Multiple mtDNA Deletions Research Articles

Mitochondrial DNA polymerase-γ and human disease

The maintenance of mitochondrial DNA (mtDNA) is critically dependent upon polymerase-gamma (pol-gamma), encoded by the nuclear gene POLG. Over the last 5 years, it has become clear that mutations of POLG are a major cause of human disease. Secondary mtDNA defects characterize these disorders, with mtDNA depletion, multiple mtDNA deletions or multiple point mutations of mtDNA in clinically affected tissues. The secondary mtDNA defects cause cell and tissue-specific deficiencies of mitochondrial oxidative phosphorylation, leading to organ dysfunction and human disease. Functional genetic variants of POLG are present in up to approximately 0.5% of the general population, and pathogenic mutations have been described in most exons of the gene. Clinically, POLG mutations can present from early neonatal life to late middle age, with a spectrum of phenotypes that includes common neurological disorders such as migraine, epilepsy and Parkinsonism. Transgenic mice and biochemical studies of recombinant mutated proteins are helping to unravel mechanisms of pathogenesis, and patterns are beginning to emerge relating genotype to phenotype.

Molecular bases of hearing loss in multi-systemic mitochondrial cytopathy

Purpose: Hearing loss is a common clinical feature in classic mitochondrial syndromes. The purpose of this study was to evaluate the diverse molecular etiologies and natural history of hearing loss in multi-systemic mitochondrial cytopathies and the possible correlation between degree of hearing loss and neurological phenotype.Methods: In this retrospective study we evaluated the clinical features and molecular bases of hearing loss associated with multi-systemic mitochondrial cytopathy. Forty-five patients with sensorineural hearing loss and definite diagnosis of mitochondrial cytopathy according to the published diagnostic criteria were studied.Results: The sensorineural hearing loss was progressive and for the most part symmetrical with involvement of the higher frequencies. Both cochlear and retrocochlear involvement were found in this cohort. No correlation was found between the degree of hearing loss and the number and severity of neurological manifestations. Deleterious mtDNA point mutations of undisputed pathogenicity were identified in 18 patients. The A3243G mutation was the most frequently encountered among this group. MtDNA depletion, over-replication, and multiple deletions were found in further 11 cases.Conclusion: This study reveals an expanding spectrum of mtDNA abnormalities associated with hearing loss. No correlation was found between the degrees of hearing loss and the severity of neurological manifestations.

Neurophysiological and mitochondrial abnormalities in MuSK antibody seropositive myasthenia gravis compared to other immunological subtypes

ObjectiveTo compare the electrophysiological and histopathological features of immunological myasthenia gravis (MG) subtypes. MethodsFifty MG patients underwent clinical examination, MuSK-Ab and AChR-Ab analysis. The majority underwent quantitative and single-fiber electromyography (QEMG, SFEMG), repetitive nerve stimulation and deltoid muscle biopsy. From muscle specimens with histological mitochondrial dysfunction, we amplified mitochondrial DNA (mtDNA). In specimens with mtDNA deletions, the nuclear gene POLG1 was sequenced. ResultsFive AChR-Ab seropositive [AChR(+)] and 5 seronegative [AChR(−)] patients were MuSK-Ab seropositive [MuSK(+)]. Five of 7 neurophysiologically examined MuSK(+) patients (71%) had proximal myopathic pattern, compared to 7 of 31 MuSK(−)/AChR(+) patients (23%) (P=0.012). SFEMG was abnormal in all examined MuSK(+) patients. All 7 biopsied MuSK(+) and 32 MuSK(−) patients (89%) had cytochrome c oxidase (COX) negative fibers. Three of five MuSK(+) and 13 of 20 MuSK(−) patients analyzed had multiple mtDNA deletions but no POLG1 mutations. ConclusionsSimilar degree of SFEMG abnormalities was present in proximal muscles among MuSK(+) and AChR(+) patients. Proximal myopathy was over-represented in MuSK(+) patients; however, both MuSK(+) and MuSK(−) patients had mild myopathy with frequent mitochondrial abnormalities. SignificanceThe weakness in MuSK(+) patients is most likely due to disturbed neuromuscular transmission. The frequently encountered mitochondrial dysfunction in MG warrants further study.

