombinants that directed synthesis of homologs of the 17-kDa protein. Immunoblot analysis using human sera from CSD cases demonstrated very little cross-reactivity among different species for this protein. In contrast, immunoblots using rabbit serum raised to the recombinant B. henselae antigen showed extensive cross-reactivity with the proteins of other Bartonella species. The data suggest that the use of the 17-kDa antigen as a serologic reagent may allow the development of more specific diagnostic assays. Furthermore, the nucleotide sequences from the various versions of the 17-kDa antigen gene should be useful for rapid identification of Bartonella at the species level.

Diagnosis of plague and identification of virulence markers in Yersinia pestis by multiplex-PCR.

We have developed a procedure for the rapid diagnosis of plague that also allows the identification of prominent virulence markers of Y. pestis strains. This procedure is based upon the use of a single polymerase chain reaction with multiple pairs of primers directed at genes present in the three virulence plasmids as well as in the chromosomal pathogenicity island of the bacterium. The technique allowed the discrimination of strains which lacked one or more of the known pathogenic loci, using as template total DNA obtained from bacterial cultures and from simulated blood cultures containing diluted concentration of bacteria. It also proved effective in confirming the disease in a blood culture from a plague suspected patient. As the results are obtained in a few hours this technique will be useful in the methodology of the Plague Control Program.

Molecular biology and electrophysiology of calcium-activated potassium channels from lens epithelium

PURPOSE. We structurally and functionally characterized the a and ß subunits of the human lens epithelium Ca ++ -activated potassium channel (BK). METHODS. The two subunits were sequenced following RT-PCR with multiple primer pairs. The subunits were cloned using a PCR approach and were expressed in tsA-201 cells for patch clamp recording. Green fluorescence protein-channel subunit fusion proteins were characterized by patch clamping and were imaged by fluorescence microscopy. RESULTS. Alpha subunits alone make a large single-channel conductance, potassium-selective channel with modest Ca ++ sensitivity. Beta subunits alone make no channel but, when coexpressed with the a subunit, make a channel with increased Ca ++ sensitivity, although still less than for natural channels of this type. GFP-BK subunit fusion proteins continue to function and result in a fluorescing channel, which can be localized by fluorescence microscopy. The a subunit codes for a "minimal" BK channel in that none of its potential alternative splicing sites contains an "extra" exon. CONCLUSIONS. The Ca ++ -activated potassium channel known as BK has the nucleotide sequences of its a and ß subunits represented in messenger RNA of cultured human lens epithelium. It is the first identified channel, to date, which imparts internal Ca ++ dependence to lens epithelial potassium conductance.

Application of PCR to detect Norwalk virus in fecal specimens from outbreaks of gastroenteritis.

Norwalk virus (NV) and other small round-structured viruses (SRSVs) are frequent causes of gastroenteritis outbreaks. The recent cloning and sequencing of the NV genome has made it possible to detect NV and Norwalk-related viruses from fecal specimens by reverse transcription (RT)-PCR. We applied this technique to the examination of a total of 139 fecal specimens from 19 outbreaks characterized by NV serology, including 56 samples from 7 NV outbreaks, 36 from 6 Norwalk-related virus outbreaks, and 47 from 6 outbreaks with SRSVs visualized by electron microscopy that were serologically unrelated to NV. Three primer pairs were evaluated: two pairs in the polymerase region of NV and one pair near the 3' end of the genome. When one set of primers (primer pair 51-3) from the polymerase region was used, 40% of all samples were positive by RT-PCR and specimens from the NV outbreaks were more likely to be positive (64%) than those from outbreaks associated with Norwalk-related viruses (44%) or SRSVs (8%). To determine the relationship of the outbreak strains to NV, we compared the sequences of a 145-base portion of the polymerase gene from 10 specimens obtained from five different outbreaks characterized as NV by serology. No two outbreak strains had the same sequence in this 145-base portion of the polymerase gene, and the identities of the nucleotide and amino acid sequences of these products compared with the sequences of the corresponding region of NV ranged from 62 to 79% and 69 to 90%, respectively. Because of sequence diversity in the polymerase region, the successful application of RT-PCR to investigations of outbreaks of suspected NV-associated gastroenteritis will depend on the use of either multiple primer pairs or primers made against regions of the genome that are more conserved.

Concordance of Polymerase Chain Reaction with Human Immunodeficiency Virus Antibody Detection

To evaluate the correlation of detection of human immunodeficiency virus (HIV) by polymerase chain reaction (PCR) with detection of HIV antibody, 271 simultaneous serum and peripheral blood mononuclear cell samples were examined from 242 persons whose activities placed them at increased risk for HIV infection: 142 from homosexual men, 86 from hemophilic men, and 43 from heterosexual partners of HIV-infected persons. PCR was performed using the gag region primer pair SK38/39 and the env region primer pairs SK68/69 and CO71/72. Amplified HIV DNA was detected using specific oligomer probes. Of 63 HIV antibody-positive samples, 58 (92%) had HIV DNA by PCR. Of 208 HIV antibody-negative samples, 7 (3.4%) had HIV DNA by PCR. On follow-up, 4 of the latter persons were seropositive when next tested; 2 were well and antibody- and PCR-negative; 1 had died of a stroke before retesting. Thus, PCR detects HIV in most antibody-positive persons; detection is increased by use of multiple primer pairs. PCR-positive antibody-negative specimens may indicate HIV infection in which antibody has not yet developed or may be false-positive PCR results. When PCR is discordant with HIV antibody, testing of additional specimens and clinical follow-up are necessary to assess HIV infection status.