Mutant POLG2 Disrupts DNA Polymerase γ Subunits and Causes Progressive External Ophthalmoplegia

DNA polymerase gamma (pol gamma ) is required to maintain the genetic integrity of the 16,569-bp human mitochondrial genome (mtDNA). Mutation of the nuclear gene for the catalytic subunit of pol gamma (POLG) has been linked to a wide range of mitochondrial diseases involving mutation, deletion, and depletion of mtDNA. We describe a heterozygous dominant mutation (c.1352G-->A/p.G451E) in POLG2, the gene encoding the p55 accessory subunit of pol gamma , that causes progressive external ophthalmoplegia with multiple mtDNA deletions and cytochrome c oxidase (COX)-deficient muscle fibers. Biochemical characterization of purified, recombinant G451E-substituted p55 protein in vitro revealed incomplete stimulation of the catalytic subunit due to compromised subunit interaction. Although G451E p55 retains a wild-type ability to bind DNA, it fails to enhance the DNA-binding strength of the p140-p55 complex. In vivo, the disease most likely arises through haplotype insufficiency or heterodimerization of the mutated and wild-type proteins, which promote mtDNA deletions by stalling the DNA replication fork. The progressive accumulation of mtDNA deletions causes COX deficiency in muscle fibers and results in the clinical phenotype.

A new POLG1 mutation with peo and severe axonal and demyelinating sensory–motor neuropathy

Progressive external ophthalmoplegia (PEO) is a mitochondrial disorder associated with defective enzymatic activities of oxidative phosphorylation (OXPHOS), depletion of mitochondrial DNA (mtDNA) and/or accumulation of mtDNA mutations and deletions. Recent positional cloning studies have linked the disease to four different chromosomal loci. Mutations in POLG1 are a frequent cause of this disorder. We describe two first-cousins: the propositus presented with PEO,mitochondrial myopathy and neuropathy, whereas his cousin showed a Charcot- Marie-Tooth phenotype. Neurophysiological studies, peroneal muscle and sural nerve biopsies, and molecular studies of mtDNA maintenance genes (ANT1, Twinkle, POLG1, TP) and non dominant CMT-related genes (GDAP1, LMNA, GJB1) were performed. A severe axonal degeneration was found in both patients whereas hypomyelination was observed only in the patient with PEO whose muscle biopsy specimen also showed defective OXPHOS and multiple mtDNA deletions. While no pathogenetic mutations in GDAP1, LMNA, and GJB1 were found, we identified a novel homozygous POLG1 mutation (G763R) in the PEO patient. The mutation was heterozygous in his healthy relatives and in his affected cousin. A homozygous POLG1 mutation might explain PEO with mitochondrial abnormalities in skeletal muscle in our propositus, and it might have aggravated his axonal and hypomyelinating sensory-motor neuropathy. Most likely, his cousin had an axonal polyneuropathy with CMT phenotype of still unknown etiology.

Auditory neuropathy in a patient with mitochondrial myopathy and multiple mtDNA deletions

Auditory neuropathy (AN) is a hearing disorder characterized by the absence or severe distortion of the auditory brainstem responses, in the presence of preserved otoacoustic emissions. This peculiar combination suggests the presence of a defect impinging upon the functional complex formed by inner hair cells, the primary afferents (spiral ganglion neurones) and the first order synapses between hair cells and the cochlear nerve. Typically, AN patients show a severe speech perception impairment, which appears reduced out of proportion to pure tone threshold, but the clinical presentation of AN is quite complex. Hearing loss is a common symptom associated with mitochondrial diseases; however, AN has only rarely been reported in these disorders. Here we report a rare association, the first case observed in Italy, in a patient with autosomal recessive mitochondrial myopathy and mitochondrial DNA multiple deletions, and a hearing deficit with the audiological and electrophysiological features of AN.

Mitochondrial Neurogastrointestinal Encephalomyopathy: Evidence of Mitochondrial DNA Depletion in the Small Intestine

Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is an autosomal recessive disease clinically defined by gastrointestinal dysmotility, cachexia, ptosis, ophthalmoparesis, peripheral neuropathy, white-matter changes in brain magnetic resonance imaging, and mitochondrial abnormalities. Loss-of-function mutations in thymidine phosphorylase gene induce pathologic accumulations of thymidine and deoxyuridine that in turn cause mitochondrial DNA (mtDNA) defects (depletion, multiple deletions, and point mutations). Our study is aimed to define the molecular basis of gastrointestinal dysmotility in a case of MNGIE. By using laser capture microdissection techniques, we correlated histologic features with mtDNA abnormalities in different tissue components of the gastrointestinal wall in a MNGIE patient and ten controls. The patient's small intestine showed marked atrophy and mitochondrial proliferation of the external layer of muscularis propria. Genetic analysis revealed selective depletion of mtDNA in the small intestine compared with esophagus, stomach, and colon, and microdissection analysis revealed that mtDNA depletion was confined to the external layer of muscularis propria. Multiple deletions were detected in the upper esophagus and skeletal muscle. Site-specific somatic point mutations were detected only at low abundance both in the muscle and nervous tissue of the gastrointestinal tract. Analysis of the gastrointestinal tract from 10 controls revealed a non-homogeneous distribution of mtDNA content; the small intestine had the lowest levels of mtDNA. Atrophy, mitochondrial proliferation, and mtDNA depletion in the external layer of muscularis propria of small intestine indicate that visceral myopathy is responsible for gastrointestinal dysmotility in this MNGIE patient.

Association of Novel POLGMutations and Multiple Mitochondrial DNA Deletions With Variable Clinical Phenotypes in a Spanish Population

Both dominant and recessive mutations were reported in the gene encoding the mitochondrial (mt) DNA polymerase gamma (POLG) in patients with progressive external ophthalmoplegia (PEO). Phenotypes other than PEO were recently documented in patients with mutations in the POLG gene. To screen patients with mitochondrial disease and multiple mtDNA deletions in muscle for mutations in the coding regions of the POLG, PEO1, and SLC25A4 genes. To identify the underlying molecular defect in a group of patients with multiple mtDNA deletions comparing their molecular genetic findings with those of healthy controls. Twenty-four patients (16 men and 8 women) diagnosed with mitochondrial disease and having multiple mtDNA deletions in muscle by Southern blot analysis. Thirteen patients had PEO; 2 had PEO alone, 4 had PEO and myopathy, and 5 had PEO and multisystem involvement. Four patients had multisystem disease without PEO. The remaining 9 patients had isolated myopathy. DNA from 100 healthy individuals was also studied. No mutation was identified in the PEO1 or SLC25A4 genes. Nine POLG mutations were observed in 6 of 24 patients. Four novel mutations were detected and mapped in the linker region (M603L) and in the pol domain of the enzyme (R853W; D1184N; R1146C). Five patients with PEO had mutations: 2 were compound heterozygotes, 1 was homozygous, and another showed a mutation in a single allele. The remaining patient also showed a sole mutation and had an unusual phenotype lacking ocular involvement. POLG molecular defects were found in 25% of our patients with multiple mtDNA deletions and mitochondrial disease. The uncommon phenotype found in 1 of these patients stresses the clinical variability of patients harboring POLG mutations. Molecular studies in the POLG gene should be addressed in patients with mitochondrial disease, particularly in those with PEO, and multiple mtDNA deletions.

Multiple mtDNA deletions with clinical features resembling MNGIE: a combined MRT/MRS and FDG-PET study

Multiple mtDNA deletions with clinical features resembling MNGIE: a combined MRT/MRS and FDG-PET study

Mitochondrial abnormalities in inclusion-body myositis

Mitochondrial changes are frequently encountered in sporadic inclusion-body myositis (s-IBM). Cytochrome c oxidase (COX)-deficient muscle fibers and large-scale mitochondrial DNA (mtDNA) deletions are more frequent in s-IBM than in age-matched controls. COX deficient muscle fibers are due to clonal expansion of mtDNA deletions and point mutations in segments of muscle fibers. Such segments range from 75 microm to more than 1,000 microm in length. Clonal expansion of the 4977 bp "common deletion" is a frequent cause of COX deficient muscle fiber segments, but many other deletions also occur. The deletion breakpoints cluster in a few regions that are similar to what is found in human mtDNA deletions in general. Analysis in s-IBM patients of three nuclear genes associated with multiple mtDNA deletions, POLG1, ANT1 and C10orf2, failed to demonstrate any mutations. In s-IBM patients with high number of COX-deficient fibers, the impaired mitochondrial function probably contribute to muscle weakness and wasting. Treatment that has positive effects in mitochondrial myopathies may be tried also in s-IBM.

Mutant mitochondrial helicase Twinkle causes multiple mtDNA deletions and a late-onset mitochondrial disease in mice

Defects of mitochondrial DNA (mtDNA) maintenance have recently been associated with inherited neurodegenerative and muscle diseases and the aging process. Twinkle is a nuclear-encoded mtDNA helicase, dominant mutations of which cause adult-onset progressive external ophthalmoplegia (PEO) with multiple mtDNA deletions. We have generated transgenic mice expressing mouse Twinkle with PEO patient mutations. Multiple mtDNA deletions accumulate in the tissues of these mice, resulting in progressive respiratory dysfunction and chronic late-onset mitochondrial disease starting at 1 year of age. The muscles of the mice faithfully replicate all of the key histological, genetic, and biochemical features of PEO patients. Furthermore, the mice have progressive deficiency of cytochrome c oxidase in distinct neuronal populations. These "deletor" mice do not, however, show premature aging, indicating that subtle accumulation of mtDNA deletions and progressive respiratory chain dysfunction are not sufficient to accelerate aging. This model is a valuable tool for therapy development and testing for adult-onset mitochondrial disorders.

Simultaneous Detection and Quantification of Mitochondrial DNA Deletion(s), Depletion, and Over-Replication in Patients with Mitochondrial Disease

Heterogeneous clinical expression of mitochondrial DNA (mtDNA) disorders depends on both qualitative and quantitative changes in mtDNA. We developed a sensitive and effective method that simultaneously detects mtDNA deletion(s) and quantifies total mtDNA content. The percentage of deletions and mtDNA content of 19 patients with single or multiple deletions were analyzed by real-time quantitative polymerase chain reaction (real-time qPCR) using TaqMan probes specific for mtDNA (tRNA leu(UUR), ND4, ATPase8, and D-loop regions) and nuclear DNA (AIB1, beta-2-microglobulin, and beta-actin). The proportion of deletion mutants determined by real-time qPCR was consistent with that determined by Southern analysis. Most patients with mtDNA deletions also demonstrated compensatory mtDNA over-replication. Multiple mtDNA deletions that were not detectable by Southern analysis due to low percentage of each deletion molecule were readily detected and quantified by real-time qPCR. Furthermore, 12 patients with clinical features and abnormal biochemical/histopathological results consistent with mitochondrial respiratory chain disorders without identified mtDNA mutations had either substantially depleted or significantly over-replicated mtDNA content, supporting the diagnosis of mitochondrial disease. Our results demonstrate that both qualitative and quantitative analyses are important in molecular diagnosis of mitochondrial diseases. The presence of deletion(s) and mtDNA depletion or compensatory over-replication can be determined simultaneously by real-time qPCR.

Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE

We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP).

Infantile onset spinocerebellar ataxia is caused by recessive mutations in mitochondrial proteins Twinkle and Twinky

Infantile onset spinocerebellar ataxia (IOSCA) (MIM 271245) is a severe autosomal recessively inherited neurodegenerative disorder characterized by progressive atrophy of the cerebellum, brain stem and spinal cord and sensory axonal neuropathy. We report here the molecular background of this disease based on the positional cloning/candidate approach of the defective gene. Having established the linkage to chromosome 10q24, we restricted the critical DNA region using single nucleotide polymorphism-based haplotypes. After analyzing all positional candidate transcripts, we identified two point mutations in the gene C10orf2 encoding Twinkle, a mitochondrial deoxyribonucleic acid (mtDNA)-specific helicase, and a rarer splice variant Twinky, underlying IOSCA. The founder IOSCA mutation, homozygous in all but one of the patients, leads to a Y508C amino acid change in the polypeptides. One patient, heterozygous for Y508C, carries a silent coding region cytosine to thymine transition mutation in his paternal disease chromosome. This allele is expressed at a reduced level, causing the preponderance of messenger RNAs encoding Y508C polypeptides and thus leads to the IOSCA disease phenotype. Previously, we have shown that different mutations in this same gene cause autosomal dominant progressive external ophthalmoplegia (adPEO) with multiple mtDNA deletions (MIM 606075), a neuromuscular disorder sharing a spectrum of symptoms with IOSCA. IOSCA phenotype is the first recessive one due to Twinkle and Twinky mutations, the dominant PEO mutations affecting mtDNA maintenance, but in IOSCA, mtDNA stays intact. The severe neurological phenotype observed in IOSCA, a result of only a single amino acid substitution in Twinkle and Twinky, suggests that these proteins play a crucial role in the maintenance and/or function of specific affected neuronal subpopulations.

Alzheimer pathology associated with POLG1 mutation, multiple mtDNA deletions, and APOE4/4: premature ageing or just coincidence?

Alzheimer pathology associated with POLG1 mutation, multiple mtDNA deletions, and APOE4/4: premature ageing or just coicidence

POLG mutations and Alpers syndrome

Alpers-Huttenlocher syndrome (AHS) an autosomal recessive hepatocerebral syndrome of early onset, has been associated with mitochondrial DNA (mtDNA) depletion and mutations in polymerase gamma gene (POLG). We have identified POLG mutations in four patients with hepatocerebral syndrome and mtDNA depletion in liver, who fulfilled criteria for AHS. All were compound heterozygous for the G848S and W748S mutations, previously reported in patients with progressive external ophtalmoplegia or ataxia. We conclude that AHS should be included in the clinical spectrum of mtDNA depletion and is often associated with POLG mutations, which can cause either multiple mtDNA deletions or mtDNA depletion.

Deleted Mitochondrial DNA in Human Luteinized Granulosa Cells

The rearrangement of mitochondrial DNA in luteinized granulosa cells was determined in order to evaluate the fertilization capacity of oocytes and the development of embryos. Multiple deletions of mtDNA were found in luteinized granulosa cells from in vitro fertilization (IVF) patients. The 4977-base pair (bp) deletion was the most frequent deletion found in human granulosa cells. No significant difference was noted between mtDNA deletions of granulosa cells based on the fertilization capacity of oocytes and the development of embryos. To determine the relationship of proportions of mtDNA rearrangements with the aging process, granulosa cells were grouped into three different cohorts according to maternal age: younger than 32 years, between 32 and 37 years, and older than 37 years. No statistical correlation was noted between patient age and the frequency of occurrence of multiple mtDNA deletions. However, an increase in granulosa cell apoptosis was associated with an increase in mtDNA deletions. Accumulation of mtDNA deletions may contribute to mitochondrial dysfunction and impaired ATP production. We concluded that the accumulation of rearranged mtDNA in granulosa cells might not interfere with fertilization of human oocytes and further embryonic development; it was, however, associated with apoptosis processes.

Hearing Loss in Mitochondrial Disorders

Hearing loss is a common clinical feature in mitochondria-syndrome disorders. The underlining molecular etiology of hearing loss has not been fully investigated. In this study, 83 patients with mitochondrial syndromic hearing loss were evaluated clinically and their blood and tissue samples were examined molecularly. Using modified Walker's criteria, 31, 31, 14, and 7 patients had been classified as having definite, probable, possible, and unlikely diagnosis of mitochondrial disease, respectively. Deleterious mtDNA point mutations and/or abnormal mtDNA content or multiple deletions were identified in 20 patients with definite diagnosis and 2 patients with probable diagnosis. In addition to known, undisputed pathogenic mutations, several novel mutations believed to be clinically significant were found. Furthermore, abnormal mtDNA content and mtDNA deletions were found in some of the cases. Evaluation of clinical and diagnostic features associated with hearing loss revealed that cardiomyopathy, lactic acidosis, deficient respiratory chain enzyme complex activities, histochemical and ultrastructural abnormalities in mitochondria, and abnormal brain imaging results occurred significantly more frequently in patients with mtDNA alterations than in those without. This study revealed that the majority of the mtDNA defects in patients with mitochondrial syndromic hearing loss affect the overall mitochondrial gene expression.

Autosomal recessive mitochondrial ataxic syndrome due to mitochondrial polymerase γ mutations

To investigate three families and one sporadic case with a recessively inherited ataxic syndrome. Clinical and genetic studies were performed in six individuals. Southern blotting and real time PCR were used to detect deletions of mtDNA and mutations in the POLG gene were identified using a combination of DHPLC and direct DNA sequencing. The patients have a distinctive, progressive disorder that starts with episodic symptoms such as migraine-like headache or epilepsy. Ataxia, which is a combination of central and peripheral disease, develops later as does ophthalmoplegia. The commonest form of epilepsy was focal and involved the occipital lobes. Myoclonus was common and patients have a high risk of status epilepticus. MRI typically shows signal changes in the central cerebellum, olivary nuclei, occipital cortex, and thalami. COX negative muscle fibers were found in four of six; in one patient these were rare and in another absent. Multiple mtDNA deletions were identified in all patients, although in two these were not apparent on Southern blotting and real time PCR was required to demonstrate the defect. Two families were homozygous for a previously described POLG mutation, G1399A (A467T). One family and the sporadic case had the same two new mutations, a G to C at position 1491 (Q497H) and a G to C at 2243 (W748S). Mutations in POLG cause a recessively inherited syndrome with episodic features and progressive ataxia. Characteristic changes on MRI are seen and although skeletal muscle may appear morphologically normal, multiple mtDNA deletions can be detected using real-time PCR.

Quantitative analysis of mitochondrial DNA deletions in the brains of patients with bipolar disorder and schizophrenia

Several clinical, genetic and neuroimaging studies implicate mitochondrial dysfunction in the pathophysiology of bipolar disorder and schizophrenia. It has been reported that a mitochondrial DNA (mtDNA) deletion of 4,977 bp, known as the 'common deletion', is associated with both mental illnesses. A lack of normal age-related accumulation of this deletion in schizophrenia and increased occurrence of the common deletion in bipolar disorder have been reported. However, even in the affected bipolar samples, the levels of common deletion were relatively small, indicating that the common deletion did not play a pathophysiological role in respiratory function. We hypothesized that accumulation of multiple mtDNA deletions, rather than the common deletion alone, is involved in the pathophysiology of these two major mental disorders. To test this hypothesis, we assessed mtDNA deletion(s) by comparing the copy number of two regions in mtDNA -- ND1 and ND4 -- using real-time quantitative PCR in the frontal cortex of 84 subjects (30 control, 27 with bipolar disorder, and 27 with schizophrenia). We also assessed the relative amount of mtDNA vs. nuclear DNA and the expression level of DNA polymerase gamma (POLG), which is involved in replicating mtDNA. We observed no association between mtDNA deletions and the two major mental disorders in the frontal cortex, which did not support our hypothesis. We did, however, make the following observations, although they were not significant after Bonferroni correction: (1) the ratio of mtDNA to nuclear DNA was significantly higher in female patients with schizophrenia than in control females ( p =0.040) and (2) in bipolar disorder, the relative amount of mtDNA decreased with age ( p =0.016). furthermore, POLG expression was significantly up-regulated in bipolar disorder ( p =0.036). Our results suggest that abnormalities in the system maintaining replication of mtdna may underlie bipolar disorder and schizophrenia.